Long-chain non-coding RNA (Ribonucleic Acid) StDI1 and application thereof
By providing the potato long non-coding RNA StDI1 gene and regulating its expression level, drought-resistant transgenic plants were constructed, filling the gap in the regulatory mechanism of potato drought resistance breeding and improving the drought resistance of potatoes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-03-10
AI Technical Summary
The regulatory mechanism of long non-coding RNA (lncRNA) in potato response to drought stress is not yet clear in the existing technology, which affects the effectiveness of drought-resistant breeding.
This invention provides a long non-coding RNA StDI1 gene derived from potato and its biological materials. By overexpressing or negatively regulating its expression level, the drought resistance of plants can be regulated, and drought-resistant transgenic plants can be constructed.
It improved the drought resistance of potatoes, showed better growth status and physiological indicators, enhanced resistance to drought stress, and filled the gap in the study of lncRNA function in potatoes.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to long non-coding RNA StDI1 and its application. BACKGROUND
[0002] Drought, as one of the main abiotic stresses in the field of global agriculture, seriously restricts the yield and quality of crops. The application of molecular biology technology in crop genetic breeding provides an effective strategy to cope with the adverse effects of drought stress. Long non-coding RNA (lncRNA) refers to non-coding RNA with a length of more than 200 bp, which has no or weak protein coding ability. It has an indispensable regulatory function in the process of plant resistance to drought, extreme temperature, salt and alkali and other abiotic stresses, and can help plants cope with environmental stress by regulating gene expression, affecting chromatin structure and participating in signal transduction.
[0003] Potato occupies the fourth place in the global food security system, and its importance is only second to the three major cereals, but the potato root system is shallow, and it is sensitive to drought stress. Even short-term water shortage will lead to a decrease in potato tuber yield and quality, so breeding drought-resistant potato varieties is of great significance to stabilize food security.
[0004] Current studies have identified lncRNAs responding to drought stress in crops such as corn, tomato, and rice, but there have been no reports on the drought resistance regulation mechanism mediated by LncRNAs genes in potato. Therefore, it is of great significance to explore potato lncRNAs responding to drought stress and clarify their functions for genetic improvement and breeding of drought-resistant potato. SUMMARY
[0005] Therefore, the main purpose of the present application is to provide a long non-coding RNA StDI1 derived from potato, which clarifies its regulatory function in drought stress response, and provides new gene resources and theoretical support for genetic improvement and breeding of drought-resistant potato.
[0006] To achieve the above-mentioned purpose, the technical solutions of the present application are as follows: In a first aspect, the present application provides a long non-coding RNA StDI1 gene, the nucleotide sequence of the RNA StDI1 gene is shown in SEQ ID NO: 7, or a nucleotide sequence with more than 90% homology to SEQ ID NO: 7 and the same function formed by deleting, inserting, or replacing one or several nucleotides based on SEQ ID NO: 7.
[0007] In the second aspect of the present application, the long non-coding RNA StDI1 gene or the biological material containing the same is applied to breeding and / or screening drought-resistant plants.
[0008] In the third aspect of the present application, the long non-coding RNA StDI1 gene or the biological material containing the same is applied to constructing drought-resistant transgenic plants.
[0009] In the fourth aspect of the present application, the long non-coding RNA StDI1 gene or the biological material containing the same is applied to regulating drought resistance of plants.
[0010] In the present application, the biological material can be one or more of a recombinant expression vector, a recombinant microorganism, a transgenic cell line, a recombinant microorganism containing the recombinant expression vector, and a transgenic cell line containing the recombinant expression vector.
[0011] Further, the regulation comprises: positively regulating the expression level of the non-coding RNA StDI1 gene to improve the drought resistance of the plant; or, negatively regulating the expression level of the non-coding RNA StDI1 gene to reduce the drought resistance of the plant.
[0012] Further, the positive regulation is overexpression of the expression level of the non-coding RNA StDI1; and the negative regulation comprises knock-out, inhibition or silencing of the expression of the non-coding RNA StDI1.
[0013] Further, the plant comprises potato, tomato, rice, and corn.
[0014] In the fifth aspect of the present application, a biological material overexpressing the long non-coding RNA StDI1 gene is applied to any one of the following: (1) application in regulating drought resistance of potato; (2) application in breeding transgenic potato with improved drought resistance; (3) application in preparing a product for improving drought resistance of potato.
[0015] The present application further provides a method for improving drought resistance of potato, comprising overexpressing the non-coding RNA StDI1 gene in potato, wherein the nucleotide sequence of the non-coding RNA StDI1 gene is shown as SEQ ID No. 7.
[0016] The present application further provides a breeding method of transgenic potato with improved drought resistance, comprising the following steps: Overexpressing the non-coding RNA StDI1 gene in potato seeds, and then cultivating the potato, wherein the nucleotide sequence of the non-coding RNA StDI1 gene is shown as SEQ ID No. 7.
[0017] The present application has at least the following advantages: (1) The present application first explicitly defines the drought resistance function of the potato RNA StDI1 gene, and the transgenic potato plants overexpressing the gene show better growth state under drought stress: the wilting degree of the leaves is lighter, the relative water content is higher, and the in vitro leaf water loss rate is lower, compared with the wild type; at the same time, the transgenic plants can reduce the accumulation of H2O2 by improving the activities of antioxidant enzymes such as SOD and POD, and reduce the oxidative damage of potato. Under the conditions of 20% PEG-6000 simulated drought and natural drought, the root length, plant height and biomass of the transgenic plants are significantly better than those of the wild type, and the recovery ability after drought stress is stronger, which fills the blank of the function research of the lncRNA in potato.
[0018] (2) The RNA StDI1 gene provided by the present application can not only be used for genetic improvement of potato drought-resistant varieties, but also can provide important gene resources and technical references for drought-resistant molecular breeding of other crops, which has important significance for alleviating the influence of drought stress on agricultural production and ensuring food security. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 Transcript sequence alignment results.
[0020] Figure 2 Open reading frame analysis in the RNA StDI1 transcript.
[0021] Figure 3 Coding potential analysis of RNA StDI1.
[0022] Figure 4 Double enzyme digestion verification of the RNA StDI1 overexpression vector, M1: 10 KB Ladder; M2: DL15000 DNA Marker; 1: RNA StDI1-vector; 2: Kpn I and BamH I digested RNA StDI1-vector.
[0023] Figure 5For the identification of transgenic plants, A: PCR detection (1, 2, 3: overexpression lines; -: negative control, wild-type AC142; +: positive control pC2300S-RNA StDI1 plasmid; M: DNA Marker DL2000); B: relative expression level of RNAStDI1 gene in overexpression plants; * indicates a significant difference in RNA StDI1 gene expression level between transgenic lines and AC142, ** indicates an extremely significant difference in RNA StDI1 gene expression level between transgenic lines and AC142 (OE-1-OE-3: overexpression lines; AC142: wild-type plant).
[0024] Figure 6 The relative expression of the RNA StDI1 gene under drought treatment is shown in the column, where each column represents the mean ± SD (n=3); different lowercase letters indicate significant differences within the group (P < 0.05).
[0025] Figure 7 Morphological characteristics of potatoes under PEG-6000 treatment were analyzed. A: Plant growth under normal conditions; B: Plant growth under PEG-6000 stress; C: Root length; D: Plant height; E: Root fresh weight; F: Stem and leaf fresh weight; G: Stem and leaf dry weight; H: Root dry weight. Each column represents the mean ± SD (n=3). * (P<0.05) or ** (P<0.01) indicates that the results in AC142 are significant or highly significant.
[0026] Figure 8 Phenotypic identification of transgenic plants before and after drought: Before Drought: phenotype before natural drought treatment; Drought for 14d: phenotype after 14 days of natural drought treatment; scale bar: 10cm.
[0027] Figure 9 For the determination of water loss rate and relative water content of detached leaves of transgenic plants, A: relative water content (RWC); B: leaf water loss rate. Each column represents the average value ± SD (n=3); * (P<0.05) or ** (P<0.01) indicates that the results in AC142 are significant or highly significant.
[0028] Figure 10 For the analysis of drought-related physiological indicators of transgenic plants, A: SOD enzyme activity; B: POD enzyme activity; C: H2O2 content. Detailed Implementation
[0029] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0030] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are feasible for those skilled in the art. If the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.
[0031] The following specific embodiments illustrate the solution proposed in this invention: Example 1 1. Experimental Materials 1.1 Plant materials The tissue culture seedlings of the potato variety “AC142” were preserved and provided by the Potato Molecular Biology Breeding Laboratory of Gansu Agricultural University.
[0032] 1.2 Strains and Vectors competent Escherichia coli DH5 α The competent Agrobacterium GV3101 was purchased from Sangon Biotech (Shanghai) Co., Ltd.; the expression vector pC2300S (purchased from Beijing Coollab Technology Co., Ltd.) was stored in the Potato Molecular Biology Breeding Laboratory of Gansu Agricultural University.
[0033] 2 Experimental Methods 2.1 Cultivation of Plant Materials Subculture of tissue culture seedlings: Potato variety “AC142” was cut into stem segments with one or two leaves and inoculated into solid MS medium containing 3% sucrose. The cuttings were cultured for 30 days in a light incubator with a temperature of 24℃-25℃ and a photoperiod of 2500 Lx for 16h light / 8h dark. After that, the leaves were collected, flash-frozen in liquid nitrogen and stored at -80℃ for subsequent experiments.
[0034] Obtaining induced tubers: Tissue culture seedlings of potato variety “AC142” were inoculated into solid MS medium containing 8% sucrose by single-node cuttings and cultured in a light incubator with a temperature of 24℃-25℃ and a photoperiod of 2500 Lx for 16 h light / 8 h dark for nearly 30 days. When the plant height reached the mouth of the conical flask / wide-mouth flask, it was transferred to a dark environment for continued culture. After about 60 days, miniature test tube tubers were obtained.
[0035] 2.2 Potato RNA Extraction and cDNA Synthesis Total RNA was extracted from leaves of potato “AC142” tissue culture seedlings using the RNA Easy Fast Plant Tissue RNA Rapid Extraction Kit (Tiangen Biotech Co., Ltd.). The RNA was then reverse transcribed into cDNA using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix Reverse Transcription Kit (Beijing Quanshijin Biotechnology Co., Ltd.) and stored at -20℃ for later use.
[0036] 2.3 Bioinformatics analysis of the RNA StDI1 gene The sequence information of the RNA StDI1 gene was found in NCBI; transcriptional prediction analysis of RNA StDI1 was performed using the website (http: / / greenc.sequentiabiotech.com / wiki2 / Main_Page); the RNA StDI1 transcript sequence was aligned using DNAMAN; open reading frames in the RNA StDI1 transcript were found using NCBI ORF Finder (https: / / www.ncbi.nlm.nih.gov / orffinder / ); and the coding potential of RNA StDI1 was predicted using the Coding Potential Calculator website (http: / / cpc.cbi.pku.edu.cn / ).
[0037] 2.4 Construction of RNA StDI1 overexpression vector 2.4.1 Primer Design and Synthesis Based on the gene sequence of RNA StDI1 and the restriction enzyme sites (Kpn I and BamHI) of the vector pC2300S, specific primers pC2300S-RNA StDI1-F / R were designed. The primer sequences are as follows: pC2300S-RNA StDI1-F: GCTTTCGCGAGCTCGGTACCCAAAATCACCGTTAAAATTTTAGT (SEQ ID NO:1); pC2300S-RNA StDI1-R: TGCTCACCATGGATCCTTAGTTTTTAAATTATTTGCTTGGT (SEQ ID NO:2). The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0038] 2.4.2 Linearization of the overexpression vector pC2300S Extract the pC2300S empty vector plasmid and use... Kpn I (5' end) and Bam The reaction was performed using a double digestion reaction with HI (3' end) restriction endonuclease. The reaction system was as follows:Kpn Ⅰ 1.0μL, Bam HI 1.0 μL, 10×Quick Cut Buffer 2.0 μL, pC2300S plasmid (1 μg) 6.0 μL, ddH2O 10.0 μL. Reaction conditions: 37℃ for 30 min, 85℃ for 5 sec, 4℃ ∞. After separation of the enzyme digestion products by agarose gel electrophoresis, the linearized vector fragment was recovered.
[0039] 2.4.3 Homologous recombination of the target gene and the overexpression linearized vector The RNA StDI1 target fragment was amplified using cDNA extracted in section 2.2 as a template. The PCR reaction system consisted of: 10.0 μL of 2X M5 HiPerplus Taq HiFi PCR mix (with blue dye), 1.0 μL of cDNA, 1.0 μL each of forward and reverse primers, and 7.0 μL of ddH2O. The reaction conditions were: 95℃ for 3 min; 94℃ for 25 sec, 55℃ for 25 sec, 72℃ for 15 sec, 34 cycles; 72℃ for 5 min. After recovering the target fragment, homologous recombination was performed with the linearized pC2300S vector. The reaction system consisted of: 1.0 μL of the RNA StDI1 target fragment, 4.0 μL of the linearized pC2300S empty vector, and 5.0 μL of 2×Uniclone Seamless CloningMix. The ligation reaction was completed on a PCR instrument.
[0040] (1) The gene sequence of the target fragment of RNA StDI1 (StLncRNA23496) is shown in SEQ ID NO:7; (2) Reaction conditions and reaction system: Table 1 Cloning StLncRNA23496 PCR reaction system for gene CDS sequence
[0041] Table 2 Cloning StLncRNA23496 PCR reaction conditions for gene CDS sequences
[0042] Table 3 Enzyme digestion system of pC2300S plasmid
[0043] Table 4. PCR reaction conditions for double enzyme digestion of pC2300S plasmid
[0044] Table 5. Ligation reaction system of pC2300S plasmid
[0045] 2.4.4 Transformation and Identification of Recombinant Plasmids Transform the recombinant plasmid into DH5α α Escherichia coli competent cells were plated on LB agar containing kanamycin (Kan, 50 μg / mL) and incubated upside down at 37°C for 12–14 h. Single colonies were picked and cultured for identification by PCR. Positive clones were sequenced by Sangon Biotech (Shanghai) Co., Ltd. The recombinant plasmid with correct sequencing was named pC2300S-RNAStDI1 and transformed into Agrobacterium GV3101 competent cells using the heat shock method. Positive clones were identified by PCR. Glycerol culture containing the target band was prepared by mixing the positive bacterial culture with bacterial culture at a ratio of bacterial culture to glycerol of 1:1 and stored at -80°C for later use.
[0046] 2.5 Genetic transformation of the potato RNA StDI1 gene (1) Preparation of infection solution: Agrobacterium tumefaciens containing recombinant plasmid (pC2300S-RNA StDI1) was inoculated into LB liquid medium containing 50 mg / L Kan and 20 mg / L rifampin (Rif), and cultured at 28°C and 220 r / min with shaking until OD. 600 =0.5-0.6.
[0047] (2) Material processing and infection: Cut the “AC142” tissue culture potato into 2-3 mm thin slices and soak them in Agrobacterium suspension for 6-8 min, shaking continuously during the process to ensure that the bacterial solution is in full contact with the cut.
[0048] (3) Culture: After infection, the bacterial solution on the surface of the potato chips was dried with sterile paper, and the chips were spread evenly on a co-culture medium (containing 100 μL 1 mg / mL indoleacetic acid (IAA), 100 μL 2 mg / mL zeatin (ZT), 50 μL 1 mg / mL 6-benzylaminopurine (6-BA), and 50 μL 1 mg / mL gibberellin (GA3)). The chips were co-cultured in the dark at 22°C for 48 h. Then the chips were transferred to a differentiation medium (containing the above hormones and 75 μL 100 mg / mL cefotaxime sodium (Cef)). The medium was changed every 1-2 days until sprouting. When the sprouts reached about 2 cm in length, they were transplanted to a root screening medium (100 mg / L Cef). Plants that could root normally after three root screening processes were preliminarily identified as transgenic lines.
[0049] 2.6 Identification of transgenic plants 2.6.1 Marker gene identification Genomic DNA was extracted from transgenic plants and wild-type "AC142" plants, with neomycin phosphotransferase gene as the primary target. NPT IIGenetic primers NPT II-F and NPT II-R were designed. The sequence of NPT II-F is: GCTATGACTGGGCACAACAG (SEQ ID NO:3); the sequence of NPT II-R is: ATACCGTAAAGCACGAGGAA (SEQ ID NO:4). PCR amplification was performed using the following reaction system: 10.0 μL of 2X M5 HiPer plus Taq HiFi PCR mix, 1.0 μL of template, 1.0 μL each of the forward and reverse primers, and 7.0 μL of ddH2O. Detection was performed by 1% agarose gel electrophoresis; plants amplifying a 676 bp band were considered positive.
[0050] 2.6.2 Target gene expression analysis Total RNA was extracted from positive plants and reverse transcribed into cDNA. Primers for RNA StDI1-qPCR-F and RNA StDI1-qPCR-R were used. The sequence of RNA StDI1-qPCR-F was: GAGGTGATTGCGTTCAGAGGATTC (SEQ ID NO:5); the sequence of RNA StDI1-qPCR-R was: CCCAAAAGTATGACGGAAGGTATCTG (SEQ ID NO:6). α As an internal reference gene, the relative expression level of RNA StDI1 was detected by qRT-PCR. The reaction system consisted of 10.0 μL of 2×SYBR® Green qPCR MasterMix, 2.0 μL of cDNA, 0.4 μL each of forward and reverse primers, and 7.2 μL of ddH2O. Reaction conditions were: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 42 s, 35 cycles; 72℃ for 5 min; 4℃ infinity. 2 -ΔΔCt The expression level was calculated using a method that ultimately screened out three overexpressing transgenic plants: OE-1, OE-2, and OE-3.
[0051] 2.7 Analysis of drought resistance in transgenic plants under PEG-6000 stress Transgenic lines OE-1, OE-2, OE-3 and wild-type “AC142” tissue culture seedlings were propagated on 3% sucrose MS liquid medium. After 21 days of culture, the experimental groups were replaced with 20% PEG-6000 3% sucrose MS liquid medium, while the control group continued to use the original medium. All groups were cultured for 7 days. Root length, plant height, root fresh weight, root dry weight, stem and leaf fresh weight, and stem and leaf dry weight were measured. Data analysis was performed using a t-test, with the error bar representing the standard deviation of three biological replicates. Simultaneously, wild-type “AC142” potted seedlings were irrigated with 20% PEG-6000 solution. Leaf samples were taken at 0 h, 1 h, 3 h, 6 h, 12 h, and 24 h of stress. Three biological replicates were set up for each sample group, with three plants per replicate. The relative expression level of RNA StDI1 was analyzed by qRT-PCR, with the relative expression level of RNA StDI1 at 0 h serving as a control. -ΔΔCt The relative expression levels of the RNA StDI1 gene at different time points were calculated, and the significance levels between the experimental group and the control group were calculated by one-way ANOVA.
[0052] 2.8 Determination of physiological and biochemical indicators of transgenic plants under natural drought treatment (1) Phenotypic observation: Transgenic plants and wild-type plants with a height of about 30 cm were selected and subjected to natural drought for 0 days and 14 days to observe the phenotypic changes of the plants before and after drought.
[0053] (2) Measurement of physiological indicators: Determination of water loss rate from detached leaves: Leaves from the third to fifth layers of three potted seedlings (OE-1, OE-2, OE-3) and the wild-type plant "AC142" were randomly selected before and after 7 days of natural drought treatment, and their weights were recorded. The leaves were placed in a plant culture room at 25℃ and 20% humidity to lose water, and were weighed rapidly every 1 hour for six times, repeated three times. The initial weight of the leaf upon detachment was used to calculate the water loss rate.
[0054] Water loss rate = (initial fresh weight - weight after water loss) / initial fresh weight × 100%; Relative moisture content determination: Potato leaves from the third to fifth layers of each potted seedling line were collected and weighed; this weight is the fresh weight (FW). The leaves were then placed in a completely dark environment at 4°C to absorb water (distilled water) for 24 hours. The leaves were then removed, the surface moisture was blotted dry, and the leaves were weighed a second time; this weight is the saturated weight (TW). Finally, the leaves were dried in a 60°C oven until constant weight and weighed; this weight is the dry weight (DW). Each group was repeated three times.
[0055] Relative water content of leaves (RWC) = (FW - DW) / (TW - DW) × 100%; SOD, POD activity and H2O2 content determination: SOD and POD activity assay kits (micro-method) and H2O2 content assay kits (micro-method) were used to determine the content of samples before and after drought stress (all kits were purchased from Shanghai Youxuan Biotechnology Co., Ltd.). Each group was repeated three times.
[0056] 3 Results and Analysis 3.1 Bioinformatics analysis of RNA StDI1 Transcript prediction indicated that the RNA StDI1 transcripts included PGSC0003DMT400013670 (672 bp) and PGSC0003DMT400013671 (563 bp), with a 304 bp inverse complementary sequence. Figure 1 ORF analysis showed that its longest short peptide was +93aa, and it had no completely homologous protein-coding genes. Figure 2 CPC coding potential prediction showed a coding coefficient of 0.031787 < 1, indicating that RNA StDI1 does not have protein coding ability. Figure 3 ).
[0057] 3.2 Construction and validation of the overexpression vector pC2300S-RNA StDI1 The results of the double enzyme digestion verification showed that ( Figure 4 ), recombinant plasmids Kpn I and Bam After HI digestion, a 3523 bp band appeared, which is consistent with the expected size of the RNA StDI1 gene. Combined with the bacterial culture sequencing results, it is confirmed that the pC2300S-RNA StDI1 vector was successfully constructed.
[0058] 3.3 Identification of transgenic plants PCR amplification of specific selection marker genes on the vector NPT II. 1% agarose gel electrophoresis revealed a 676 bp band amplified in the genomic DNA of the transgenic plants, while no band was observed in the non-transgenic plants. As a result, three transgenic lines overexpressing OE-RNA (StDI1-1, StDI1-2, and StDI1-3) were selected. Figure 5 A), propagate the above-mentioned strains separately for subsequent experiments.
[0059] The relative expression of potato RNA StDI1 in overexpressing plants was further detected using qRT-PCR. Using the wild-type plant “AC142” as a control line, the results showed that the relative expression levels of RNA StDI1 in the OE-1, OE-2, and OE-3 lines were 2.93 times, 2.76 times, and 5.41 times that of the wild-type, respectively. Figure 5B), In summary, RNA StDI1 overexpressing plants have been successfully obtained.
[0060] 3.4 Analysis of drought resistance of transgenic plants under PEG-6000 stress To understand the drought resistance mechanism of the RNA StDI1 gene, wild-type plant “AC142” was subjected to PEG-6000 osmotic stress for 24 h. The relative expression level of the RNA StDI1 gene at 0 h, 1 h, 3 h, 6 h, 12 h, and 24 h of PEG stress was analyzed using qRT-PCR. The results showed that the expression level of the RNA StDI1 gene after drought treatment was significantly higher than that at 0 h without drought treatment. The relative expression level of the RNA StDI1 gene at 6 h was 23.9 times that at 0 h, at 12 h it was 53.7 times that at 0 h, and at 24 h it was 85.3 times that at 0 h, indicating that the expression level of the RNA StDI1 gene significantly increased with increasing drought stress duration. Figure 6 ).
[0061] To further investigate the function of the RNA StDI1 gene under drought conditions, transgenic overexpressing plants OE-1, OE-2, and OE-3, as well as wild-type plantlets "AC142," were subjected to PEG-6000 osmotic stress treatment. After 7 days of stress, the root length, root number, fresh weight, and dry weight of both the overexpressing plants OE-1, OE-2, and OE-3 and the wild-type "AC142" plantlets showed a decreasing trend under drought stress, but the decreasing trend was slower in the overexpressing plants than in the wild-type plants. Figure 7 (Table 6) shows that plants overexpressing the gene under drought stress grew better and were more drought-tolerant than wild-type plants. In summary, these results indicate that the RNA StDI1 gene can respond to drought stress and enhance the drought resistance of potato plants.
[0062] Table 6. Results of root length, plant height, root fresh weight, stem and leaf fresh weight, stem and leaf dry weight, and root dry weight of plants after PEG-6000 stress.
[0063] 3.5 Determination of physiological and biochemical indicators of transgenic plants under natural drought treatment RNA StDI1 overexpressing plants OE-1, OE-2, OE-3 and wild-type plant "AC142" were subjected to a 14-day natural drought treatment. Figure 8 It was observed that the "AC142" plants were more sensitive to drought stress, with leaves completely wilting and producing dead leaves, and stems bending and wrinkling; the OE-n overexpressing lines showed wilting and curling of leaf edges, but remained unfolded without producing dead leaves. The relative water content of leaves before and after drought was measured. Figure 9A) It was found that before drought stress, the relative water content of the two plants was not significantly different, except for OE-2, which showed a significant difference. After drought stress, the relative water content of both OE-n and "AC142" plants showed a decreasing trend, with the decrease in the OE-n line being smaller than that of the "AC142" line. Compared with "AC142", the relative water content of OE-1, OE-2, and OE-3 increased by 16.52%, 17.15%, and 18.31%, respectively. Subsequently, the water loss rate of detached leaves of OE-n and "AC142" plants within 6 hours was measured, and the results showed ( Figure 9 B), "AC142" loses water faster and its curve rises more significantly compared to the transgenic line OE-n.
[0064] After 7 and 14 days of drought, the SOD and POD activities of the overexpressing lines were significantly higher than those of the wild type, while the H2O2 content was significantly lower than that of the wild type. Figure 10 This indicates that overexpression of the RNA StDI1 gene can enhance plant drought resistance by increasing antioxidant enzyme activity and reducing reactive oxygen species accumulation.
[0065] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.
[0066] The sequence numbers of the above embodiments of the present invention are for descriptive purposes only and do not represent the superiority or inferiority of the embodiments.
[0067] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A long non-coding RNA StDI1 gene, characterized by, The nucleotide sequence of the RNA StDI1 gene is shown in SEQ ID NO: 7, or a nucleotide sequence having > 90% homology with the sequence shown in SEQ ID NO:
7.
2. Use of the long-chain non-coding RNA StDI1 gene or biological material containing the same of claim 1 in breeding and / or screening drought-resistant plants.
3. Use of the long-chain non-coding RNA StDI1 gene or biological material containing the same of claim 1 in constructing drought-resistant transgenic plants.
4. Use of the long-chain non-coding RNA StDI1 gene or biological material containing the same of claim 1 in regulating drought resistance of plants.
5. Use according to claim 4, characterized in that, The regulation comprises: up-regulating the expression level of the non-coding RNA StDI1 gene to improve the drought resistance of plants; or down-regulating the expression level of the non-coding RNA StDI1 gene to reduce the drought resistance of plants.
6. Use according to claim 5, characterized in that, The up-regulation is overexpression of the expression level of the non-coding RNA StDI1 gene; the down-regulation comprises knock-out, inhibition or silencing of the expression of the non-coding RNA StDI1 gene.
7. Use according to any one of claims 2 to 6, characterized in that, The plants include potato, tomato, rice and corn.
8. Use of a biological material overexpressing the long-chain non-coding RNA StDI1 gene of claim 1 in any of the following: (1) in regulating drought resistance of potato; (2) in breeding transgenic potato with improved drought resistance; (3) in preparing a product for improving drought resistance of potato.
9. A method of increasing drought tolerance in potato plants, characterized in that, The non-coding RNA StDI1 gene overexpressed in potato has a nucleotide sequence shown in SEQ ID No.
7.
10. A method of breeding a transgenic potato having increased drought tolerance, comprising, The method comprises the following steps: overexpressing the non-coding RNA StDI1 gene in potato seeds, and then cultivating the potato seeds into potato, wherein the non-coding RNA StDI1 gene has a nucleotide sequence shown in SEQ ID No. 7.
Citation Information
Patent Citations
Potato high-temperature response lncRNA and application thereof
CN114807137A
StPYL2 gene with drought resistance and application thereof
CN118325917A
Application of long-chain non-coding RNA gene StlncPDR-AS in potato disease-resistant breeding
CN118581142A
Application of StDND1 gene in improvement of drought resistance of potatoes
CN118853734A