FISH probe combination and kit for detecting NECTIN4 gene amplification as well as preparation method and application of FISH probe combination and kit
By optimizing the preparation of the NECTIN4 gene probe and the chromosome 1 internal reference probe, the problems of insufficient signal intensity and specificity in the existing technology have been solved, and rapid and accurate NECTIN4 gene amplification detection has been achieved, supporting clinical auxiliary diagnosis and prognosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-30
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies lack rapid and accurate fluorescence in situ hybridization (FISH) kits for detecting NECTIN4 gene amplification. FISH probe combinations have insufficient signal intensity and specificity, failing to meet the needs of rapid clinical testing.
By optimizing the preparation of NECTIN4 gene probes and chromosome 1 internal reference probes, a 400 kb segment covering the NECTIN4 gene was selected. Uniform short probes were obtained using ultrasonic fragmentation technology. Centromere sequences with better specificity were screened using bioinformatics methods, and signal intensity and specificity were improved by combining fluorescent labeling.
It achieves rapid, stable, and accurate detection of NECTIN4 gene amplification, improves signal intensity and specificity, is suitable for clinical auxiliary diagnosis and prognosis, and supports individualized treatment.
Smart Images

Figure CN121629052A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology and medicine, and particularly relates to a FISH probe combination for detecting NECTIN4 gene amplification, a kit, a preparation method and application thereof. BACKGROUND
[0002] NECTIN4 is an immunoglobulin-like molecule, homologous to poliovirus receptor (PVR / CD155), also known as poliovirus receptor-related protein PVRL4, located at 1q23.3. It belongs to the Nectins family of immunoglobulin-like molecules, which contains 4 members, NECTIN1, NECTIN2, NECTIN3 and NECTIN4, all of which are single-pass transmembrane proteins, belonging to the Ca 2 + dependent immunoglobulin-like molecules.
[0003] In recent years, it has been found that NECTIN4 is overexpressed in various malignant tumors, including breast cancer, ovarian cancer, colorectal cancer, prostate cancer and lung cancer. In addition to the membrane form, the serum NECTIN4 level of patients with non-small cell lung cancer or serous ovarian cancer is significantly increased, and the first ADC drug targeting NECTIN4 (Enfortumab Vedotin-ejfv, hereinafter referred to as EV) has been approved for the treatment of urothelial carcinoma. Studies have shown that NECTIN4 gene amplification can serve as a potential prognostic marker to help identify a patient population sensitive to EV, providing data support for future clinical trials and individualized treatment, and is a promising tumor research target.
[0004] Fluorescence in situ hybridization (FISH) is a cytogenetic molecular diagnostic technique that uses fluorescently labeled known nucleic acid molecules as probes to hybridize with sample DNA after denaturation, and observes the hybridization signal under a fluorescence microscope. As a classical technique most widely used in clinical pathology detection in recent years, FISH can be used to detect gene amplification, gene deletion, gene breakage, gene fusion, and chromosomal number abnormalities, and has the functions of guiding treatment, assisting diagnosis, differential diagnosis and judging prognosis in clinical practice.
[0005] FISH gene probe is usually prepared by nick translation method using BAC bacteria, and the probe length is not uniform and has wide coverage, and usually needs overnight hybridization for detection, which cannot meet the demand of rapid detection; in addition, the signal intensity and specificity of the probes prepared from different segments of the target site are obviously different, which affects the judgment, so the optimization and selection of the target site region are also extremely important. The satellite DNA region of the human centromere segment, which is highly repetitive, is generally selected as the internal reference of gene amplification probe, and its size is different from 0.2 Mb to 6.2 Mb, but the sequence specificity is low, and non-specific signal is easy to appear in the reagent application, which affects the accuracy. Especially, the satellite DNA sequence of chromosome 1 is highly shared with other chromosomes, so it is particularly important to screen a specific centromere segment and its primer.
[0006] There is no probe combination and corresponding kit for fluorescence in situ hybridization detection of chromosome 1 and NECTIN4 in the prior art, and there is a lack of a rapid and accurate NECTIN4 gene amplification detection scheme, therefore, at present, it is urgent to provide a fluorescence in situ hybridization detection kit which can rapidly, stably and accurately detect the amplification of NECTIN4 and can be applied to auxiliary diagnosis and prognosis. SUMMARY
[0007] In view of the deficiencies in the prior art, the purpose of the present application is to provide a FISH probe combination, kit and preparation method and application for detecting NECTIN4 gene amplification. High expression of NECTIN4 can promote various evolution mechanisms of tumors, such as cell proliferation and differentiation, angiogenesis, lymphangiogenesis and lymphatic metastasis, and tumor patients often have poor prognosis. The present application solves the problems of low signal intensity, poor specificity and low signal-to-noise ratio by analyzing specific NECTIN4 segments and chromosome 1 centromere segments and combining labeling methods, and provides a preparation scheme of NECTIN4 gene amplification detection probe, which can be used to detect the NECTIN4 gene amplification of patients and provide data support for future clinical trials and individualized treatment.
[0008] To achieve the purpose of the present application, the following technical solutions are adopted:
[0009] In a first aspect, the present application provides a FISH probe combination for detecting NECTIN4 gene amplification, which comprises: a NECTIN4 gene probe and a chromosome 1 internal reference probe;
[0010] The preparation template of the NECTIN4 gene probe is composed of any one of the BAC cloning plasmids shown in (1)-(3) as follows:
[0011] (1) BAC cloning plasmid RP11-157H6, CTD-3003O12 and RP11-4N6;
[0012] (2) BAC clone plasmid CTD-2299J15 and CTD-2502B20;
[0013] (3) BAC clone plasmid CTD-2502B20.
[0014] The application provides a preparation scheme of a NECTIN4 gene amplification detection probe kit, which can quickly, stably and accurately detect the amplification of NECTIN4 and can be applied to aspects such as auxiliary diagnosis and prognosis judgment.
[0015] FISH products usually have defects such as poor signal brightness, specificity and signal-to-noise ratio, which are often related to probe segment selection and probe preparation schemes. The application optimizes and investigates different probe segments, screens the optimal probe segment, and optimizes the probe preparation scheme, further ensuring signal strength, specificity and signal-to-noise ratio.
[0016] Specifically, the application selects a NECTIN4 gene probe covering a segment of about 400 kb of the NECTIN4 gene, further ensuring signal strength, specificity and signal-to-noise ratio. FISH detection is labeled with a fluorescent dye, and the fluorescent signal needs to be observed by the naked eye. The resolution of the naked eye is limited, and short FISH probes are not easy to observe due to weak signal strength and are prone to misjudgment. On the contrary, although the signal strength is sufficient, the specificity may be poor. In view of the above problems, the NECTIN4 gene coverage range in the application is selected to be about 200 kb, ensuring signal strength and specificity. The ultrasonic breaking method is used to obtain short probes with uniform fragments, and rapid hybridization can be performed at the same time.
[0017] Preferably, the preparation template of the NECTIN4 gene probe is BAC clone plasmid CTD-2502B20.
[0018] Preferably, the sequence of the No. 1 chromosome internal reference probe comprises any one of SEQ ID NO: 1-3, preferably SEQ ID NO: 2.
[0019] The existing disclosed sequence screening method obtains a short fragment (≤50 bp) which is only suitable for nucleic acid synthesis marking method, is not conducive to enzyme marking and signal is affected by the number of fluorescent modification. The application obtains 60 groups of candidate sequences through downloading about 5 Mb sequence of human chromosome 1 satellite DNA and splitting to about 300 bp fragments in turn, and roughly comparing specificity with other centromere sequences. The slightly better specific sequence SEQ ID NO:1 is obtained through analyzing the matching with other centromeres one by one, and the corresponding specific primers F1 and R1 are designed. The high specificity sequence SEQ ID NO:2 is further obtained through screening by deleting or displacing 5-10 bp, and another high specificity sequence SEQ ID NO:3 is obtained, and the target sequence length is 100-200 bp. The corresponding specific primers F2, R2 and F3, R3 are designed.
[0020] The application utilizes bioinformatics means to compare and analyze a large number of centromere satellite DNA sequences, and analyzes to obtain the better specific sequence SEQ ID NO:2.
[0021] Preferably, the fluorescent labels of the NECTIN4 gene probe and the chromosome 1 internal reference probe are different; and the fluorescent labels are selected from red fluorescent labels or green fluorescent labels.
[0022] In the application, the chromosome 1 internal reference probe: the target sequence is labeled with a fluorescent signal through PCR, so that an additional labeling step is omitted and a better labeling effect can be obtained.
[0023] The NECTIN4 gene probe: the plasmid DNA labeled with fluorescence is broken by ultrasonic, and the hybridization effect is good.
[0024] Preferably, the fluorescent labels are dUTP.
[0025] Preferably, the red fluorescent label is TRITC.
[0026] Preferably, the green fluorescent label is Fluorescein.
[0027] Preferably, the 5' end of the chromosome 1 internal reference probe further contains a fluorescent modification group, and the excitation wavelength and emission wavelength of the fluorescent modification group are similar to the excitation wavelength and emission wavelength of the fluorescent label on the dUTP.
[0028] In the application, the fluorescent embedding rate is increased by incorporating fluorescence into the sequence and modifying the primer end fluorescence, and a better hybridization fluorescent signal is obtained.
[0029] Secondly, the present invention provides a method for preparing the FISH probe combination for detecting NECTIN4 gene amplification as described in the first aspect, the preparation method comprising:
[0030] (A) Preparation method of NECTIN4 gene probe: Plasmid DNA was fluorescently labeled by nick translation and then fragmented by sonication;
[0031] (B) Preparation method of chromosome 1 internal reference probe: Using the human genome as a template, fluorescein is labeled into the PCR product by PCR labeling method.
[0032] In this invention, the length of the NECTIN4 gene probe is controllable, the internal reference probe on chromosome 1 has good specificity, the fluorescence incorporation efficiency is high, the signal-to-noise ratio is excellent, and it is suitable for rapid hybridization.
[0033] Preferably, in step (A), the fluorescently labeled plasmid DNA is ultrasonically fragmented; the fragment of the fluorescently labeled plasmid DNA fragmented by ultrasonication is 150-300 bp.
[0034] Preferably, in step (A), the reaction system for fluorescently labeling plasmid DNA includes: buffer, dNTPs, fluorescently labeled dUTP, DNase I, DNA polymerase I, and plasmid DNA.
[0035] Preferably, the dNTPs include dATP, dCTP, dGTP, and dTTP.
[0036] In this invention, the concentrations of dATP, dCTP, and dGTP are the same and higher than the concentration of dTTP.
[0037] Preferably, in the reaction system, the molar concentration ratio of dTTP to TRITC-dUTP is 3:(1.5-2.5), for example, it can be 3:1.5, 3:1.8, 3:2, 3:2.2 or 3:2.5, etc.
[0038] In this invention, the optimal molar ratio of dTTP to TRITC-dUTP is 3:(1.5-2.5), which can achieve better fluorescence incorporation and affect the fluorescence signal intensity.
[0039] Preferably, in step (A), the reaction procedure for fluorescently labeling plasmid DNA is to incubate at 15-25℃ (e.g., 15℃, 16℃, 18℃, 20℃, 22℃, 24℃ or 25℃, etc.) for 1-4 hours (e.g., 1 hour, 2 hours, 3 hours or 4 hours, etc.) and then incubate at 80℃ for 10 minutes.
[0040] Preferably, in step (B), the primer sequence for amplifying the internal reference probe of chromosome 1 includes: as shown in SEQ ID NO:4-9; more preferably, as shown in SEQ ID NO:6-7.
[0041] Preferably, the 5' end of the primer also contains a fluorescent modifying group.
[0042] Preferably, in step (B), the reaction system of the PCR labeling method includes: buffer, MgCl2, dNTPs, fluorescently labeled dUTP, amplification template, amplification primers, and DNA polymerase.
[0043] Preferably, the dNTPs include dATP, dCTP, dGTP, and dTTP.
[0044] In this invention, the concentrations of dATP, dCTP, and dGTP are the same and higher than the concentration of dTTP.
[0045] Preferably, in the reaction system, the molar ratio of dTTP to fluorescently labeled dUTP is 3:(0.5-2), for example, it can be 3:0.5, 3:0.8, 3:1, 3:1.2, 3:1.4, 3:1.5, 3:1.6, 3:1.8 or 3:2, etc.
[0046] In this invention, the optimal molar ratio of dTTP to fluorescently labeled dUTP is 3:(0.5-2), which can achieve better fluorescence incorporation and affect the fluorescence signal intensity.
[0047] Thirdly, the present invention provides a FISH kit for detecting NECTIN4 gene amplification, the kit comprising: the FISH probe combination for detecting NECTIN4 gene amplification as described in the first aspect.
[0048] Preferably, the kit further includes any one or a combination of at least two of the following: hybridization buffer, digestion solution, or in situ hybridization blue staining solution.
[0049] Preferably, the hybridization buffer contains sodium citrate buffer (SSC), deionized formamide, and dextran sulfate (DSS).
[0050] Preferably, the concentration of deionized formamide in the hybridization buffer is 40%-60%, for example, it can be 40%, 45%, 50%, 55% or 60%, etc.
[0051] Preferably, the concentration of dextran sulfate in the hybridization buffer is 0.1-0.2 g / mL, for example, it can be 0.1 g / mL, 0.15 g / mL or 0.2 g / mL, etc.
[0052] Preferably, the digestive fluid includes pepsin.
[0053] Fourthly, the present invention provides a method of using the FISH kit for detecting NECTIN4 gene amplification as described in the third aspect for purposes other than disease diagnosis and / or treatment. The method of use includes: digesting the sample with a digestive solution, adding the FISH probe combination for detecting NECTIN4 gene amplification as described in the first aspect for denaturation and hybridization, staining, and observation.
[0054] Preferably, the final concentration of the digestive fluid is 4 mg / mL.
[0055] Preferably, the digestion time is 3-15 minutes, for example, 3 minutes, 5 minutes, 10 minutes or 15 minutes.
[0056] Preferably, the final concentration of the FISH probe combination is: NECTIN4 is 5-10 ng / μL, for example, it can be 5 ng / μL, 6 ng / μL, 7 ng / μL, 8 ng / μL, 9 ng / μL or 10 ng / μL, etc., preferably 8 ng / μL; chromosome 1 internal reference probe is 2-5 ng / μL, for example, it can be 2 ng / μL, 3 ng / μL, 4 ng / μL or 5 ng / μL, etc., preferably 2.5 ng / μL.
[0057] Preferably, the denaturation and hybridization conditions are: denaturation at 82°C for 2-5 minutes (e.g., 2 minutes, 3 minutes, 4 minutes, or 5 minutes), and hybridization at 42°C for 1-18 hours (e.g., 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, or 18 hours).
[0058] Preferably, the method of use further includes a step of using a permeabilizing agent for permeation.
[0059] Fifthly, the present invention provides an apparatus for detecting NECTIN4 gene amplification, the apparatus simultaneously detecting the NECTIN4 gene and an internal reference on chromosome 1; the apparatus comprises:
[0060] Preprocessing module: used to digest and / or permeate the sample to be tested;
[0061] Hybridization module: Uses a combination of FISH probes to denature and hybridize samples;
[0062] Color development and analysis module: The hybridized samples are stained with in situ hybridization staining solution and then analyzed.
[0063] In a sixth aspect, the present invention provides the application of any one or at least a combination of two of the FISH probe combination for detecting NECTIN4 gene amplification described in the first aspect, the FISH kit for detecting NECTIN4 gene amplification described in the third aspect, or the device for detecting NECTIN4 gene amplification described in the fifth aspect in the preparation of products for detecting NECTIN4 gene amplification.
[0064] The numerical range described in this invention includes not only the point values listed above, but also any point values within the numerical ranges not listed above. Due to space limitations and for the sake of brevity, this invention will not exhaustively list all the specific point values included in the range.
[0065] Compared with the prior art, the present invention has the following beneficial effects:
[0066] (1) This invention selects a probe covering approximately 400 kb of the NECTIN4 gene to further ensure signal strength and specificity and improve the signal-to-noise ratio. FISH detection uses fluorescent dyes to label DNA, and the fluorescent signal ultimately needs to be observed by the naked eye. However, the resolution of the naked eye is limited. Short FISH probe segments have weak signal intensity, are difficult to observe, and are prone to misinterpretation; conversely, excessively long probes may have sufficient signal strength but may have poor specificity. To address the above problems, this invention selects a NECTIN4 gene coverage of approximately 200 kb to ensure signal strength and specificity. Short probes with relatively uniform fragments are obtained using ultrasonic fragmentation, which also allows for rapid hybridization.
[0067] (2) To address the issue of poor probe specificity affecting interpretation due to the high degree of centromere sharing between chromosome 1 and other chromosomes, this invention utilizes bioinformatics techniques to conduct extensive comparative analysis of centromere satellite DNA sequences, thereby obtaining sequences with better specificity.
[0068] (3) The present invention optimizes the probe labeling scheme to improve signal intensity. The ratio of dTTP:TRITC-dUTP in the NECTIN4 probe labeling is optimized to increase the fluorescence embedding ratio, so as to obtain better signal intensity at a shorter coverage length; the chromosome 1 centromere probe is labeled with fluorescein in the PCR primer, and the ratio of dTTP:Fluorescein-dUTP is adjusted to obtain a higher fluorescence embedding ratio and improve signal brightness. Attached Figure Description
[0069] Figure 1 This is a staining image of the NECTIN4 gene probe from the kit in Example 2 (magnification 1000×).
[0070] Figure 2 This is a staining image of chromosome 1 internal reference probe from kit 2 (magnification 1000×).
[0071] Figure 3 This is a merge staining image (magnification 1000×) of the NECTIN4 gene probe and chromosome 1 internal reference probe from a human peripheral blood culture cell sample.
[0072] Figure 4 This is a staining image of a formalin-fixed paraffin-embedded sample (magnification 1000×).
[0073] Figure 5 This is a staining image of chromosome 1 internal control probe from kit 8 (magnification 1000×).
[0074] Figure 6 This is a staining image of chromosome 1 internal control probe from kit 9 (magnification 1000×).
[0075] Figure 7 This is a staining image of a sample without NECTIN4 gene amplification (magnification 1000×).
[0076] Figure 8 This is a staining image of a NECTIN4 gene multisomal sample (magnification 1000×).
[0077] Figure 9 This is a staining image of a NECTIN4 gene amplification sample (magnification 1000×). Detailed Implementation
[0078] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.
[0079] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0080] Example 1
[0081] This embodiment provides a FISH probe combination for detecting NECTIN4 gene amplification and its preparation method.
[0082] (1) Probe design: It includes two probes, the NECTIN4 gene probe and the chromosome 1 internal reference probe.
[0083] (a) NECTIN4 gene probe.
[0084] Download the UCSC gene covering approximately 400 kb of the NECTIN4 gene. Select any one of the following: chr1:160,773,443-161,218,447 (445 kb), chr1:160,911,057-161,199,157 (289 kb), or chr1:160,915,797-161,105,096 (189 kb). Select the corresponding appropriate BAC clones: RP11-157H6, CTD-3003O12, and RP11-4N6; CTD-2299J15 and CTD-2502B20; CTD-2502B20.
[0085] (b) Centromere probe of chromosome 1.
[0086] In this embodiment, approximately 5 Mb of human genome chromosome 1 satellite DNA sequence was downloaded and sequentially fragmented into approximately 300 bp segments. After rough specificity comparison with other centromere sequences, 60 candidate sequences were obtained. By analyzing the matching between each sequence and other centromeres, a slightly more specific sequence SEQ ID NO:1 was obtained, and corresponding specific primers F1 and R1 were designed. Further screening was performed by deletion or shifting of 5-10 bp to obtain a highly specific sequence SEQ ID NO:2, and another highly specific sequence SEQ ID NO:3 was also obtained, with a target sequence length of 100-200 bp. Corresponding specific primers F2, R2 and F3, R3 were designed.
[0087] SEQ ID NO:1:
[0088] CGATTGAGTTCAACTCACAGAGCTGAACATTCCTTTGGATGGAGCAGTTTCCAAACACACTTTGTGTAGAATCTGCAAGTGGAGATTTGGACCGCTCTGAGGATTTCGTTGGATACGGGAGAAAACTCACCTACGTAAACAGAAGCATTC TCAGAACCTTCTTCGTGATGCTTGCATTCAACTCACAGTGTTGAACCTTTCTCTGACAGTTCAGGTTTGAAACACTCCTTCTGCAGAATCTGCAAGTGGAGATTTGGACCTCTTTGAGGCCGATCGTAGTAAAGGAAAGAACTTCATCTA.
[0089] SEQ ID NO:2:
[0090] GGATACGGGAGAAAACTCACCTACGTAAACAGAAGCATTCTCAGAACCTTCTTCGTGATGCTTGCATTCAACTCACAGTGTTGAACCTTTCTCTGACAGTTCAGGTTT.
[0091] SEQ ID NO:3:
[0092] TCCGTTTGGAAACACACTTTTGGTAGAATCTTAAAGGGGAGATTTGAACCGCTTTGAGGCCTATGGCAGTAGAGGATATAACTGCACATAAAAACGAGACAGGAGCATTCCCAGGAAACACTTTGTGACGATTGAG.
[0093] F1 (SEQ ID NO:4): CGATTGAGTTCAACTCACAGAGCT.
[0094] R1 (SEQ ID NO:5):TAGATGAAGTTCTTTCCTTTACTACGAT.
[0095] F2 (SEQ ID NO: 6): GGATACGGGAGAAAACTCACCTAC.
[0096] R2 (SEQ ID NO:7): AAACCTGAACTATCAGAGAAAGGTTC.
[0097] F3 (SEQ ID NO:8): TCCGTTTGGAAACACACTTTTG.
[0098] R3 (SEQ ID NO:9): CTCAATCGTCACAAAGTGTTTCC.
[0099] (2) Probe labeling and preparation.
[0100] (a) NECTIN4 gene probe.
[0101] Plasmid extraction: Using a commercially available plasmid extraction kit, plasmids were extracted from the BAC clones according to the kit instructions to obtain plasmid DNA, which was then quantified using Nanodrop 2000.
[0102] Probe labeling: Plasmid DNA was fluorescently labeled using TRITC-dUTP (orange-red) (Roche, 11534378910) based on a nick translation method. The reaction system was prepared on ice under strictly dark conditions, and the probe labeling reaction system is shown in Table 1 below. A molar ratio of dTTP:TRITC-dUTP of 3:2 yielded better signal intensity.
[0103] Table 1
[0104]
[0105] The reaction procedure was to incubate at 25°C for 2 hours and then at 80°C for 10 minutes.
[0106] After the reaction, the DNA fragments were broken down to 150 bp using a Covaris M220 ultrasonic DNA disruptor (maximum incident power (PIP): 50, duty factor: 20, cycles per burst: 200, treatment time (s): 350). A 5 μL sample was then analyzed by 2% agarose gel electrophoresis. The remaining products were purified and recovered according to the MinElute PCR Purification Kit instructions to prepare the NECTIN4 gene probe. DNA concentration and the peak absorption at 550 nM were measured to confirm product concentration and labeling efficiency.
[0107] (b) Centromere probe of chromosome 1.
[0108] Using the human genome as a template, Fluorescein-dUTP (green) (Roche, 11373242910) was added to replace dTTP for PCR amplification. The PCR reaction system is shown in Table 2. Fluorescence was incorporated into the PCR product to obtain fluorescent PCR products. A dTTP:Fluorescein-dUTP ratio of 3:1 (molar concentration ratio) yielded the highest fluorescence intercalation efficiency.
[0109] Table 2
[0110]
[0111] The Alexa Fluor 488 modifier was added to the 5' end of both the upstream and downstream primers during synthesis to further increase the fluorescence signal intensity. The PCR procedure is shown in Table 3.
[0112] Table 3
[0113]
[0114] After the PCR reaction, 5 μL of the product was analyzed by 2% agarose gel electrophoresis, which showed a bright band at approximately 100 bp. The remaining product was purified and recovered according to the MinElute PCR Purification Kit instructions to prepare the chromosome 1 centromere probe. The DNA concentration and the peak absorption at 495 nM were measured to confirm the product concentration and labeling efficiency.
[0115] Example 2
[0116] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The kit includes a NECTIN4 gene probe, a chromosome 1 internal control probe, hybridization buffer, digestion solution, and in situ hybridization staining solution.
[0117] The template for preparing the NECTIN4 gene probe was the BAC cloning plasmid CTD-2502B20. The preparation method of the NECTIN4 gene probe is as described in Example 1.
[0118] The sequence of the chromosome 1 internal reference probe is SEQ ID NO:2. The preparation method of the chromosome 1 internal reference probe is as described in Example 1.
[0119] The digestive fluid is pepsin (Anbiping).
[0120] Probe hybridization solution preparation: The hybridization buffer contains sodium citrate buffer (SSC), deionized formamide and dextran sulfate (DSS), wherein the concentration of deionized formamide is 40% and the concentration of DSS is 0.1 g / mL.
[0121] The reagent composition and preparation are shown in Table 4 below.
[0122] Table 4
[0123]
[0124] Test Example 1
[0125] The sensitivity, specificity, and signal intensity were evaluated using the FISH kit for detecting NECTIN4 gene amplification described in Example 2.
[0126] 1. Hybridization detection of human peripheral blood cultured cell samples.
[0127] (1) Sample processing: After resuspending the cells, take 3 μL of cell suspension and add it to a glass slide, and let it air dry at room temperature; with the slide facing up, add 200 μL of working pepsin solution (final concentration of 4 mg / mL) and digest for 5 minutes; add 2×SSC and incubate at room temperature for 5 minutes; use 70%, 90% and 100% ethanol gradient dehydration, and incubate for 2 minutes each; take out the glass slide and let it air dry at room temperature.
[0128] (2) Denaturation hybridization: Add 10 μL of probe hybridization solution to the hybridization area and seal the slide; denature at 82℃ for 2 minutes and hybridize at 42℃ for 1-18 hours.
[0129] (3) Washing after hybridization: Carefully remove the coverslip and wash the sample slide in 0.3% NP-40 / 1×SSC preheated at 72±1℃ for 2 minutes; then wash it in 0.1% NP-40 / 2×SSC at 37±1℃ for 30 seconds; soak it in 70% ethanol at room temperature for 3 minutes.
[0130] (4) Counterstaining: Dry in the dark, add 10 μL of in situ hybridization blue staining solution (DAPI) for staining, store in the dark and observe.
[0131] Figure 1 The image shows the staining of the NECTIN4 gene probe from the kit in Example 2. In metaphase cells, a clear and bright red signal is visible in the 1q23.3 region, with no other fluorescent signals observed, indicating a high signal-to-noise ratio. In interphase cells, two distinct red signals are visible, with no other fluorescent signals observed, also indicating a high signal-to-noise ratio. The NECTIN4 gene probe of this invention exhibits high specificity and high detection accuracy.
[0132] Figure 2 This is a staining image of the chromosome 1 internal control probe in the kit of Example 2. In metaphase cells, a clear and bright green signal is visible in the centromere region, with no other fluorescent signals observed, indicating a high signal-to-noise ratio. In interphase cells, two distinct green signals are visible, with no other fluorescent signals observed, also indicating a high signal-to-noise ratio. The chromosome 1 centromere probe of this invention exhibits high specificity and high detection accuracy.
[0133] Figure 3 Merge staining of NECTIN4 gene probe and chromosome 1 internal reference probe in human peripheral blood cultured cell samples.
[0134] 2. Formalin-fixed paraffin-embedded samples.
[0135] Sample preparation: Place the sample slides on a 65℃ constant temperature heating plate and bake for 5-30 minutes; place the samples in an environmentally friendly dewaxing agent at room temperature for 10 minutes to dewax; place them in anhydrous ethanol at room temperature for 10 minutes to remove residual dewaxing agent; then place them in anhydrous ethanol at room temperature, 90% ethanol, 70% ethanol, and purified water for 3 minutes each for rehydration; place the sample slides in purified water at 95-100℃ and boil for 25 minutes; after the sample slides are air-dried, add 100-200 μL of pepsin working solution and digest at 37±1℃ for 3-15 minutes; wash in 2×SSC at room temperature for 3 minutes; then place them in anhydrous ethanol at room temperature, 70%, 90%, and 100% for 2 minutes each for dehydration, and air-dry at room temperature.
[0136] Denaturation hybridization: Add 10 μL of probe hybridization solution to the hybridization area and mount the slide; denature at 85℃ for 5 minutes and hybridize at 42℃ for 1-18 hours.
[0137] Washing after hybridization: Carefully remove the coverslip and wash the sample slide in 2×SSC preheated at 37±1℃ for 10 minutes; then wash it in 0.1%NP-40 / 2×SSC at 37±1℃ for 5 minutes; then soak it in 70% ethanol at room temperature for 3 minutes.
[0138] Counterstaining: After drying in the dark, add 10 μL of in situ hybridization blue staining solution (DAPI) for staining, store in the dark, and observe.
[0139] The results are as follows Figure 4 As shown in the figure, the signal is bright, no other fluorescent signals are observed, and the signal-to-noise ratio is high.
[0140] Example 3
[0141] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Example 2 is that the template for preparing the NECTIN4 gene probe is BAC cloning plasmids CTD-2299J15 and CTD-2502B20. The composition and proportions of the remaining materials and reagents are the same as in Example 2.
[0142] Example 4
[0143] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Example 2 is that the template for preparing the NECTIN4 gene probe is BAC cloning plasmids RP11-157H6, CTD-3003O12, and RP11-4N6. The composition and proportions of the remaining materials and reagents are the same as in Example 2.
[0144] Test Example 2
[0145] The sensitivity, specificity, and signal intensity of the FISH kits for detecting NECTIN4 gene amplification in Examples 3 and 4 were evaluated.
[0146] The sample used in this test case was a human peripheral blood cultured cell sample.
[0147] The probe labeling reaction system is shown in Table 5 below. The hybridization signal, background conditions, and nonspecific properties of the kits from Examples 3 and 4 were evaluated.
[0148] Table 5
[0149]
[0150] The experimental steps are as follows.
[0151] (1) Sample processing refers to test example 1.
[0152] (2) Reverse hybridization reference test example 1.
[0153] (3) Wash after hybridization, refer to test example 1.
[0154] (4) Re-dyeing with re-dyeing agent, refer to test example 1.
[0155] The test results are shown in Table 6.
[0156] Table 6
[0157]
[0158] Protocol A: In metaphase cells, a striking red signal was observed in the 1q23.3 region, with no other fluorescent signals and a moderate signal-to-noise ratio; in interphase cells, two striking red signals were observed, with no other fluorescent signals and a moderate signal-to-noise ratio. The best observation results were obtained using Example 2.
[0159] Option B: In metaphase cells, the signal intensity in the 1q23.3 region was similar to that in Example 2, with no other fluorescent signals observed and a moderate signal-to-noise ratio. In interphase cells, the signal intensity was similar to that in Example 2, with no other fluorescent signals observed and a moderate signal-to-noise ratio. The probe preparation scheme (Example 2) using a shorter coverage area design yielded excellent signal performance, and the selected clone was determined to be CTD-2502B20.
[0160] Example 5
[0161] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Example 2 is that, in the NECTIN4 gene probe preparation process, the dTTP:TRITC-dUTP ratio in the nick translation system is 3:1.5 or 3:2.5, respectively. The remaining preparation steps are the same as in Example 1.
[0162] Comparative Example 1
[0163] This comparative example provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this comparative example and Example 2 is that, in the NECTIN4 gene probe preparation process, the dTTP:TRITC-dUTP ratio in the nick translation system is 1:4, 2:3, or 4:1, respectively. The remaining preparation process steps are the same as in Example 1.
[0164] Test Example 3
[0165] This test case evaluates the hybridization signal, background conditions, and non-specific conditions of the NECTIN4 gene probes prepared in Example 5 and Comparative Example 1.
[0166] The sample used in this test case is a human peripheral blood cell culture sample. The test method is the same as in Test Case 1.
[0167] The test results are shown in Table 7.
[0168] Table 7
[0169]
[0170] The results showed that dTTP:TRITC-dUTP ratios of 3:15 and 3:2.5 were superior to 1:4, 2:3, and 4:1 in terms of signal brightness and signal-to-noise ratio, with Example 2 (3:2) being the best. The dTTP:TRITC-dUTP ratio of 3:2 was confirmed.
[0171] Example 6
[0172] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Embodiment 2 is that no interruption is performed after the nick translation reaction, and the interruption is performed to 200 bp (maximum incident power (PIP): 50, duty factor: 20, number of energy transfers per cycle (Cycles per Burst): 200, treatment time (S): 160) and 300 bp (maximum incident power (PIP): 50, duty factor: 20, number of energy transfers per cycle (Cycles per Burst): 200, treatment time (S): 75). During the NECTIN4 gene probe preparation process, the remaining preparation steps are the same as in Embodiment 1.
[0173] Test Example 4
[0174] This test case evaluates the hybridization signal, background conditions, and non-specific conditions of the NECTIN4 gene probe prepared in Example 6.
[0175] The sample used in this test case was a human peripheral blood cell culture sample. The test method was the same as in Test Case 1, and the hybridization time was 1 hour.
[0176] The test results are shown in Table 8.
[0177] Table 8
[0178]
[0179] The results showed that the signal strength was low without interruption, while interruption to 200 bp and 300 bp achieved better hybridization results, with interruption to 150 bp yielding the best results.
[0180] Example 7
[0181] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Embodiment 2 is that, in the preparation of the centromere probe of chromosome 1, the ratio of dTTP to Fluorescein-dUTP is 3:0.5 or 3:2, respectively. The remaining preparation steps are the same as in Embodiment 1.
[0182] Comparative Example 2
[0183] This comparative example provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this comparative example and Example 2 is that, in the preparation of the centromere probe of chromosome 1, the ratio of dTTP to Fluorescein-dUTP is 1:3 or 2:2, respectively. The remaining preparation steps are the same as in Example 1.
[0184] Test Example 5
[0185] This test case evaluates the hybridization signal, background conditions, and non-specific conditions of the chromosome 1 centromere probes prepared in Example 7 and Comparative Example 2.
[0186] The sample used in this test case is a human peripheral blood cell culture sample. The test method is the same as in Test Case 1.
[0187] The test results are shown in Table 9.
[0188] Table 9
[0189]
[0190] The results showed that the luminance and signal-to-noise ratio of dTTP:TRITC-dUTP signals with ratios of 1:3 and 2:2 were significantly worse than those with ratios of 3:0.5 and 3:2, with Example 2 (3:1) being the best. The dTTP:TRITC-dUTP ratio was confirmed to be 3:1.
[0191] Example 8
[0192] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Embodiment 2 is that the sequence of the chromosome 1 internal control probe is SEQ ID NO:1. The composition and proportions of the remaining materials and reagents are the same as in Embodiment 2.
[0193] Example 9
[0194] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Embodiment 2 is that the sequence of the chromosome 1 internal control probe is SEQ ID NO:3. The composition and proportions of the remaining materials and reagents are the same as in Embodiment 2.
[0195] Test Example 6
[0196] Hybridization signal, background conditions, and non-specific conditions were evaluated for the chromosome 1 centromere probes in the kits of Examples 8 and 9.
[0197] The sample used in this test case is a human peripheral blood cell culture sample. The test method is the same as in Test Case 1.
[0198] The test results are shown in Table 10.
[0199] Table 10
[0200]
[0201] The results showed that the primer hybridization used in Example 8 was not specific, which affected the interpretation. Figure 5 Example 9: Primer hybridization showed a relatively clear green signal, with slight non-specific signals present, such as... Figure 6 The results were all inferior to those in Example 2, confirming that the primers used were F2 and R2.
[0202] Example 10
[0203] This embodiment provides a FISH kit for detecting NECTIN4 gene amplification. The only difference between this embodiment and Embodiment 2 is that no modification marker is added to the 5' end of the primer during the preparation of the chromosome 1 centromere probe; the remaining preparation steps are the same as in Embodiment 1.
[0204] Test Example 7
[0205] Hybridization signal, background conditions and non-specific conditions were evaluated for the centromere probe of chromosome 1 in Example 10.
[0206] The test results are shown in Table 11.
[0207] Table 11
[0208]
[0209] The results showed that adding a modification marker to the 5' end of the primer resulted in a clearer and brighter fluorescence signal.
[0210] Example 11
[0211] This example examines the probe hybridization time of the NECTIN4 gene amplification detection kit.
[0212] In this embodiment, the template for preparing the NECTIN4 gene probe is the BAC cloning plasmid CTD-2502B20. The sequence of the chromosome 1 internal reference probe is SEQ ID NO:2.
[0213] (1) The probe preparation is performed according to the steps in Example 1.
[0214] (2) Preparation of probe hybridization solution.
[0215] The hybridization buffer contains sodium citrate buffer (SSC), deionized formamide, and dextran sulfate (DSS), with the deionized formamide concentration being 40% and the DSS concentration being 0.1 g / mL.
[0216] More specifically, the reagent composition and preparation are shown in Table 4.
[0217] (3) Hybridization.
[0218] Sample preparation: Place the sample slides on a 65℃ constant temperature heating plate and bake for 5-30 minutes; place the samples in an environmentally friendly dewaxing agent at room temperature for 10 minutes to dewax; place them in anhydrous ethanol at room temperature for 10 minutes to remove residual dewaxing agent; then place them in anhydrous ethanol at room temperature, 90% ethanol, 70% ethanol, and purified water for 3 minutes each for rehydration; place the sample slides in purified water at 95-100℃ and boil for 25 minutes; after the sample slides are air-dried, add 100-200 μL of pepsin working solution and digest at 37±1℃ for 3-15 minutes; wash in 2×SSC at room temperature for 3 minutes; then place them in anhydrous ethanol at room temperature, 70%, 90%, and 100% for 2 minutes each for dehydration, and air-dry at room temperature.
[0219] Denaturation hybridization: Add 10 μL of probe hybridization solution to the hybridization area and mount the slide; denature at 85℃ for 5 minutes, and hybridize at 42℃ for 1 hour and 16 hours respectively.
[0220] Washing after hybridization: Carefully remove the coverslip and wash the sample slide in 2×SSC preheated at 37±1℃ for 10 minutes; then wash it in 0.1%NP-40 / 2×SSC at 37±1℃ for 5 minutes; then soak it in 70% ethanol at room temperature for 3 minutes.
[0221] Counterstaining: After drying in the dark, add 10 μL of in situ hybridization blue staining solution (DAPI) for staining, store in the dark, and observe.
[0222] The probe hybridization signal, background conditions, and non-specific conditions were evaluated at different hybridization times. The results are shown in Table 11.
[0223] Table 12
[0224]
[0225] The results showed that the probe signals and background were comparable after 1 hour and 16 hours of hybridization, with a high signal-to-noise ratio and the ability to achieve rapid hybridization.
[0226] Example 12
[0227] The NECTIN4 gene amplification detection kit probes are used for tumor detection.
[0228] The preparation method for the NECTIN4 gene amplification detection probe kit is the same as in Example 2.
[0229] Sample collection: Sixteen FFPE samples from triple-negative breast cancer were collected from Guangzhou Anbiping Medical Laboratory Co., Ltd.
[0230] Sample preparation: Place the sample slides on a 65℃ constant temperature heating plate and bake for 5-30 minutes; place the samples in an environmentally friendly dewaxing agent at room temperature for 10 minutes to dewax; place them in anhydrous ethanol at room temperature for 10 minutes to remove residual dewaxing agent; then place them in anhydrous ethanol at room temperature, 90% ethanol, 70% ethanol, and purified water for 3 minutes each for rehydration; place the sample slides in purified water at 95-100℃ and boil for 25 minutes; after the sample slides are air-dried, add 100-200 μL of pepsin working solution and digest at 37±1℃ for 3-15 minutes; wash in 2×SSC at room temperature for 3 minutes; then place them in anhydrous ethanol at room temperature, 70%, 90%, and 100% for 2 minutes each for dehydration, and air-dry at room temperature.
[0231] Denaturation hybridization: Add 10 μL of probe hybridization solution to the hybridization area and mount the slide; denature at 85℃ for 5 minutes and hybridize at 42℃ for 1 hour.
[0232] Washing after hybridization: Carefully remove the coverslip and wash the sample slide in 2×SSC preheated at 37±1℃ for 10 minutes; then wash it in 0.1%NP-40 / 2×SSC at 37±1℃ for 5 minutes; then soak it in 70% ethanol at room temperature for 3 minutes.
[0233] Counterstaining: After drying in the dark, add 10 μL of in situ hybridization blue staining solution (DAPI) for staining, store in the dark, and observe.
[0234] The results are as follows Figures 7-9 The signal was bright, with no other fluorescent signals observed, and the signal-to-noise ratio was high. Among them... Figure 7 This is a staining image of a sample without NECTIN4 gene amplification. Figure 8 The staining diagram shows a multisomal sample of the NECTIN4 gene. Figure 9 The staining image is of a sample amplified from the NECTIN4 gene.
[0235] Comparative Example 3
[0236] This comparative study investigated the probe hybridization effect of the NECTIN4 gene amplification detection kit.
[0237] The same samples were tested using the commercially available NECTIN4 amplification probe (EMPIRE) to evaluate the probe hybridization effect.
[0238] The detection protocol for the NECTIN4 gene amplification detection kit is the same as in Example 11; the detection protocol for commercially available probes is the same as the manufacturer's recommended protocol, as follows.
[0239] Sample preparation: Place the sample slides on a 90℃ constant temperature heating table for 20 minutes; dewax the samples in an environmentally friendly dewaxing agent at room temperature for 10 minutes; remove residual dewaxing agent in anhydrous ethanol at room temperature for 10 minutes; then rehydrate the samples sequentially in anhydrous ethanol at room temperature, 90% ethanol, 70% ethanol, and purified water for 3 minutes each; boil the sample slides in citric acid pretreatment solution at 95-100℃ for 30-60 minutes, and wash with 2×SSC for 2 minutes; after air-drying the sample slides, add 100-200 μL of pepsin working solution and digest at 37±1℃ for 3-15 minutes; wash with 2×SSC at room temperature for 2 minutes; then dehydrate the samples sequentially in 70% and 100% ethanol at room temperature for 30 seconds each, and air-dry at room temperature.
[0240] Denaturation hybridization: Add 10 μL of probe hybridization solution to the hybridization area and mount the slide; denature at 75℃ for 3 minutes and hybridize at 37℃ for 1 hour.
[0241] Washing after hybridization: Carefully remove the coverslip and wash the sample slide in 0.3% NP-40 / 0.4×SSC preheated at 73±1℃ for 2 minutes; then wash it in 0.1% NP-40 / 2×SSC at room temperature for 2 minutes.
[0242] Counterstaining: After drying in the dark, add 10 μL of in situ hybridization blue staining solution (DAPI) for staining, store in the dark, and observe.
[0243] The results showed that the sample detection results were consistent with those of commercially available probes, with a concordance rate of 100%; and the hybridization effect was excellent, as shown in Table 13.
[0244] Table 13
[0245]
[0246] In summary, this invention, through analysis of the NECTIN4 region and the centromere region of chromosome 1 with high specificity and sensitivity, and by combining a labeling method, solves the problems of low signal intensity and poor specificity, providing a rapid FISH probe combination for detecting NECTIN4 gene amplification. This FISH probe combination can be used to detect NECTIN4 gene amplification in patients, providing data support for future clinical trials and personalized treatment, and has broad application prospects in disease auxiliary diagnosis and prognosis assessment.
[0247] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. A FISH probe combination for detecting amplification of a NECTIN4 gene, characterized by The FISH probe combination comprises: a NECTIN4 gene probe and a chromosome 1 internal reference probe; The preparation template of the NECTIN4 gene probe is composed of the BAC clone plasmid shown in any one of (1)-(3) below: (1) BAC clone plasmids RP11-157H6, CTD-3003O12 and RP11-4N6; (2) BAC clone plasmids CTD-2299J15 and CTD-2502B20; (3) BAC clone plasmid CTD-2502B20.
2. The FISH probe combination for detecting NECTIN4 gene amplification according to claim 1, characterized by, The preparation template of the NECTIN4 gene probe is BAC clone plasmid CTD-2502B20; Preferably, the sequence of the chromosome 1 internal reference probe comprises any one of SEQ ID NOs: 1-3, preferably SEQ ID NO:
2.
3. The FISH probe combination for detecting NECTIN4 gene amplification according to claim 1 or 2, characterized in that, The fluorescence labeling modes of the NECTIN4 gene probe and the chromosome 1 internal reference probe are different; the fluorescence labeling mode is selected from the group consisting of red fluorescence labeling and green fluorescence labeling; Preferably, the fluorescence labeling is on dUTP; Preferably, the red fluorescence is TRITC; Preferably, the green fluorescence is Fluorescein; Preferably, the 5' end of the chromosome 1 internal reference probe further contains a fluorescent modification group, and the excitation wavelength and emission wavelength of the fluorescent modification group are similar to the excitation wavelength and emission wavelength of the fluorescein on dUTP.
4. The method of producing a FISH probe combination for detecting amplification of the NECTIN4 gene according to any one of claims 1 to 3, characterized in that, The preparation method comprises: (A) Preparation method of the NECTIN4 gene probe: the plasmid DNA is fluorescently labeled by the nick translation method, and then the plasmid DNA is broken by ultrasonic treatment; (B) Preparation method of the chromosome 1 internal reference probe: using human genome as a template, the fluorescein is labeled into the PCR product by the PCR labeling method.
5. The method of claim 4, wherein the FISH probe combination for detecting NECTIN4 gene amplification is prepared by the steps of: In step (A), the fluorescently labeled plasmid DNA is broken by ultrasonic treatment; the ultrasonic treatment fragment of the fluorescently labeled plasmid DNA is 150-300 bp; In step (A), the reaction system for fluorescently labeling the plasmid DNA comprises: buffer, dNTPs, fluorescently labeled dUTP, DNase I, DNA polymerase I and plasmid DNA; Preferably, in the reaction system, the molar concentration ratio of dTTP to TRITC-dUTP is 3:(1.5-2.5); Preferably, in step (A), the reaction program for fluorescently labeling the plasmid DNA is incubation at 15-25°C for 1-4 hours and incubation at 80°C for 10 minutes.
6. The method for preparing the FISH probe combination for detecting NECTIN4 gene amplification according to claim 4, characterized in that, In step (B), the primer sequence for amplifying the chromosome 1 internal reference probe comprises: SEQ ID NOs: 4-9; preferably, SEQ ID NOs: 6-7; Preferably, the 5' end of the primer further contains a fluorescent modification group; Preferably, in step (B), the reaction system of the PCR labeling method comprises: buffer, MgCl2, dNTPs, fluorescently labeled dUTP, amplification template, amplification primer and DNA polymerase. Preferably, the molar concentration ratio of dTTP to fluorescently labeled dUTP in the reaction system is 3:(0.5-2).
7. A FISH kit for detecting amplification of a NECTIN4 gene, characterized by The kit comprises: the FISH probe combination for detecting NECTIN4 gene amplification according to any one of claims 1-3; Preferably, the kit further comprises: any one or a combination of at least two of the following: hybridization buffer, digestion solution or in-situ hybridization blue staining solution; Preferably, the hybridization buffer comprises sodium citrate buffer, deionized formamide and dextran sulfate; Preferably, the concentration of deionized formamide in the hybridization buffer is 40%-60%; Preferably, the concentration of dextran sulfate in the hybridization buffer is 0.1-0.2 g / mL; Preferably, the digestion solution comprises pepsin.
8. The method of using the FISH kit for detecting amplification of the NECTIN4 gene according to claim 7 for a purpose other than disease diagnosis and / or treatment, characterized by, The use method comprises: digesting the sample using the digestion solution, adding the FISH probe combination for detecting NECTIN4 gene amplification according to any one of claims 1-3 to perform denaturation and hybridization, then performing staining and observation; Preferably, the final concentration of the digestion solution is 4 mg / mL; Preferably, the digestion time is 3-15 minutes; Preferably, the final concentration of the FISH probe combination is: NECTIN4 is 5-10 ng / μL, preferably 8 ng / μL, chromosome 1 internal reference probe is 2-5 ng / μL, preferably 2.5 ng / μL; Preferably, the denaturation and hybridization conditions are: denaturation at 82℃ for 2-5 minutes and hybridization at 42℃ for 1-18 hours.
9. A device for detecting NECTIN4 gene amplification, characterized in that, The device simultaneously detects NECTIN4 gene and chromosome 1 internal reference; the device comprises: A pretreatment module for digesting the sample to be tested; A hybridization module for denaturing and hybridizing the sample using the FISH probe combination; A color development and analysis module for staining the hybridized sample using the in-situ hybridization staining solution and performing analysis.
10. Use of any one or a combination of at least two of the following: the FISH probe combination for detecting NECTIN4 gene amplification according to any one of claims 1-3, the FISH kit for detecting NECTIN4 gene amplification according to claim 7 or the device for detecting NECTIN4 gene amplification according to claim 9 in the preparation of a product for detecting NECTIN4 gene.