Traditional Chinese medicine composition for improving sleep quality and preparation method thereof

Abstract

The invention discloses a traditional Chinese medicine composition for improving sleep quality and a preparation method and application thereof. The composition is prepared from 6-48 parts of semen ziziphi spinosae, 4-32 parts of semen boitae, 4-32 parts of bulbus lilii and 0.5-4 parts of passion fruit juice. The preparation method comprises the following steps: decocting the three medicinal materials with water, concentrating, freeze-drying to obtain freeze-dried powder, and dissolving with diluted passion fruit juice. Through the synergistic effect of the passion fruit juice and the three medicinal materials, sleep is effectively improved, meanwhile, the day-to-day sobering activeness is not inhibited, and the postherpetic effect of a traditional sedative is avoided. The composition is mild in effect and good in taste, and can be used for preparing medicines or health-care foods for improving sleep disorders and improving sleep quality.

Description

Technical Field

[0001] This invention belongs to the fields of traditional Chinese medicine manufacturing, health food, and biomedicine, and specifically relates to a traditional Chinese medicine composition for improving sleep quality and its preparation method. Background Technology

[0002] Insomnia, a common sleep disorder, seriously affects patients' quality of life and mental and physical health. Currently, benzodiazepines (such as alprazolam) are commonly used in clinical practice for treatment. Although these drugs can effectively shorten the time to fall asleep, their mechanism of action is mainly to forcibly inhibit the central nervous system, often accompanied by side effects such as disrupting sleep structure, causing daytime sleepiness the next day, decreased attention, and drug dependence, i.e., the "false sleep" effect.

[0003] Traditional Chinese medicine has certain advantages in improving insomnia, but common nourishing and calming Chinese herbs, such as jujube seed, cypress seed, and lily bulb, are moist in texture. Long-term use can easily cause discomfort such as abdominal distension or constipation in some patients, affecting their clinical application and compliance. In other words, there is a limitation of compatibility that is "nourishing but causing stagnation".

[0004] Therefore, there is an urgent need for a technology that can effectively shorten the time to fall asleep and restore sleep duration, while avoiding excessive central nervous system inhibition and the side effects of traditional tonics. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a traditional Chinese medicine composition for improving sleep quality and its preparation method. This composition can significantly shorten the time it takes for individuals with insomnia to fall asleep and effectively restore their sleep duration; its mechanism of action is mild and can enhance activity levels during wakefulness; and by introducing egg juice, the efficacy is enhanced while its natural aroma and sweet-sour taste improve the product flavor, thereby increasing user compliance.

[0006] To achieve the above objectives, the present invention is implemented through the following technical solution: In a first aspect, the present invention provides a traditional Chinese medicine composition for improving sleep quality, said composition being prepared from the following raw materials in parts by weight: Sour jujube seed 6-48 parts, cypress seed 4-32 parts, lily bulb 4-32 parts, passion fruit juice 0.5-4 parts.

[0007] Preferably, the composition is formulated as follows: 12 parts jujube seed, 8 parts cypress seed, 8 parts lily bulb, and 1 part passion fruit juice.

[0008] Preferably, the egg juice is pure juice obtained by squeezing fresh passion fruit, and is diluted with pure water to 25%-75% of its original concentration before use.

[0009] This invention provides a method for preparing the aforementioned traditional Chinese medicine composition, comprising the following steps: Step (1): Crush the jujube seed, cypress seed, and lily bulb, soak them in water and decoct them twice. Combine the decoctions and centrifuge to remove the precipitate. Step (2): Concentrate the combined decoction and freeze-dry it to obtain freeze-dried powder; Step (3): Dilute the passion fruit juice, dissolve and / or disperse the freeze-dried powder to obtain the final traditional Chinese medicine composition.

[0010] Preferably, the decocting conditions in step (1) are as follows: for the first decocting, add 5-10 times the amount of pure water, bring to a boil over high heat, and then simmer over low heat for 30-90 minutes; for the second decocting, add 5-8 times the amount of pure water, bring to a boil over high heat, and then simmer over low heat for 15-45 minutes.

[0011] Secondly, the present invention provides the application of the aforementioned traditional Chinese medicine composition in the preparation of products for improving sleep disorders, promoting sleep quality, shortening sleep onset time, prolonging sleep duration, or increasing waking activity.

[0012] Preferably, the product is an oral liquid, jelly, gummies, oral spray, granules, tablets, or capsules.

[0013] Preferably, the daily dosage of the composition ranges from 0.230 to 1.837 g / kg.

[0014] The present invention has the following beneficial effects: (1) The traditional Chinese medicine composition provided by the present invention can significantly shorten the time for insomnia model mice to fall asleep and effectively restore their sleep duration to normal levels.

[0015] (2) The composition does not work by forcibly inhibiting the central nervous system, has no sedative-hypnotic aftereffects on normal mice, and can enhance or maintain activity during wakefulness, thus avoiding the problems of "false sleep" and drowsiness the next day caused by traditional sedative drugs.

[0016] (3) There is a synergistic effect between egg juice and the three medicinal herbs: jujube seed, cypress seed, and lily bulb. Comparative experiments show that the sleep-promoting effect of the complete prescription cannot be achieved without egg juice or by using only egg juice. At the same time, as a natural flavoring agent, egg juice greatly improves the taste of the product and increases user compliance.

[0017] (4) The raw materials of this composition are natural and the preparation process is simple. It can be developed into a health food or medicine to improve sleep. Due to its mild properties and good taste, it has the potential to be developed as a leisure health food for the general population. Attached Figure Description

[0018] Figure 1The effect of different dosage groups of the present invention on the sleep onset time of insomnia mice (significant difference analysis: each group vs. the model group); Figure 2 The effect of different dosage groups of the present invention on sleep duration in insomnia mice (significant difference analysis: each group vs. the model group); Figure 3 The effect of different dosage formulations of this invention on the level of GABAAγ2 receptors in the hypothalamus of insomnia mice; Figure 4 The effects of formulation 2 and the positive control group on sleep onset time and sleep duration in normal mice; Figure 5 The effects of formulation 2, the comparative ratio, and the positive control group on the number of times normal mice stand up (activity level); Figure 6 The effect of formulation 2 and the comparative formulation on the number of times in sleepy mice stood up (activity level); Figure 7 The effects of formulation 2 and the comparative formulation on sleep onset time in insomnia mice; Figure 8 The effects of formulation 2 and the comparative formulation on sleep duration in insomnia mice. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the embodiments. The test materials used in the embodiments can all be obtained through conventional means.

[0020] Experimental Materials and Methods

[0021] 1. Main reagents and medicinal materials: Sour jujube seed is the dried, mature seed of Ziziphus jujuba Mill. var. spinosa (Bunge) Hu ex HFChou, a plant belonging to the Rhamnaceae family of the Lamiaceae family.

[0022] Platycladus orientalis (L.) Franco, a plant belonging to the Cupressaceae family, is a dried, mature seed kernel.

[0023] Lily refers to the dried, fleshy scales of plants in the Liliaceae family, such as Lilium lancifolium Thunb., Lilium brownii F.E.Brown var. viridulum Baker, or Lilium pumilum DC.

[0024] Passion fruit is the fresh fruit of a vine belonging to the genus Passiflora in the family Passifloraceae.

[0025] Positive test result: Alprazolam tablets, purchased from Shandong Xinyi Pharmaceutical Co., Ltd.

[0026] Sodium pentobarbital, 4-chloro-DL-phenylalanine (PCPA).

[0027] 2. Laboratory animals: Animals: ICR mice, provided by Jiangsu Qinglongshan Biotechnology Co., Ltd. (Experimental Animal Production License: SCXK (Su) 2024-0001). Weight: 28-32 g; Sex: Male.

[0028] Mouse administration: Based on an average mouse weight of 30 g, each mouse was orally administered 0.3 mL by gavage (formulations of the examples and comparative examples).

[0029] 3. Insomnia Model Construction: The minimum suprathreshold dose of sodium pentobarbital is the minimum dose that causes 100% loss of the righting reflex in insomnia model mice. Through preliminary experiments, this dose was determined to be 50 mg / kg. The experiment lasted for 7 days. From day 1, mice were administered the corresponding doses of the positive control and the formulations of the examples and comparative examples once daily. On days 5 and 6, except for the blank control group (which was treated with pure water), mice in other groups were intraperitoneally injected for two consecutive days with a 450 mg / kg solution of 4-chloro-DL-phenylalanine (PCPA) edible oil. After injection, insomnia symptoms (restlessness, disheveled fur) were observed in the mice. On day 7, mice in each group were injected with 50 mg / kg sodium pentobarbital. Using the righting reflex as a reference, the sleep onset time and sleep duration of each group were recorded.

[0030] 4. Observation indicators: Sleep onset time: the time from injection of sodium pentobarbital to the time when the mouse enters sleep; Sleep duration: the time from the time when the mouse enters sleep to the time when the mouse wakes up.

[0031] Activity level: The number of times a mouse stands up (with its hind legs gripping the ground and its body upright) per unit time is used as an indicator to evaluate activity level during wakefulness.

[0032] Among the above indicators, sleep onset time directly reflects the time required for an individual to fall asleep and is used as a key indicator for evaluating drug efficacy in insomnia models; sleep duration is used to help demonstrate the effect of drugs on sleep and is combined with wakefulness activity level to comprehensively judge the quality of sleep.

[0033] Detection indicators: After the experimental period, hypothalamic tissue from mice was collected for mRNA extraction and qRT-PCR to test the expression level of GABAAγ2. The qRT-PCR procedure and experimental conditions were the same as those in the literature [PMID: 40841706]. The mouse GABAAγ2 primer sequences were: F: CAAAGAGAGCACAGCCCCAT, R: CCACAGCGTCATTTTATTCATGC.

[0034] Statistical analysis: All data are expressed as mean ± SD. Between-group differences were analyzed using Prism 8.0. * P A difference <0.05 is considered statistically significant, and the significance level is marked as **. P <0.01, *** P <0.001, **** P <0.0001. Example 1

[0035] The present invention provides a traditional Chinese medicine composition for improving sleep quality: 6 parts of jujube seed, 4 parts of cypress seed, 4 parts of lily bulb, and 0.5 parts of passion fruit juice; The preparation method is as follows: (1) Grind the required medicinal materials into powder, add 5-10 times the amount of pure water, soak for 15-45 minutes, bring to a slight boil over high heat, then simmer over low heat for 30-90 minutes and take out the decoction. (2) Add 5-8 times the amount of pure water, boil in the same way, then simmer for 15-45 minutes. Combine the two decoctions and centrifuge to remove the precipitate. (3) Concentrate by rotary evaporation, freeze the concentrate into a solid at -80℃, and freeze dry it for 2 to 4 days at a vacuum of 30 to 70 Pa using a freeze dryer to obtain the freeze-dried powder solid of the traditional Chinese medicine composition; (4) Dilute the pure fruit juice of passion fruit with pure water to 25%-75% of the original concentration and mix it with the freeze-dried powder solid of the traditional Chinese medicine composition to obtain the first traditional Chinese medicine composition with passion fruit juice as solvent.

[0036] The corresponding dosage of freeze-dried powder for rats in this formulation is 0.520 g / kg, the corresponding dosage of raw medicinal materials in the rat-use traditional Chinese medicine composition is 2.090 g / kg, and the corresponding dosage of raw medicinal materials in the human-use traditional Chinese medicine composition is 0.230 g / kg. Example 2

[0037] The present invention provides a traditional Chinese medicine composition for improving sleep quality: 12 parts of jujube seed, 8 parts of cypress seed, 8 parts of lily bulb, and 1 part of passion fruit juice; The preparation method is as follows: (1) Grind the required medicinal materials into powder, add 5-10 times the amount of pure water, soak for 15-45 minutes, bring to a slight boil over high heat, then simmer over low heat for 30-90 minutes and take out the decoction. (2) Add 5-8 times the amount of pure water, boil in the same way, then simmer for 15-45 minutes. Combine the two decoctions and centrifuge to remove the precipitate. (3) Concentrate by rotary evaporation, freeze the concentrate into a solid at -80℃, and freeze dry it for 2 to 4 days at a vacuum of 30 to 70 Pa using a freeze dryer to obtain the freeze-dried powder solid of the traditional Chinese medicine composition; (4) Dilute the pure fruit juice of passion fruit with pure water to 25%-75% of the original concentration and mix it with the freeze-dried powder solid of the traditional Chinese medicine composition to obtain the second traditional Chinese medicine composition with passion fruit juice as solvent.

[0038] The dosage of the freeze-dried powder for rats corresponding to Formula 2 is 1.040 g / kg, the dosage of the raw medicinal material for rats is 4.180 g / kg, and the dosage of the raw medicinal material for human use is 0.459 g / kg. Example 3

[0039] The present invention provides a traditional Chinese medicine composition for improving sleep quality: 24 parts of jujube seed, 16 parts of cypress seed, 16 parts of lily bulb, and 2 parts of passion fruit juice; The preparation method is as follows: (1) Grind the required medicinal materials into powder, add 5-10 times the amount of pure water, soak for 15-45 minutes, bring to a slight boil over high heat, then simmer over low heat for 30-90 minutes and take out the decoction. (2) Add 5-8 times the amount of pure water, boil in the same way, then simmer for 15-45 minutes. Combine the two decoctions and centrifuge to remove the precipitate. (3) Concentrate by rotary evaporation, freeze the concentrate into a solid at -80℃, and freeze dry the solution for 2 to 4 days at a vacuum of 30 to 70 Pa using a freeze dryer to obtain the freeze-dried powder solid of the traditional Chinese medicine composition; (4) Dilute the pure fruit juice of passion fruit with pure water to 25%-75% of the original concentration and mix it with the freeze-dried solid of the traditional Chinese medicine composition to obtain the third traditional Chinese medicine composition with passion fruit juice as solvent.

[0040] The dosage of the freeze-dried powder for rats corresponding to Formula 3 is 2.080 g / kg, the dosage of the raw medicinal material for rats is 8.360 g / kg, and the dosage of the raw medicinal material for human use is 0.919 g / kg. Example 4

[0041] The traditional Chinese medicine composition of the present invention for improving sleep quality is: 48 parts of jujube seed, 32 parts of cypress seed, 32 parts of lily bulb, and 4 parts of passion fruit juice; The preparation method is as follows: (1) Grind the required medicinal materials into powder, add 5-10 times the amount of pure water, soak for 15-45 minutes, bring to a slight boil over high heat, then simmer over low heat for 30-90 minutes and take out the decoction. (2) Add 5-8 times the amount of pure water, boil in the same way, then simmer for 15-45 minutes. Combine the two decoctions and centrifuge to remove the precipitate. (3) After rotary evaporation and concentration, freeze-drying, the freeze-dried powder solid of the traditional Chinese medicine composition is obtained; (4) Dilute the pure fruit juice of passion fruit with pure water to 25%-75% of the original concentration and mix it with the freeze-dried solid of the traditional Chinese medicine composition to obtain the fourth traditional Chinese medicine composition with passion fruit juice as solvent.

[0042] The dosage of the freeze-dried powder for rats corresponding to Formula 4 is 4.160 g / kg, the dosage of the raw medicinal material for rats is 16.80 g / kg, and the dosage of the raw medicinal material for human use is 1.837 g / kg.

[0043] Comparative Example 1: The difference from Example 2 is that pure water is used instead of egg juice.

[0044] Comparative Example 2: The difference from Example 2 is that the formula consists only of egg juice (using the same formula as in Example 2).

[0045] Experimental Example 1: Effects of formulations 1-4 on sleep behavior in insomnia mice Grouping and treatment: A blank group, a model group, a positive control group (alprazolam, 0.19 mg / kg / day), and groups 1-4 of Examples (Formulas 1 to 4) were set up.

[0046] Experimental results: (1) such as Figure 1 As shown, the traditional Chinese medicine composition reduced the sleep onset time in insomnia-prone mice. The average sleep onset time was 3.30 min in the control group, extended to 5.54 min in the model group, and shortened to 3.50 min in the positive control group. The sleep onset time was shortened to 4.45, 3.43, 4.17, and 4.14 min by the dosages of the formulations in Examples 1, 2, 3, and 4, respectively. Calculations showed that the positive control group and the dosages of the formulations in Examples 1, 2, 3, and 4 reduced the sleep onset time in the model group by 36.82%, 19.68%, 38.09%, 24.73%, and 25.28%, respectively. This indicates that the positive control group and formulations 1 to 4 can significantly shorten the sleep onset time.

[0047] (2) For example Figure 2As shown, the traditional Chinese medicine composition prolonged the sleep duration of insomniac mice. After the insomnia model was established, compared with the blank group (100%), the sleep duration of the model group was shortened to 78.52%, the positive control group restored the sleep duration to 112.97%, and formulations one, two, three, and four restored the sleep duration of the model group to 81.60%, 101.25%, 99.06%, and 87.42%, respectively. This experiment confirms that the traditional Chinese medicine composition can effectively improve the sleep status of insomniac mice, and its core lies in "significantly shortening the time to fall asleep" and "effectively prolonging the sleep duration".

[0048] (3) such as Figure 3 As shown, the traditional Chinese medicine composition promoted the expression of GABAAγ2 receptor in insomnia mice. The upregulation of GABAAγ2 receptor expression by formulations one, two, three, and four did not restore it to the level of the blank group. This phenomenon reveals that formulation two does not exert its hypnotic effect by forcibly and excessively activating the GABA system, but rather through a gentler and more precise multi-target regulation, which effectively improves sleep while potentially avoiding the side effects of excessive inhibition of the central nervous system.

[0049] Experiment Example 2: Effects on sleep and wakefulness in normal mice Normal mice were selected, but the insomnia model was not established. The mice were treated with Formula 2 (Formula 2) and the positive control drug (alprazolam) according to the dosage and administration method shown in the previous examples. First, the time to fall asleep and the duration of sleep were recorded (method as before). Second, the number of times the mice stood up was used as an indicator to measure their activity level. This reflects vertical exploratory activity, indicating a stronger exploratory desire and a better mental state.

[0050] like Figure 4 As shown, when formulation 2 was used alone on normal mice, it had no effect on the time it took for normal mice to fall asleep, but it shortened the total sleep time (normal mice vs. formulation alone = 135.26 vs. 105.43 min). Alprazolam, while reducing the time it took for mice to fall asleep, increased the total sleep time, consistent with the previously reported "false sleep" effect.

[0051] In normal mice treated with alprazolam and formulation two, behavioral observations showed that the activity level during wakefulness in mice treated with formulation two was not significantly different from that in control mice; Figure 5 As shown, the number of times mice stood up was counted. The results showed that after treatment with formulation 2, there was no significant difference in the number of times mice stood up compared with the control group; however, the number of times mice treated with alprazolam stood up was shorter compared with the control group; the number of times mice in formulation 2 (pure water instead of egg juice) stood up was also not affected by the number of times mice stood up compared with the control group.

[0052] Alprazolam significantly shortened the time it took for normal mice to fall asleep, but it also led to a significant decrease in the number of times they stood up the next day, indicating that the positive control group had a residual effect of central nervous system depression. Formula 2 had no effect on the time it took for normal mice to fall asleep, and the number of times they stood up was no different from that of the control group, indicating that the herbal composition of this invention does not inhibit the alertness and activity level of normal individuals. The effects of Formula 2 (pure water substitute) and the egg juice alone were not as good as those of Formula 2, indicating that egg juice and the three herbs have a synergistic effect in maintaining normal alertness and activity level, and none of them can be omitted.

[0053] Experiment 3: Effects on sleep and wakefulness in insomnia mice like Figure 6 As shown, the insomnia mouse model induced by PCPA showed a significant increase in the number of times the mouse stood up compared to the control group, indicating that the insomnia mice exhibited anxiety. The positive control drug (alprazolam) inhibited the activity of the mice. The number of times the mouse stood up in formulation 2 was comparable to that in the control group, indicating that the herbal composition of the present invention not only improved the anxiety symptoms of insomnia mice when awake, but also did not cause significant activity inhibition, thus avoiding the drawbacks of traditional sedative drugs.

[0054] like Figure 8 As shown, compared with formulation 2, the formulation 2 (pure water instead of egg juice) group and the egg juice group had no significant effect on the sleep duration of insomnia mice. Compared with the positive control drug, although it can increase sleep duration, it has the disadvantage of inhibiting individual activity when awake. This shows that the combination of Chinese medicine and fresh fruit selected in this invention has a significant advantage over the positive control drug in that it does not affect the inhibition of activity when awake.

[0055] In summary, the experiments show that the herbal composition of the present invention not only effectively treats insomnia in the insomnia model, but also restores normal physiological sleep; and it also improves sleep quality in normal individuals.

[0056] Experiment Example 4: Verification of the synergistic effect of egg juice and medicinal materials 4.1 Synergistic effect on sleep onset time Grouping: Blank group, model group, formulation 2 (Example 2), pure water replacing egg juice (Comparative Example 1), egg juice (Comparative Example 2) like Figure 7 As shown, formulation two had the strongest effect in promoting sleep, while the effect of pure water replacing egg juice was significantly weakened, and there was no significant difference between egg juice alone and the model group; indicating that egg juice and the three medicinal herbs have a clear synergistic effect in shortening sleep onset time.

[0057] 4.2 Synergistic effect on maintaining alertness and activity level like Figure 5 and 6As shown, egg juice alone inhibited the activity level of both normal (vs. blank group) and insomnia (vs. model group) mice. Pure water replacing egg juice had no significant effect on the activity level of both normal (vs. blank group) and insomnia (vs. model group) mice. However, the activity level of mice was increased under the action of the complete formula formed by the three components. This indicates that the synergistic effect of "egg juice" + "jujube seed, cypress seed, and lily" in this invention can effectively treat insomnia without negatively affecting wakefulness and activity level.

[0058] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. However, the above description is merely a specific embodiment of the present invention, and the technical features of the present invention are not limited thereto. Any other embodiments derived by those skilled in the art without departing from the technical solution of the present invention should be covered within the patent scope of the present invention.

Claims

1. A traditional Chinese medicine composition for improving sleep quality, characterized in that, The composition is prepared from the following raw materials in parts by weight: Sour jujube seed 6-48 parts, cypress seed 4-32 parts, lily bulb 4-32 parts, passion fruit juice 0.5-4 parts.

2. The traditional Chinese medicine composition for improving sleep quality according to claim 1, characterized in that, The composition is formulated as follows: 12 parts jujube seed, 8 parts cypress seed, 8 parts lily bulb, and 1 part passion fruit juice.

3. The traditional Chinese medicine composition for improving sleep quality according to claim 1 or 2, characterized in that, The passion fruit juice is pure juice obtained by pressing fresh passion fruit. Before use, it should be diluted with pure water to 25%-75% of the original concentration.

4. The traditional Chinese medicine composition for improving sleep quality according to claim 1, characterized in that, The preparation method of the traditional Chinese medicine composition includes the following steps: Step (1): Crush the jujube seed, cypress seed, and lily bulb, soak them in water and decoct them twice. Combine the decoctions and centrifuge to remove the precipitate. Step (2): Concentrate the combined decoction and freeze-dry it to obtain freeze-dried powder; Step (3): Dilute the passion fruit juice, dissolve and / or disperse the freeze-dried powder to obtain the final traditional Chinese medicine composition.

5. The traditional Chinese medicine composition for improving sleep quality according to claim 4, characterized in that, The decocting conditions described in step (1) are as follows: for the first decocting, add 5-10 times the amount of pure water, bring to a boil over high heat, and then simmer over low heat for 30-90 minutes; for the second decocting, add 5-8 times the amount of pure water, bring to a boil over high heat, and then simmer over low heat for 15-45 minutes.

6. The use of the traditional Chinese medicine composition as described in claim 1 or 2 in the preparation of products for improving sleep disorders, promoting sleep quality, shortening sleep onset time, prolonging sleep duration, or increasing waking activity.

7. The application according to claim 6, characterized in that, The products are oral liquids, jellies, gummies, mouth sprays, granules, tablets, or capsules.

8. The application according to claim 6, characterized in that, The daily dosage range of the composition is 0.230-1.837 g / kg.

Images