Application of GPR84 inhibitor in preparation of medicine for treating sepsis liver injury

Abstract

The invention relates to application of a reagent for inhibiting GPR84 expression or a reagent for inhibiting GPR84 activity in preparation of a medicine for treating or preventing liver injury caused by sepsis. The invention also relates to application of the composition in preparation of a medicine for treating or preventing liver injury caused by sepsis. The application provides a great potential treatment and prevention mode for sepsis liver injury.

Description

Technical Field

[0001] This application relates to the development of therapeutic targets, specifically the use of GPR84 in the treatment of liver injury caused by sepsis. Background Technology

[0002] Sepsis is a systemic inflammatory disease primarily caused by infection. Globally, there are at least 20 million new cases of sepsis each year, and more than 5 million sepsis-related deaths, with a case fatality rate exceeding 25%. Its extremely high morbidity and mortality make sepsis one of the major threats to global health. As sepsis develops, the immune system initiates a complex immune response, simultaneously inducing an inflammatory response. Excessive inflammation often leads to tissue and cell damage and organ dysfunction, even resulting in septic shock, multiple organ dysfunction syndrome, or circulatory failure, thus endangering life.

[0003] The liver plays a vital role in metabolism, detoxification, and immunity, making it one of the most commonly affected organs in sepsis. Acute inflammatory liver injury is a major manifestation of sepsis-induced multiple organ dysfunction syndrome (MODS), severely impacting the prognosis of sepsis patients. Clinical indicators of sepsis-related liver injury include plasma bilirubin levels >34.2 μmol / L (2 mg / dL) and an international normalized ratio (INR) >1.5. Scientific research often uses liver function biochemical indicators such as ALT / AST, the accumulation status of lipids and oxygen free radicals in the animal liver and the degree of lipid peroxidation, the secretion and expression levels of inflammatory factors by hepatic immune cells, and the growth, proliferation, and apoptosis status of hepatocytes as evaluation indicators. The overall incidence of sepsis-related liver injury is greater than 30% clinically, with sepsis-related acute liver injury, liver dysfunction, and liver failure accounting for 32%, 40%, and 11% of sepsis patients, respectively. The mortality rate of sepsis patients with acute liver injury during ICU stays is as high as 60%. Therefore, liver injury is a challenging and critical aspect in the development and progression of sepsis.

[0004] Currently, there is no specific treatment for acute inflammatory liver injury caused by sepsis; treatment mainly relies on early diagnosis and symptomatic management. Conventional treatment methods include: ① Antibiotic therapy: In the early stages, empirical antibiotics are used to control the source of infection based on the pathogen and drug sensitivity. Some patients with foci of infection also require debridement and drainage to control the infection. ② Supportive care: This includes fluid resuscitation to address hypoperfusion, maintaining hemodynamic stability, or administering vasoactive drugs such as norepinephrine and respiratory support, which can help alleviate liver damage in sepsis patients. ③ Anti-inflammatory and immunotherapy: Some treatments or known drugs that can reduce the activation of inflammatory cells and the intensity of the inflammatory response are also used to treat sepsis-related liver injury. Examples include anti-inflammatory therapy with glucocorticoids, hyperbaric oxygen therapy (which exerts anti-inflammatory effects by reducing the release of reactive oxygen species), immunomodulators such as thymosin, cytokine-targeted therapy, and drugs that regulate autophagy and may also play a protective role against liver damage by reducing the inflammatory response. ④ Specific liver-protective treatments: Antioxidants such as N-acetylcysteine ​​can significantly reduce oxidative stress in damaged livers and decrease liver damage; hepatoprotective drugs such as polyene phosphatidylcholine, glycyrrhizic acid preparations, and S-adenosylmethionine can also exert hepatoprotective effects in different parts of the damaged liver; drugs such as alprostadil can alleviate liver damage by improving microcirculation; for patients with extremely severe liver damage, artificial liver systems can be considered to remove toxins. ⑤ Enteral and parenteral nutrition therapy: Good nutritional status plays an important role in the improvement and cure of sepsis. The hypoperfusion state of sepsis causes gastrointestinal damage and bacterial translocation, which can damage the liver through the portal vein. Early enteral nutrition and supplemental parenteral nutrition can promote the recovery of liver function and facilitate the relief of patients with sepsis-related liver damage. ⑥ Other emerging treatments: Treatments targeting metabolic function: Some key genes / proteins that help maintain mitochondrial respiratory function, control blood sugar, or reduce and improve cellular hypoxia are considered potential therapeutic targets for sepsis-related liver damage and are being studied; hepatocyte and exosome therapy have been reported to potentially improve the state of sepsis-related liver damage through anti-inflammatory and tissue repair pathways.

[0005] With the continuous advancement of medical technology and the progress of the above treatment strategies, the prognosis of patients with sepsis complicated by liver injury has improved. However, the mortality rate of sepsis patients with liver injury remains high, and the treatment of liver injury still faces many limitations and challenges. For example, among the aforementioned treatments, glucocorticoids are a class of hormones with strong anti-inflammatory and immunosuppressive effects, widely used to treat various inflammatory and autoimmune diseases. They exert their effects through multiple pathways (such as inhibiting pro-inflammatory factors, regulating cytokine networks, affecting cell signaling pathways, regulating macrophage activation, affecting immune cell function, and gene regulation, etc.). Although glucocorticoids are important drugs for treating inflammatory and autoimmune diseases, their use in the treatment of sepsis-induced liver injury remains controversial, with controversies arising from individual differences in treatment efficacy and dosage. Furthermore, most of the aforementioned treatments target the severe infection state of sepsis, and there is still a significant lack of specific liver-protective measures. The current strategy of using traditional hepatoprotective drugs as adjunctive therapy urgently needs updating and improvement. Furthermore, the pathological mechanisms of sepsis-induced liver injury are complex, involving mechanisms such as inflammatory response, metabolic abnormalities, oxidative stress, microcirculatory disturbances, and apoptosis. Individual differences among sepsis patients are significant, and damage may occur in various organs, making it difficult to formulate a unified treatment plan. As a result, there are currently no specific drugs or clear targets for sepsis-induced liver injury, and research on new treatment methods for sepsis-induced liver injury is also limited.

[0006] In recent years, some researchers have attempted to develop targets for sepsis-induced liver injury to provide a theoretical basis for precision treatment. Although current research based on proteomics targeting the pathological mechanisms of sepsis-induced liver injury has yielded some results, such as targeting inflammatory signaling pathways like NF-κB and JAK-STAT, targeting pathways regulating oxidative stress like Nrf-2, and targeting vascular endothelial growth factor to improve microcirculatory disturbances and protect mitochondrial function, these studies are still in the early stages, and their efficacy requires further exploration and validation.

[0007] Therefore, in the field of sepsis, there is a strong need to develop more precise targets for sepsis-related liver injury. Summary of the Invention

[0008] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0009] As explained earlier, developing new targets for sepsis-induced liver injury not only helps to elucidate its pathological mechanisms but also provides a theoretical basis for precision medicine. By designing novel drugs or treatment strategies targeting specific targets, it is hoped that more efficient and safer treatment outcomes can be achieved, thereby improving patient prognosis and reducing mortality. Accelerating the research and translation of new targets for sepsis-induced liver injury is a major challenge in the medical field and a key breakthrough in improving the treatment of sepsis. However, the pathological mechanisms of sepsis-induced liver injury are still unclear, research on targeted therapy strategies is in its early stages and requires further exploration; and the efficacy of potential target drugs still needs further validation. Therefore, the development of effective drugs for liver injury remains a significant challenge.

[0010] Based on this, the inventors conducted extensive research and discovered that GPR84 can serve as an effective therapeutic target for sepsis-induced liver injury among numerous potential targets. They then confirmed the therapeutic efficacy of drugs targeting GPR84 for sepsis-induced liver injury through in vitro and in vivo experiments, thus completing this invention.

[0011] GPR84 belongs to the G protein-coupled receptor family and was first discovered and identified in 2001. It is highly expressed in immune cells such as monocytes / macrophages and neutrophils, and is also widely expressed in metabolically active tissues and organs such as the brain, spleen, liver, and kidneys. Endogenous and exogenous medium-chain free fatty acids (C9-C14 length) and exogenous derivatives can act as ligands to activate GPR84 activity, enabling it to exert its physiological functions by binding to G proteins (Gαs, Gαi / o, Gαq / 11, Gα12 / 13, etc.) and mediating cAMP second messenger signaling.

[0012] GPR84 initially attracted attention as an "inflammatory sensor." The GPR84 agonist 6-OAU has been reported to enhance phosphorylated Akt, p-ERK expression, and p65 nuclear translocation, thereby increasing macrophage inflammatory cytokine production and bacterial adhesion and phagocytosis. Conversely, GPR84 deficiency is associated with a weakened release of LPS-induced pro-inflammatory mediators (IL-6, KC-GROα, VEGF, MIP-, etc.) from peritoneal exudate.

[0013] The characteristic of GPR84 as a medium-chain fatty acid receptor has led to interest in its role in metabolic diseases such as diabetes and obesity. The GPR84 antagonist PBI-4547 has been found to regulate glucose and fatty acid metabolism by lowering blood glucose and weight, and improving insulin sensitivity. GPR84 agonists can also increase mitochondrial calcium levels. 2+ It effectively restores the activity of brown adipocytes and improves lipid metabolism disorders, playing an important role in brown adipose tissue (BAT). GPR84 ligands capric acid and lauric acid exert a protective effect on obese or diabetic patients by balancing the metabolism of substances or hormones such as glucose and cholesterol in the body.

[0014] Currently, research on the impact of GPR84 on the pathological processes of liver diseases is scarce, and the related molecular mechanisms require further investigation. GPR84 has been detected as upregulated in the livers of patients with non-alcoholic fatty liver disease, and its expression level may be related to the degree of inflammation and liver fibrosis. The GPR84 antagonist PBI-4050 has been reported to potentially exert an anti-fibrotic effect by regulating ATP levels in hepatic stellate cells through the LKB1 / AMPK / mTOR pathway. However, research on the therapeutic potential of GPR84 in sepsis-induced acute inflammatory liver injury, as well as its pathological function and mechanism of action, remains lacking.

[0015] Accordingly, in one aspect, this application provides the use of reagents that inhibit GPR84 expression or GPR84 activity in the preparation of medicaments for the treatment or prevention of liver injury caused by sepsis.

[0016] In a specific implementation, the reagent for inhibiting GPR84 expression is selected from one or more of the group consisting of ASO, siRNA, shRNA, miRNA, ribozyme, aptamer, and CRISPR interference system.

[0017] As used herein, the term “ASO” also refers to antisense oligonucleotides. An ASO is a single-stranded oligonucleotide with a nucleobase sequence that, when written in the 5' to 3' orientation, contains the inverse complement of a target segment of a specific nucleic acid and is appropriately modified to induce RNase H-mediated cleavage of its target RNA in the cell or to inhibit the translation of target mRNA in the cell. ASOs have been used for decades to reduce the expression of specific target genes (see, for example, Bennett et al. (2017) ANNU.REV. PHARMACOL. 57:81-105).

[0018] As used in this article, the term "siRNA," also known as small interfering RNA, refers to a small RNA molecule composed of 19-25 nucleotides, which is produced by processing dsRNA via Dicer. siRNA degrades specific messenger RNA (mRNA) in RNA interference, which is a post-transcriptional regulation.

[0019] As used in this article, the term "shRNA" is also known as short hairpin RNA. It can suppress the expression of specific genes through RNA interference mechanisms. shRNA consists of a sense strand, an antisense strand, and a circular structure, and is usually 50-100 nucleotides in length.

[0020] As used in this article, the term "miRNA," also known as microRNA, refers to a class of endogenous non-coding small RNA molecules, approximately 18-25 nucleotides in length. They regulate gene expression by binding complementary to the 3' untranslated region (3'UTR) of mRNA, inhibiting translation or promoting mRNA degradation.

[0021] As used herein, the term "ribozyme" is a catalytic RNA molecule that recognizes target RNA through sequence specificity and cleaves phosphodiester bonds with endonuclease activity, thereby blocking the expression of the target gene. Its mechanism of action is independent of protein cofactors; by designing its catalytic domain to bind to the complementary sequence of the target RNA, silencing specific genes can be achieved.

[0022] As used herein, the term "aptamer" refers to a single-stranded oligonucleotide molecule obtained through in vitro screening that specifically binds to target biomolecules, such as proteins, nucleic acids, or small molecule compounds, through three-dimensional conformation. Aptamers interfere with the biological function of target molecules in gene expression regulatory pathways through steric hindrance, conformational alteration mechanisms, or competitive binding, thereby inhibiting the expression of target genes.

[0023] As used herein, the terms “CRISPR interference system” and “CRISPR-based gene expression repression complex” are used interchangeably and refer to gene expression repression tools modified based on the CRISPR-Cas system, which are complexes containing an inactivated Cas9 (dCas) protein and a sequence-specific guide RNA (sgRNA). This system targets specific regions of the genome through sgRNA-mediated base pairing, inhibiting the transcriptional activity of the promoter or regulatory region of the target gene. The dCas9 protein is mutated to eliminate nuclease activity while retaining DNA-binding function, and hinders the binding of transcription factors or blocks the progress of RNA polymerase through steric hindrance, thereby achieving targeted inhibition of the expression of the target gene.

[0024] In a specific implementation, the reagent for inhibiting GPR84 activity is selected from one or more of the group consisting of PBI-4547, PBI-4050, GPR84antagonist 1, GLPG1205, and BGT-004.

[0025] In this paper, the term "inhibition of GPR84 expression" includes a partial or near-complete reduction at the gene or protein level, such as a 50-90% reduction in GPR84 expression via siRNA. In cases of partial reduction, the term "inhibition" may be used interchangeably with "knockdown" or "downregulation." Furthermore, the reduction can be near-complete, such as reducing expression to less than 10%, in which case the term "inhibition" may be used interchangeably with "silencing." The reduction in expression can be measured by analysis at the transcriptional or protein level. The degree of inhibition can range from 40% to 100%, such as 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.

[0026] In this paper, the term "agent that inhibits GPR84 activity" refers to a substance that blocks receptor function without affecting its expression level. In this paper, an agent that inhibits GPR84 activity can be a GPR84 antagonist, such as a compound that binds to the GPR84 receptor, blocking its activation and downstream signaling. Antagonists can be competitive or non-competitive.

[0027] In this paper, the term "inhibition of GPR84 activity" includes partial and complete inhibition, and the reduction in activity can be measured, for example, by IC50. The degree of inhibition can be 40%-100%, such as 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.

[0028] In a specific implementation, liver injury refers to acute liver injury.

[0029] Alternatively, this application provides the use of reagents that inhibit GPR84 expression or GPR84 activity in the preparation of a medicament for treating liver injury in a subject suffering from sepsis.

[0030] In a specific implementation, the subjects are mammals, including humans, chimpanzees, apes, monkeys, cattle, horses, sheep, goats, pigs, rabbits, dogs, cats, rats, and mice.

[0031] In a preferred embodiment, the subject is a human being.

[0032] In this article, "liver injury caused by sepsis" is distinguished from other types of liver injury. Sepsis is a systemic inflammatory response syndrome triggered by infection, which can lead to multiple organ dysfunction, including that of the liver. Other types of liver injury include drug-induced liver injury, alcoholic liver injury, and viral liver injury.

[0033] It is important to note that the clinical treatment of sepsis-related liver injury follows different protocols compared to other types of liver injury. For example, in the United States, the treatment of sepsis and its resulting liver injury typically follows the Surviving Sepsis Campaign (SSC) guidelines, while the treatment of other types of liver injury is based on the guidelines of the American Association for the Study of Liver Diseases (AASLD).

[0034] As used herein, the term "treatment" refers to the eradication or improvement of the underlying condition being treated. The therapeutic benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying condition, resulting in observed improvement in the patient, although the patient may still have the underlying condition.

[0035] As used herein, the term “prevention” means the preventive treatment of a disease, symptom, or condition; or the delay of the onset or progression of such disease, symptom, or condition.

[0036] In some implementations, the reagents of this application are used in therapeutically effective or preventatively effective amounts.

[0037] As used herein, the term "therapeutic effective dose" refers to the amount of the reagents used herein to achieve the desired therapeutic outcome (i.e., inhibition of GPR84 expression, or inhibition of GPR84 activity). Therapeutic effective doses can be determined by initially administering a low dose and then incrementally increasing that dose until the desired effect is achieved. Therapeutic effective doses can also vary depending on the intended application (in vitro or in vivo) or the subject being treated and the disease condition, such as the subject's weight and age, the severity of the disease condition, the route of administration, etc., which can be readily determined by those skilled in the art.

[0038] As used herein, the term "preventative effective dose" refers to the amount of the reagent disclosed herein that is effective in achieving the desired preventative outcome within the necessary dosage and time period. Typically, because the preventative dose is used in subjects before or in the early stages of disease, the preventative effective dose will be less than the therapeutic effective dose.

[0039] On the other hand, this application provides the use of the composition in the preparation of a medicament for treating or preventing liver injury caused by sepsis, wherein the composition comprises:

[0040] Reagents that inhibit GPR84 expression or GPR84 activity; and

[0041] Pharmaceutically acceptable carrier.

[0042] In specific embodiments, pharmaceutically acceptable carriers include the group consisting of viral carriers (such as AAV viral carriers, lentiviral carriers), nanoemulsions, capsules, lipid nanoparticles (LNPs), cationic polymers, and GalNAc coupling modifications.

[0043] In another aspect, this application provides the use of a pharmaceutical combination in the preparation of a pharmaceutical composition for treating or preventing liver injury caused by sepsis, wherein the pharmaceutical combination comprises:

[0044] Reagents that inhibit GPR84 expression and / or reagents that inhibit GPR84 activity; and

[0045] Choose one or more drugs from the group consisting of: antibiotics, antifungals, vasoactive drugs, anti-inflammatory agents, immunomodulators, and hepatoprotective drugs.

[0046] In specific implementations, antibiotics include β-lactams and quinolones.

[0047] In specific implementations, antifungal agents include fluconazole, voriconazole, caspofungin, and amphotericin B.

[0048] In a specific implementation, the vasoactive drug includes norepinephrine.

[0049] In a specific implementation, anti-inflammatory treatment agents include glucocorticoids.

[0050] In a specific implementation, the immunomodulator includes thymopeptides.

[0051] In specific implementations, the hepatoprotective drugs include N-acetylcysteine, polyene phosphatidylcholine, glycyrrhizic acid preparations, and S-adenosylmethionine.

[0052] In some embodiments, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0053] This application, through in vivo and in vitro models and by means of pathological morphological analysis, macrophage enrichment analysis, biochemical index detection, and inflammatory factor detection, has demonstrated the therapeutic efficacy of reagents that inhibit GPR84 expression or activity against sepsis-induced liver injury (which is reflected in the comprehensive improvement of cell and tissue structure, macrophage infiltration, inflammatory response, and liver function), as well as its clinical therapeutic potential.

[0054] Without being bound by theory, the reagents for inhibiting GPR84 expression or activity described in this application may be partially related to inhibiting macrophage migration, inflammatory invasion, and inducing macrophage polarity phenotypic switching. However, given the unexpected in vitro and in vivo therapeutic effects demonstrated in the Examples section below, the specific therapeutic mechanism still requires further investigation. Attached Figure Description

[0055] Figure 1 The results of bioinformatics analysis of sepsis samples are shown in the figure.

[0056] Figure 2 The graph shows the expression levels of GPR84 in patients with sepsis and healthy controls;

[0057] Figure 3 A diagram showing the establishment of a mouse model of acute septic liver injury is presented.

[0058] Figures 4A to 4D A graph showing the cellular distribution of GPR84 in damaged liver, analyzed by single-cell sequencing.

[0059] Figure 5 A diagram is shown to validate the establishment of the inflammatory cell model;

[0060] Figure 6 The results of detecting the mRNA levels of GPR84 and a series of related G protein receptor families are shown in the figure.

[0061] Figure 7 A graph showing the quantitative analysis of GPR84 protein levels is presented;

[0062] Figure 8 A diagram showing the changes in GPR84 expression and cellular localization in the liver is presented.

[0063] Figure 9 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as evaluated by liver pathological morphology analysis.

[0064] Figure 10 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as assessed by macrophage immunohistochemical staining.

[0065] Figure 11 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as assessed by serum biochemical markers.

[0066] Figure 12 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as assessed by inflammatory factor detection.

[0067] Figure 13 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as evaluated by liver pathological morphology analysis.

[0068] Figure 14 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as assessed by macrophage immunohistochemical staining.

[0069] Figure 15The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as assessed by serum biochemical markers.

[0070] Figure 16 The figure shows the therapeutic or protective effect of GPR84 expression inhibition on mice with septic liver injury, as assessed by inflammatory factor detection.

[0071] Figure 17 The figure shows the effect of knocking down GPR84 expression on inflammatory macrophages as verified by cell growth and proliferation.

[0072] Figure 18 The figure shows the effect of knocking down GPR84 expression on inflammatory macrophages, as verified by cell migration ability;

[0073] Figure 19 The figure shows the effect of knocking down GPR84 expression on inflammatory macrophages by verifying the level of inflammatory factor secretion;

[0074] Figure 20 The figure shows the Annexin V apoptosis staining experiment verifying that knocking down macrophage GPR84 alleviates its apoptosis-inducing effect on hepatocytes;

[0075] Figure 21 The figure shows the effect of knockdown of GPR84 expression on inflammatory macrophages by detecting macrophage markers using flow cytometry and qPCR. Detailed Implementation

[0076] The present application will be described in detail below with reference to specific embodiments and examples, thereby making its advantages and various effects more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0077] Example 1: Bioinformatics Analysis of Sepsis Samples and Control Samples

[0078] 1. Data Acquisition and Filtering

[0079] First, we retrieved all GSE sequence data from sepsis-related clinical studies from the GEO (Gene Expression Omnibus) database. The selection criteria were as follows:

[0080] - The sample must be a clinical sepsis sample containing mRNA expression data;

[0081] - Both the sepsis group and the healthy control group must include at least 3 samples;

[0082] - The experiment requires the use of the Affymetrix HG-U133 or a higher version of the microarray platform for detection.

[0083] 2. Data Analysis

[0084] For each selected dataset, a Linear Models for Microarray Data (limma) model was applied to fit the data, calculating the fold change (FC) and p-value for each gene. The specific steps are as follows:

[0085] - Fit a linear model using the "lmFit" function in the limma package and calculate the FC and p-value for each gene;

[0086] - Apply the p-value merging method of the Random Effects Model to merge the statistical results of each dataset and perform weighted merging of the Full Collective (FC).

[0087] 3. Meta-Analysis

[0088] The meta-analysis process described above yielded a list of candidate genes. These genes showed significant changes in sepsis patient samples compared to control samples, as shown in the results below. Figure 1 As shown.

[0089] Figure 1 A volcano plot showing the analysis results of differentially expressed genes related to sepsis is presented, visually illustrating the expression differences of all analyzed genes. Data points in the plot are categorized into three groups based on their direction of change and statistical significance: gray dots represent genes with no significant difference, orange dots represent genes significantly upregulated in sepsis patient samples, and green dots represent genes significantly downregulated (gene names are labeled only for some orange and green dots). Next, based on our previous research, we will further screen the numerous significantly upregulated and downregulated genes.

[0090] Among the significantly upregulated genes, although some were significantly elevated (e.g., PFKFB3 was expressed approximately 5.7-fold more in sepsis patients than in control samples) and were key drivers, these genes may not be direct drivers of liver-specific injury. Furthermore, the core mechanisms of some significantly upregulated genes in septic liver injury are less clear, and we believe they are unsuitable as potential therapeutic targets for septic liver injury.

[0091] Among the significantly downregulated genes, some were downregulated only to a small degree. Furthermore, while some genes were significantly downregulated, based on our information, their direct association with core pathological processes of septic liver injury (such as neutrophil infiltration and uncontrolled inflammation) is weak; their downregulation is more likely a result of the injury or a concomitant phenomenon. Therefore, we hypothesize that they are not suitable as potential therapeutic targets for septic liver injury.

[0092] Ultimately, based on the results of the meta-analysis and our existing information and experience, we initially selected GPR84 as a potential test subject.

[0093] 4. Result Verification

[0094] To further verify the expression of GPR84 in patients with septic liver injury, we conducted the following experiment:

[0095] - The expression level of GPR84 in sepsis patients and healthy controls was detected using qRT-PCR technology. The GPR84 level was also detected in patients with clinical sepsis-induced liver injury and subjects with normal liver function. Results are as follows: Figure 2 As shown.

[0096] Depend on Figure 2 (***: p < 0.001) indicates that SLI (Sepsis-associated liver injury) served as a key grouping variable in this experiment to reveal the specific association between GPR84 expression levels and the severity of sepsis complications (liver injury). The sepsis patient population was further subdivided into sepsis patients without liver injury and sepsis patients with liver injury based on whether liver injury was present.

[0097] By comparing the Sepsis group and the SLI group, we found that the GPR84 expression level in the SLI group (i.e., sepsis patients with liver damage) was significantly higher than that in sepsis patients without liver damage, suggesting a potential association between GPR84 expression and the severity of liver damage.

[0098] The above results indicate that high expression of GPR84 is closely associated with severe complications of sepsis, such as liver damage.

[0099] Example 2: Clarifying the role of GPR84 in septic liver injury

[0100] 1. Establishment of a mouse model of acute septic liver injury

[0101] To verify the role of GPR84 in sepsis-related acute liver injury, we established a mouse model of septic acute liver injury. The specific steps are as follows:

[0102] - Animal selection: Six-week-old male C57 BL / 6 mice were selected as experimental animals.

[0103] - Modeling method: Acute liver injury was induced by intraperitoneal injection of a mixture of LPS (20 μg / kg) and D-GaLN (700 mg / kg) in physiological saline.

[0104] - Sample collection: Blood was collected from the eyes of mice at 30 min, 2 h, 4 h and 6 h after modeling. Mice were euthanized by cervical dislocation and serum and liver tissue were collected.

[0105] - Liver tissue processing: The abdominal cavity was opened to expose the liver, and liver tissue from the same location was collected and photographed. The liver tissue was fixed with paraformaldehyde, trimmed, embedded in paraffin, sectioned, and then stained with H&E to assess the degree of liver damage.

[0106] - Immunohistochemical experiment: Immunohistochemical staining of liver sections with macrophage marker F4 / 80 was performed to assess the enrichment status of liver macrophages, i.e. the degree of liver inflammatory damage.

[0107] - Serum biochemical index detection: The kit was used to measure liver function biochemical indexes such as ALT (alanine aminotransferase) and AST (aspartate aminotransferase) in serum.

[0108] - Detection of inflammatory factors: The levels of Il-1β, Il-6 and Tnf-α in serum were measured by ELISA.

[0109] - RNA extraction and qPCR experiment: Total RNA was extracted from liver tissue using the Trizol method, and cDNA samples were obtained after reverse transcription. qPCR experiments were then performed to detect the mRNA levels of inflammatory factors such as Il-1β, Il-6, Tnf-α, and Nos2.

[0110] Test results as follows Figure 3 As shown in the figure, a mouse model of acute septic liver injury was successfully established.

[0111] 2. Single-cell sequencing analysis of GPR84 cell distribution in damaged liver

[0112] To further clarify the cell-specific expression of GPR84 in sepsis-related acute liver injury, we performed single-cell sequencing analysis on the liver tissue of mice after modeling. The specific steps are as follows:

[0113] - Sample Preparation: Liver tissue from mice 6 h after modeling was collected, rinsed thoroughly with pre-cooled PBS, and cut into small pieces approximately 1 mm³. The liver tissue was digested at 37°C for 20-30 minutes using collagenase IV (1 mg / mL) and DNase I (20 U / mL), with gentle pipetting to promote cell dissociation. The digested tissue suspension was filtered through a 70 μm cell sieve to collect a single-cell suspension. Red blood cells were removed using red blood cell lysis buffer, and the cells were then resuspended in PBS to adjust the cell concentration to 1 × 10⁻⁶. 6 cells / mL.

[0114] - Single-cell sequencing library construction: Single-cell capture and library construction were performed using the 10x Genomics single-cell sequencing platform. Following the manufacturer's instructions, single-cell suspensions were mixed with gel beads and an oil phase to generate single-cell emulsion droplets. Cell lysis, mRNA capture, and reverse transcription were performed within the emulsion droplets to generate a cDNA library containing cell barcodes and a Unique Molecular Identifier (UMI).

[0115] The cDNA library was amplified, fragmented, and ligated with sequencing adapters to construct the final single-cell sequencing library.

[0116] - Sequencing and Data Analysis: High-throughput sequencing of the library was performed using the Illumina sequencing platform to obtain single-cell transcriptome data. Cell Ranger software was used to align, quantify, and decode the raw sequencing data, generating single-cell gene expression matrices. Single-cell data analysis tools such as Seurat or Scanpy were used for data quality control, standardization, dimensionality reduction (e.g., PCA and UMAP), and cell cluster analysis.

[0117] Cell populations are annotated based on known cell marker genes (such as F4 / 80, Cd68, Cd11b, etc.) to identify monocyte-macrophage populations, hepatocyte populations, endothelial cell populations, etc.

[0118] - GPR84 Expression Analysis: GPR84 expression information was extracted from single-cell transcriptome data, and its expression level in each cell population was calculated. The enrichment of GPR84 in the monocyte-macrophage population was visualized using UMAP. Differential expression analysis tools (such as MAST or Wilcoxon test) were used to compare the expression differences of GPR84 in the monocyte-macrophage population with other cell populations to verify its specific enrichment.

[0119] To characterize the cellular landscape of LPS / galn-induced liver injury, we performed single-cell RNA sequencing (scRNA-seq) on liver tissue obtained 6 hours post-treatment. Transcriptomic analysis of 15,000 high-quality single cells revealed nine distinct cell populations. Figure 4A It is evident that macrophages exhibit the most pronounced transcriptional reprogramming; characterized by elevated expression of typical inflammatory mediators, including Il-1β, Il-6, Tnf-α, and Nos2 (…). Figure 4B ).Depend on Figure 4C As can be seen, all cells in the control group appeared gray, indicating that GPR84 was not expressed at all; while in the LPS / GalN treatment group, a large number of pinkish-purple scattered dots appeared, representing high expression of GPR84 (according to the color bar "Log2Expr-Gpr84" on the right, the higher the value, the stronger the expression). It is worth noting that these high expression dots are not randomly distributed, but densely appear in the clustered areas of macrophages and hepatocytes in the first image. Especially in the macrophage-enriched area, the expression intensity of GPR84 is the highest (the color is close to 3.0), and the hepatocyte area also has moderate expression (about 1.0–2.0), while other cell types are basically gray or have an expression level close to 0. Therefore, GPR84 is mainly enriched in macrophages, moderately expressed in hepatocytes, and negligible in other cell types. It is worth noting that, compared with the control group, GPR84 is one of the ten genes most upregulated in hepatic macrophages with damaged liver ( Figure 4D Based on this, we believe that liver macrophages are a potential target cell type for GPR84 to play a key role in septic liver injury.

[0120] 3. Establishment of an inflammatory macrophage model

[0121] To simulate the pathological state of liver macrophages under sepsis conditions in vitro, we established an inflammatory macrophage model. The specific steps are as follows:

[0122] - Cell selection: The mouse macrophage cell line RAW264.7 was selected, and primary Kupffer cells were extracted from mouse liver using the Percoll separation-gradient centrifugation method.

[0123] - Inflammatory stimulation: Cells were stimulated with 1 μg / mL lipopolysaccharide (LPS) or 200 μM palmitic acid (PA) to simulate an inflammatory state.

[0124] - Sample collection: Samples were collected at 2 h, 4 h, 6 h, 12 h and 24 h after stimulation.

[0125] - qPCR experiment: Total RNA was extracted from cells using the Trizol method, and cDNA samples were obtained after reverse transcription. qPCR experiments were then performed to detect the mRNA levels of inflammatory factors such as Il-1β, Il-6, Tnf-α, and Nos2, verifying the establishment of the inflammatory cell model. Results are as follows: Figure 5 As shown.

[0126] 4. Expression detection of GPR84 in in vivo and in vitro models

[0127] To clarify the role of GPR84 in sepsis-related liver injury and macrophage inflammation, we examined the expression of GPR84 in in vitro and in vivo models. The specific steps are as follows:

[0128] - RNA extraction and qPCR experiment: Total RNA was extracted from the above-mentioned model-injured liver tissue, control, and inflammatory macrophage samples using the Trizol method. After reverse transcription, cDNA samples were obtained and subjected to qPCR experiments to detect the mRNA levels of GPR84 and a series of related G protein receptor families. Results Figure 6 As shown.

[0129] - Protein extraction and Western blot experiment: Total protein was extracted from the above-mentioned model-damaged liver tissue, control, and inflammatory macrophage samples using RIPA lysis buffer, and Western blot experiments were performed. Specific steps included SDS-PAGE gel electrophoresis, membrane transfer, blocking, low-temperature incubation with GPR84 monoclonal antibody, secondary antibody incubation, electrochemiluminescence imaging, and image acquisition using a gel imaging system. Quantitative analysis of GPR84 protein levels was conducted, and the results are as follows: Figure 7 As shown.

[0130] - Immunofluorescence double staining assay: Immunofluorescence double staining assays were performed on liver sections damaged during the modeling process, involving GPR84 with the macrophage marker F4 / 80 and GPR84 with the hepatocyte marker ALB, to assess the expression changes and cellular localization of GPR84 in the liver. Results are as follows: Figure 8 As shown.

[0131] Depend on Figure 6 and Figure 7 As shown, compared to the control, to investigate the functional role of GPR84 in macrophage-mediated inflammation, we stimulated RAW264.7 cells with LPS within 0-24 hours. GPR84 transcription was rapidly induced within 2 hours, reaching a peak at 4 hours, while protein expression gradually increased, reaching its highest level between 4 and 6 hours. Importantly, the induction amplitude of GPR84 exceeded that of other members of the GPCR family, highlighting its selective involvement in LPS-driven inflammatory signaling pathways.

[0132] Depend on Figure 8Immunofluorescence staining confirmed the transcriptomic findings, showing that GPR84 had strong co-localization with F4 / 80+ macrophages, but little overlap with Alb+ hepatocytes. This suggests that the upregulation of GPR84 during liver injury is macrophage-specific and may originate from both infiltrative and resident macrophage populations.

[0133] In summary, these data collectively confirm that GPR84 is a receptor enriched in macrophages and is selectively activated during acute liver injury.

[0134] This embodiment established a mouse model of acute liver injury due to sepsis, followed by single-cell sequencing and an inflammatory macrophage model. This demonstrated the expression changes and functions of GPR84 in sepsis-related liver injury and inflammation, confirming that liver macrophages are the key cell population for GPR84 expression and regulation of liver injury in the liver. This provides experimental evidence for further research on GPR84 as an anti-sepsis target.

[0135] Example 3: Verification of the therapeutic or protective effect of inhibiting GPR84 expression on a mouse model of septic liver injury.

[0136] 1. Grouping and processing of laboratory animals

[0137] - This implementation method used 20 six-week-old male wild-type C57 BL / 6 mice, which were randomly divided into the following 4 groups:

[0138] ① Control group without model (Ctrl) + empty AAV virus: Mice were injected with empty AAV adeno-associated virus via the tail vein as a blank virus control.

[0139] ② Acute liver injury modeling (LPS / D-GaLN) + empty AAV virus control group: Mice were injected with empty AAV adeno-associated virus via the tail vein and intraperitoneally injected with a mixture of LPS (20 μg / kg) and D-GaLN (700 mg / kg) in physiological saline to induce acute liver injury.

[0140] ③ No modeling + AAV shRNA GPR84 treatment group: Mice were injected with AAV adeno-associated virus carrying shRNA GPR84 via the tail vein.

[0141] ④ Acute liver injury modeling + AAV shRNA GPR84 treatment group: Mice were injected with AAV adeno-associated virus carrying shRNA GPR84 via the tail vein, and injected intraperitoneally with a mixture of LPS (20 μg / kg) and D-GaLN (700 mg / kg) in physiological saline to induce acute liver injury.

[0142] The shRNA GPR84 sequence is (5' to 3'): AAGGTATATTGCTGTTGACAGTGAGCGCCAACTTCTCCTGCTACCATAGTGAAGCCACAGATGTATGGTAGCAGGAGAAGTTGGTGCCTACTGCCTCG (SEQ ID NO:1)

[0143] 2. Experimental Procedure

[0144] - Pretreatment: Three weeks before modeling, mice in the treatment group were injected via tail vein with shRNA GPR84 AAV adeno-associated virus or vector control virus, and then fed normally for 3 weeks.

[0145] - Modeling: On the day of sampling, mice in all model groups were intraperitoneally injected with a mixture of LPS (20 μg / kg) and D-GaLN (700 mg / kg) in physiological saline to induce acute liver injury. Mice in the non-modeling group were given intraperitoneal injection of the corresponding physiological saline as a control.

[0146] - Sample collection: Six hours after modeling, blood was collected from the eyes of all mice to collect serum and liver tissue samples were taken.

[0147] 3. Detection Indicators and Methods

[0148] - Similar to the establishment of the mouse sepsis acute liver injury model in Example 2 above, this study included several detection indicators and methods, such as liver tissue processing, H&E staining, immunohistochemistry, serum biochemical index detection, and inflammatory factor expression and secretion detection. The therapeutic or protective effect of GPR84 expression inhibition on mice with sepsis-induced liver injury was evaluated. Results are as follows: Figure 9-12 As shown.

[0149] 4. Results Analysis

[0150] - Liver pathological morphological analysis: Figure 9 Liver sample observation and H&E staining results showed that the liver tissue of mice in the acute liver injury model + empty AAV virus control group was significantly damaged, congested and pathologically altered, including hepatocyte necrosis, inflammatory cell infiltration and tissue structure disorder. In contrast, the acute liver injury model + AAV shRNA GPR84 treatment group showed significantly reduced liver pathological damage, hepatocyte necrosis and inflammatory cell infiltration, indicating that inhibiting GPR84 expression has a protective effect on the liver.

[0151] - Macrophage enrichment analysis: Figure 10Immunohistochemical staining results showed that the expression of macrophage marker F4 / 80 was significantly increased in liver samples from mice in the acute liver injury model + empty AAV virus control group, indicating that macrophages were abundant in the liver. In contrast, the F4 / 80 expression level was significantly decreased in the acute liver injury model + AAV shRNA GPR84 treatment group, suggesting that inhibiting GPR84 expression can reduce macrophage infiltration in the liver, thereby alleviating the inflammatory response.

[0152] - Serum biochemical marker detection: Figure 11 In the acute liver injury model + empty AAV virus control group, serum ALT and AST levels were significantly elevated, indicating severe liver function impairment. In contrast, in the acute liver injury model + AAV shRNA GPR84 treatment group, ALT and AST levels were significantly lower, approaching those of the normal control group, indicating that inhibiting GPR84 expression can effectively improve liver function.

[0153] - Inflammatory factor detection: Figure 12 ELISA and Kuffer cell qPCR results from mouse serum samples showed that the secretion and expression levels of IL-1β, IL-6, and TNF-α were significantly increased in the serum of mice in the acute liver injury model + empty AAV virus control group, indicating a strong inflammatory response. In contrast, the secretion and expression levels of the above inflammatory factors were significantly reduced in the acute liver injury model + AAV shRNA GPR84 treatment group, suggesting that inhibiting GPR84 expression can effectively suppress the inflammatory response.

[0154] The results above indicate that inhibiting GPR84 expression significantly reduces liver pathological damage, improves hepatocyte necrosis, and alleviates tissue structural disorder. Inhibiting GPR84 expression reduces macrophage infiltration in damaged liver and lowers the inflammatory response. Inhibiting GPR84 expression significantly reduces serum ALT and AST levels and improves liver function. Inhibiting GPR84 expression effectively reduces the secretion and expression levels of inflammatory factors (IL-1β, IL-6, TNF-α, etc.) in serum and hepatic macrophages.

[0155] also, Figure 9-12 No significant differences were found between the non-model + AAV shRNA GPR84 treatment group and the non-model + empty AAV virus control group in various indicators, indicating that the treatment of inhibiting GPR84 expression in vivo has no significant effect on various indicators of liver function under normal and undamaged conditions.

[0156] Example 4: Therapeutic or protective effects of GPR84 inhibitors on a mouse model of septic liver injury.

[0157] 1. Grouping and processing of laboratory animals

[0158] - In this example, ten 6-week-old male wild-type C57 BL / 6 mice were randomly divided into the following two groups:

[0159] ① Acute liver injury modeling + saline control group: Mice were given saline by gavage every other day for one week before modeling.

[0160] ② Acute liver injury modeling + PBI-4050 treatment group: mice were treated with the GPR84 inhibitor PBI-4050 by gavage every other day one week before modeling.

[0161] 2. Experimental Procedure

[0162] - Pretreatment: Mice in the treatment group were administered 200 mg / kg PBI-4050 or control saline by gavage every other day starting one week before modeling, for a period of 1 week.

[0163] - Modeling: On the day of sampling, all mice were intraperitoneally injected with a mixture of LPS (20 μg / kg) and D-GaLN (700 mg / kg) in physiological saline to induce acute liver injury.

[0164] - Sample collection: Six hours after modeling, blood was collected from the eyes of all mice to collect serum and liver tissue samples were taken.

[0165] 3. Detection Indicators and Methods

[0166] - Similar to the establishment of the mouse sepsis acute liver injury model in Example 2 above, this study included several detection indicators and methods, such as liver tissue processing, H&E staining, immunohistochemistry, serum biochemical index detection, and inflammatory factor expression and secretion detection. The therapeutic or protective effect of GPR84 expression inhibition on mice with sepsis-induced liver injury was evaluated. Results are as follows: Figure 13-16 As shown.

[0167] 4. Results Analysis

[0168] - Liver pathological morphological analysis: Figure 13 Observational records of liver samples and H&E staining results showed that the liver tissue of mice in the acute liver injury model + saline control group exhibited significant damage, congestion, and pathological changes, including hepatocyte necrosis, inflammatory cell infiltration, and tissue structure disorder. In contrast, the acute liver injury model + PBI-4050 treatment group showed significantly reduced liver pathological damage, hepatocyte necrosis, and inflammatory cell infiltration, indicating that inhibiting GPR84 activity has a protective effect on the liver.

[0169] - Macrophage enrichment analysis: Figure 14Immunohistochemical staining results showed that the expression of macrophage marker F4 / 80 was high in liver samples from mice with acute liver injury model + saline control group, indicating that macrophages were abundant in the liver. In contrast, the expression level of F4 / 80 was significantly reduced in the acute liver injury model + PBI-4050 treatment group, indicating that reducing GPR84 activity can reduce macrophage infiltration in the liver, thereby alleviating the inflammatory response.

[0170] - Serum biochemical marker detection: Figure 15 In mice with acute liver injury model + saline control group, serum ALT and AST levels were significantly higher than normal, indicating severe liver function impairment. In contrast, in acute liver injury model + PBI-4050 treatment group, ALT and AST levels were significantly lower and close to normal, indicating that inhibiting GPR84 activity can effectively improve liver function.

[0171] - Inflammatory factor detection: Figure 16 ELISA and Kuffer cell qPCR results from mouse serum samples showed that the secretion and expression levels of IL-1β, IL-6, and TNF-α were higher in the serum of mice with acute liver injury model + saline control group, indicating a strong inflammatory response. In contrast, the secretion and expression levels of the above inflammatory factors were significantly lower in the acute liver injury model + PBI-4050 treatment group, suggesting that inhibiting GPR84 activity can effectively suppress the inflammatory response.

[0172] The results above indicate that inhibiting GPR84 activity in mice significantly reduces liver pathological damage, improves hepatocyte necrosis, and alleviates tissue structural disorder. Inhibition of GPR84 activity in mice reduces macrophage infiltration in damaged livers and lowers the inflammatory response. Inhibition of GPR84 activity in mice significantly reduces serum ALT and AST levels and improves liver function. Inhibition of GPR84 activity in mice effectively reduces the secretion and expression levels of inflammatory factors (IL-1β, IL-6, TNF-α, etc.) in serum and hepatic macrophages.

[0173] Example 5: In vitro experimental verification of the effect of GPR84 knockdown on inflammatory macrophages

[0174] 1. Cell treatment:

[0175] - The RAW264.7 macrophage cell line was used as the experimental subject.

[0176] - Treating cells with the GPR84 inhibitor PBI-4050 for 24 hours inhibits GPR84 activity, or transfecting with the GPR84-specific siRNA sequence (5' to 3'): CCAACTTCTCCTGCTACCA (SEQ ID NO:2) for 48 hours knocks down GPR84 expression levels.

[0177] 2. Stimulation treatment:

[0178] - The treated cells were stimulated with LPS (1 μg / ml) for 2 hours.

[0179] 3. Detection indicators and methods:

[0180] - Cell growth and proliferation detection: The growth and proliferation of macrophage cell lines after treatment were detected using the WST-8 assay.

[0181] - Cell migration ability assay: The changes in the migration ability of macrophages after treatment were assessed by the Transwell cell migration assay.

[0182] - Detection of inflammatory factor secretion levels: The secretion levels of IL-6, IL-1β and TNF-α in the culture medium of macrophages after treatment were detected by ELISA.

[0183] - Detection of cellular inflammatory invasion capacity: Using a co-culture experiment of small-aperture Transwell macrophages RAW264.7 and hepatocytes AML12, the ability of stimulated macrophages to induce hepatocyte apoptosis was examined to comprehensively reflect the inflammatory invasion capacity of cells.

[0184] - Macrophage polarization assay: Using flow cytometry and qPCR experiments with specific cell markers, we investigated the effect of inhibiting GPR84 expression or activity on macrophage polarization.

[0185] It should be noted that, considering the ligand-activated receptor nature of GPR84, in the in vitro experiments, 6-OAU (5 μM) and lauric acid (50 μM) were uniformly added to the cell culture system to activate GPR84 function.

[0186] 4. Results Analysis

[0187] - Cell growth and proliferation: Figure 17 The results of the WST-8 experiment showed that, compared with the control group, LPS stimulation promoted the growth of macrophages, while treatment with the GPR84 inhibitor PBI-4050 or knockdown of GPR84 expression by siRNA had no significant effect on the growth and proliferation of macrophages induced by LPS.

[0188] - Cell migration ability: Figure 18 Transwell cell migration assays showed that, compared with the control group, LPS stimulation significantly improved macrophage migration ability, while treatment with the GPR84 inhibitor PBI-4050 or siRNA knockdown of GPR84 expression effectively inhibited LPS-induced macrophage migration and reduced macrophage migration ability.

[0189] - Levels of inflammatory factor secretion: Figure 19 The results of the ELISA experiment showed that, compared with the control group, LPS stimulation induced the secretion of inflammatory factors such as IL-6, IL-1β and TNF-α in macrophages. Treatment with the GPR84 inhibitor PBI-4050 or knockdown of GPR84 expression by siRNA could significantly inhibit the secretion level of the above inflammatory factors, suggesting that inhibiting GPR84 plays a controlling role in the inflammatory response of inflammatory macrophages.

[0190] - Cellular inflammatory invasion ability: Figure 20 Annexin V apoptosis staining results of macrophage-hepatocyte co-culture experiments showed that LPS-treated macrophages could significantly induce partial apoptosis in co-cultured hepatocytes. Treatment with the GPR84 inhibitor PBI-4050 or siRNA knockdown of GPR84 expression significantly reduced the apoptosis rate of co-cultured hepatocytes, suggesting that inhibiting GPR84 can suppress the inflammatory immune function of inflammatory macrophages and alleviate excessive inflammatory damage to cells.

[0191] - Macrophage polarization: Figure 21 Mid-flow cytometry and qPCR experiments showed that LPS treatment significantly induced M1 pro-inflammatory phenotype polarization in macrophages, while treatment with the GPR84 inhibitor PBI-4050 or siRNA knockdown of GPR84 expression significantly reversed the M1 polarization state of macrophages and induced M2 polarization phenotypic conversion.

[0192] This embodiment investigated the effects of inhibiting GPR84 expression or reducing its activity by culturing RAW264.7 macrophage cells in vitro and stimulating them with lipopolysaccharide (LPS) on various aspects of macrophage immune function, including growth, proliferation, migration, inflammatory invasion, and polarization. The experimental results showed that:

[0193] - Inhibition of GPR84 expression or activity had no significant effect on the growth and proliferation of inflammatory macrophages.

[0194] - Inhibiting GPR84 expression or activity significantly reduced the migration ability, inflammatory factor secretion, and inflammatory invasion ability of LPS-induced inflammatory macrophages, and altered the M1 pro-inflammatory phenotype of inflammatory macrophages, causing them to transform into the M2 phenotype and exert anti-inflammatory capabilities.

Claims

1. Use of reagents that inhibit GPR84 expression in the preparation of drugs for the treatment or prevention of liver damage caused by sepsis.

2. The use as described in claim 1, wherein, The reagent for inhibiting GPR84 expression is selected from one or more of the group consisting of siRNA, shRNA, and aptamers.

3. Use of reagents that inhibit GPR84 activity in the preparation of drugs for the treatment or prevention of liver damage caused by sepsis.

4. The use as described in claim 1, wherein, The reagent used to inhibit GPR84 activity was selected from PBI-4050.

5. Use of the composition in the preparation of a medicament for the treatment or prevention of liver injury caused by sepsis, wherein, The composition comprises: Reagents that inhibit GPR84 expression or GPR84 activity; and Pharmaceutically acceptable carrier.

6. The use as described in claim 5, wherein, The reagent for inhibiting GPR84 expression is selected from one or more of the group consisting of ASO, siRNA, shRNA, miRNA, ribozyme, aptamer, and CRISPR interference system.

7. The use as described in claim 5, wherein, The reagent that inhibits GPR84 activity is selected from one or more of the group consisting of PBI-4547, PBI-4050, GPR84 antagonist 1, GLPG1205, and BGT-004.

8. The use according to any one of claims 5 to 7, wherein the pharmaceutically acceptable vector comprises a viral vector.

9. Use of the pharmaceutical combination in the preparation of a pharmaceutical composition for the treatment or prevention of liver injury caused by sepsis, wherein, The drug combination includes: Reagents that inhibit GPR84 expression and / or reagents that inhibit GPR84 activity; and Choose one or more drugs from the group consisting of: antibiotics, antifungals, vasoactive drugs, anti-inflammatory agents, immunomodulators, and hepatoprotective drugs.

10. The use as described in claim 9, wherein, The pharmaceutical composition further includes a pharmaceutically acceptable carrier.

Images