DDX54 fusion protein and preparation method thereof

The preparation of DDX54 fusion protein using the E. coli expression system solves the problem of efficiently preparing high-purity DDX54 fusion protein in existing technologies, achieving efficient and economical protein preparation and screening, and simplifying the production process.

CN121653097APending Publication Date: 2026-03-13SHENZHEN KEYE HEALTH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing technologies are difficult to efficiently prepare high-purity DDX54 fusion proteins that retain enzyme activity, and the production process is complex and costly.

Method used

The truncated recombinant human RNA helicase DDX54 fusion protein was expressed using the E. coli expression system. The fusion protein was expressed and purified in E. coli, with 49 amino acids deleted from the N-terminus and 131 amino acids deleted from the C-terminus. The post-translational modification protein SUMO and the purification tag histidine tag were also added.

Benefits of technology

This method enables the efficient and economical preparation of high-purity, soluble DDX54 fusion proteins, suitable for high-throughput screening of DDX54 inhibitors, simplifying the production process and reducing biosafety risks and costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653097A_ABST
    Figure CN121653097A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicines, and relates to a DDX54 fusion protein and a preparation method thereof. The amino acid sequence of the DDX54 fusion protein is as shown in SEQ ID NO: 1. The method comprises the following steps: 1) amplifying a nucleic acid sequence of the DDX54 fusion protein; 2) cloning the nucleic acid sequence to a prokaryotic expression vector; (3) transforming the prokaryotic expression vector into an E. coli strain; 4) inducing expression of the DDX54 fusion protein; and 5) purifying the DDX54 fusion protein. The DDX54 fusion protein disclosed by the invention has ATP hydrolase activity and helicase activity, the method disclosed by the invention is easy for large-scale production and can be used for high-throughput screening of DDX54 helicase or ATP hydrolase activity inhibitors, and a protein expression system of the DDX54 fusion protein is simple.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a fusion protein of the RNA helicase DDX54, its preparation method, and its applications. Background Technology

[0002] DEAD-box proteins are a class of ATP-dependent RNA helicases marked by the conserved motif Asp-Glu-Ala-Asp (DEAD). They regulate a series of key cellular processes, including translation initiation, nuclear and mitochondrial RNA splicing, and ribosome and spliceosome assembly, by remodeling RNA secondary structure. Members of this family are widely involved in vital activities such as embryogenesis, spermatogenesis, and cell growth and division; their functional abnormalities are often closely related to the occurrence and development of various diseases.

[0003] DDX54 (DEAD-box helicase 54) is a member of this family. The gene encoding it is located on human chromosome 12q24.13, contains 12 exons, and produces a major transcript of about 3.1 kb. Its protein product contains a typical DEAD domain and two nuclear localization signals, which are mainly distributed in the nucleolus and nucleoplasm.

[0004] At the functional level, the core role of DDX54 is to catalyze the maturation of the 60S large subunit peptidyl transferase center (PTC): it clamps and remodels the 90-93 helix region (H90-93 helix) in 28S rRNA in an ATP-dependent manner, recruits assembly factors such as nucleolar protein 2 (NOP2) and nuclear import protein 7 (NIP7), and ensures the correct folding of 28S rRNA and the stable generation of the 60S subunit.

[0005] Regarding disease association, Cancer Genome Atlas (TCGA) bioinformatics analysis and tissue microarray showed that DDX54 was significantly overexpressed in colorectal cancer. Functional experiments confirmed that it promotes tumor cell proliferation and migration and inhibits apoptosis by activating the NF-κB p6 subunit (NF-κB (p65)) axis. Knockdown can induce cell cycle arrest in the quiescent / first interval (G0 / G1) phase and caspase-3-dependent cell death, suggesting that it has the potential to be a prognostic marker and therapeutic target.

[0006] In addition, DDX54 forms a ternary complex with small nucleolar RNA host gene 10 (SNHG10) and transcription factor pre-B-cell leukemia homeobox 3 (PBX3), which stabilize each other and jointly drive the growth and movement of gastric cancer cells, providing a new mechanism for "RNA-protein interaction-tumor progression".

[0007] DDX54 participates in tumor progression through a multidimensional network of "ribosome generation-NF-κB activation-RNA complex regulation," and its high expression is associated with poor patient prognosis, making it a potential intervention. However, strategies targeting DDX54 are still in the laboratory stage, and further analysis of its structural and functional relationship and the development of specific inhibitors are needed to achieve clinical translation.

[0008] Existing techniques involve transiently transfecting HEK293T cells with an expression plasmid carrying the DDX54 ORF sequence to overexpress and produce DDX54 protein. However, this method is complex, difficult, costly, and yields low output, and there is no method for producing purified protein. Therefore, how to mass-produce high-purity DDX54 fusion proteins that retain the core enzyme activity while maintaining protein solubility is a pressing technical problem that needs to be solved in this field. Summary of the Invention

[0009] The purpose of this invention is to overcome the shortcomings of existing technologies and, using the cDNA sequence of human skin fibroblasts (HSF) as a library template, provide an easily obtainable method for cloning the RNA helicase DDX54 gene and a method for preparing the fusion protein. The prepared fusion protein... E. coli It exhibits good solubility and possesses good ATP hydrolase and helicase activities. This invention utilizes... E. coli The expression system expresses a truncated recombinant human RNA helicase DDX54 fusion protein. E. coli With a fast growth cycle and high efficiency, it can prepare sufficient quantities of soluble and active fusion proteins in a short time, making it suitable for high-throughput screening of DDX54 inhibitors.

[0010] On the one hand, the present invention provides a DDX54 fusion protein that simultaneously possesses ATP hydrolase and helicase activities, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0011] Compared to the natural human RNA helicase DDX54 protein, the DDX54 fusion protein has 49 amino acids missing from its N-terminus but has an added fusion tag, namely the post-translational modification protein SUMO, which has a structure similar to ubiquitin; and 131 amino acids missing from its C-terminus but has an added purification tag, namely the histidine tag (His-Tag).

[0012] Therefore, in embodiments of the present invention, the N-terminus of the DDX54 fusion protein has a post-translational modified protein SUMO with a structure similar to ubiquitin.

[0013] In a second aspect, the present invention provides a nucleic acid encoding the DDX54 fusion protein.

[0014] In an embodiment of the present invention, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO: 2.

[0015] In a third aspect, the present invention provides an expression vector containing nucleic acid encoding the DDX54 fusion protein.

[0016] In a preferred embodiment of the present invention, the expression vector is a prokaryotic expression vector, and the prokaryotic expression vector is preferably pET28a.

[0017] In a fourth aspect, the present invention provides a strain containing the expression vector described in the third aspect.

[0018] In a preferred embodiment, the above-mentioned strain contains the above-mentioned expression vector. In a specific embodiment, the strain is... E. coli Strains, such as Rossette DH5α, BL21 (DE3) or BL21 pLysS.

[0019] In a fifth aspect, the present invention provides a method for preparing the DDX54 fusion protein, comprising the following steps: 1) Amplify the nucleic acid sequence encoding the DDX54 fusion protein; 2) Clone the nucleic acid sequence into a prokaryotic expression vector; 3) Transform the prokaryotic expression vector into E. coli In the strains; 4) Inducing the expression of the DDX54 fusion protein, and 5) Purify the DDX54 fusion protein.

[0020] In a specific embodiment of the present invention, the prokaryotic expression vector is pET28a.

[0021] In a specific embodiment of the present invention E. coli The strains are Rossette (DE3), BL21 (DE3), or BL21 pLysS.

[0022] In a specific embodiment of the invention, purification can be performed, for example, by affinity chromatography.

[0023] In a sixth aspect, the present invention provides the use of the DDX54 fusion protein in the following: 1) Preparation of formulations that untangle the double-stranded structure of oligonucleotides; 2) RNA modification and processing, preferably mRNA precursor splicing; or 3) High-throughput screening of DDX54 helicase or ATP hydrolase activity inhibitors.

[0024] Compared with existing technologies, the present invention has the following beneficial effects. Specifically, the recombinant DDX54 fusion protein of the present invention simultaneously retains the activities of ATP hydrolase and RNA helicase, and can be used for physiological and biochemical operations such as DDX54 helicase and ATP hydrolase activity analysis, high-throughput screening of inhibitors, intermolecular interaction analysis, and antibody and detection kit preparation; it has high solubility, high expression level, and simple purification process, significantly reducing production costs. The present invention... E. coli The expression system delivers the core functional fragment of DDX54, overcoming the bottleneck of the large molecular weight (881 aa) and complex spatial structure of natural DDX54, which makes it difficult to prepare intact in conventional genetic engineering systems. The short bacterial culture cycle and rapid passage allow for the rapid acquisition of sufficient high-purity protein to meet large-scale production requirements. Compared to existing technologies that rely on HEK293T cells (human embryonic kidney 293 cells integrating the SV40 large T antigen gene) overexpression, this invention eliminates the cumbersome steps of viral element management, serum culture, and multiple transfections, simplifying the construction process, reducing biosafety risks and production costs. Furthermore, the recombinant protein yield and activity are superior to those of the eukaryotic system (see Table 1). Therefore, this invention provides an efficient, economical, and scalable protein preparation platform for DDX54 structure-function studies, target validation, and high-throughput screening of antitumor / antiviral drugs.

[0025] Table 1: Comparison of DDX54 protein production systems Attached Figure Description

[0026] Figure 1 This is a DDX54 gene map, where DDX54 is the full-length gene sequence, and the truncated DDX54 is the gene truncated sequence of this invention. Figure 2 Alignment of DDX54 with the natural DDX54 nucleotide sequence; Figure 3 The construction map of the prokaryotic expression plasmid pET28a-DDX54 (truncated); Figure 4 For DDX54 fusion protein in E. coli The induced expression of Rosetta (DE3) is shown in the figure, where + indicates induction with the addition of an inducer and - indicates induction without the addition of an inducer. Figure 5 The results show the affinity purification of the DDX54 fusion protein. Figure 6 The results are the ATP hydrolysis activity assay results for the DDX54 fusion protein; Figure 7 The results show the helicase activity assay of the DDX54 fusion protein. Detailed Implementation

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, as described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2012), or according to the conditions recommended in the manufacturer's instructions; the materials and reagents used, unless otherwise specified, are commercially available.

[0028] Example 1: Gene Cloning To obtain the target gene fragment of DDX54, this invention cultured human skin fibroblasts (HSF, purchased from Shanghai Boson Biotechnology Co., Ltd.), and amplified the full-length human wild-type DDX54 target gene fragment using an HSF cDNA library as a template. Referring to the natural DDX54 protein and nucleotide sequences (NCBI reference sequences: NP_076977.3 and NM_024072.4), the N-terminus and C-terminus of the DDX54 protein were selectively truncated. The N-terminus was truncated by 49 amino acids, and the C-terminus by 131 amino acids, while retaining the core enzyme active region, resulting in the amino acid sequence of the truncated DDX54 protein (see details). Figure 1 , Figure 2 Primers were designed accordingly. The target gene fragment was obtained via PCR polymerase chain reaction, and a high-concentration fragment solution was obtained using a gel DNA recovery kit (Hangzhou Xinjing Biotechnology Co., Ltd., Gel DNA Recovery Kit, 2001050). The truncated DDX54 target gene fragment and the pET28a vector (purchased from BioVector Plasmid Vector Strains Cell Protein Antibody Gene Preservation Center) were double-digested with restriction endonucleases (NdeI, XhoI) (New England Biotechnology (Beijing) Co., Ltd.). The truncated DDX54 gene fragment and the pET28a digestion products were then ligated, and the ligation product was transformed into... E. coli In DH5α (Shanghai Angyu Biotechnology Co., Ltd., DH5α, G6016), recombinant plasmids with correct sequencing were obtained by screening positive clones.

[0029] HSF cells were cultured until the cell density reached 90%, and RNA was extracted using an RNA extraction kit (MolPure® TRIeasy, Yisheng Biotechnology (Shanghai) Co., Ltd.). TMThe Plus Total RNA Kit (19211ES60) was used to extract total RNA from HSF cells. The concentration of the extracted RNA was measured to be 266 ng / µL. The extracted RNA was reverse transcribed in a 500 ng system to obtain a cDNA library. The reverse transcription system is shown in Table 2. Table 2: Reverse Transcription System

[0030] After adding the corresponding reagents to the system and mixing well, heat at 37°C for 15 min, then at 80°C for 15 s, and dilute to obtain 500 ng / µL cDNA.

[0031] Online primer design was used with Snap Gene software to amplify full-length DDX54; the full-length DDX54 was then truncated to obtain the amino acid and nucleotide sequences of the truncated DDX54, and primers were designed as follows: DDX54-F:atggcggccgacaagggcccg DDX54-R: tcacatcctcttccgcatcttgcccttcttggagcg DDX54-F / NdeI:ggtggtcatatggcggaagatgacgcccg DDX54-R / XhoI:gtggtgctcgagcttcttcttgtcttcctgtcct The target gene fragment was obtained by PCR polymerase chain reaction, and a high-concentration fragment solution was obtained by using a rapid purification kit (Beijing TransGen Biotech Co., Ltd., #S20513). The specific PCR reaction conditions are shown in Table 3.

[0032] Table 3: PCR amplification reaction system

[0033] The PCR amplification program is as follows: 94℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 55-65℃ annealing for 15 s, 68℃ extension for 3 min, 33 cycles; 68℃ extension for 10 min, 4℃ to finish.

[0034] The PCR product amplified by primers DDX54-F and DDX54-R was the CDS fragment of DDX54 in the cDNA of human skin fibroblasts (HSF). The product, which was 2643 bp in size, was recovered after 1% agarose gel electrophoresis.

[0035] The PCR product amplified by primers DDX54-F / NdeI and DDX54-R / XhoI was a 2103 bp truncated fragment of DDX54, which was recovered by 1% agarose gel electrophoresis and was 2103 bp in size.

[0036] The DDX54 truncated vector and pET28a were double-digested using restriction endonucleases (NdeI, XhoI) (New England Biotechnology (Beijing) Co., Ltd.). The double digestion systems are shown in Tables 4 and 5, respectively. Table 4: Double digestion system of truncated DDX54

[0037] Table 5: pET28a double enzyme digestion system

[0038] Add reagents according to the corresponding system, mix well, heat at 37℃ for 2 h, prepare a 1% nucleic acid gel for electrophoresis, cut and recover the gel, and perform ligation reaction using T4 ligase (New England Biotechnology (Beijing) Co., Ltd., T4 DNA ligase, M0202V). The ligation system is shown in Table 6. Table 6: Connection Reaction System

[0039] According to Table 6, after adding and mixing the ligation reaction system, the ligation was carried out overnight at room temperature to convert the ligation product to... E. coli In DH5α, the specific steps of the transformation are as follows: 1) Take it out of the -80℃ freezer E. coli DH5α competent cells were placed on ice until completely thawed. 2) Add 5 µL of the obtained ligation product to competent cells, gently pipette to mix, and then place on ice for 30 min. 3) Place the mixture after the ice bath into a 42°C water bath for heat shock for 1 min; 4) Quickly place the heat-shocked competent cells back onto ice and give them a 3-minute ice bath; 5) Add 700 μL of LB liquid medium to the competent cells after ice bath, and incubate at 37℃ in a shaker for 45-60 min to recover. 6) Centrifuge the revived bacterial culture at 12,000 rpm for 1 min, collect 100 μL of supernatant, and spread the precipitate evenly by pipetting and spreading it on an LB agar plate containing 100 mg / mL Kanamycin. Incubate at 37°C upside down overnight.

[0040] Pick 5-10 single colonies and place them in 3 mL LB liquid medium supplemented with Kana. Shake to the logarithmic phase, centrifuge at 8000 rpm for 2 min to obtain the bacterial strain. Extract plasmids using a plasmid miniprep kit (Tiangen Biotech (Beijing) Co., Ltd., Plasmid Miniprep Kit, DP103-03). Verify the obtained plasmid by digesting it again with restriction endonucleases (NdeI, XhoI). Sequencing yields the correct truncated DDX54 plasmid, i.e., plasmid pET28a-DDX54. Its construction diagram is shown below. Figure 3 As shown.

[0041] Example 2: Protein Induction Expression and Affinity Purification Transform the correctly sequenced plasmid pET28a-DDX54 into the expressed protein. E. coli The specific steps for transforming Rosetta(DE3) (Shanghai Beyotime Biotechnology Co., Ltd., Rosetta(DE3) supercompetent cells, D1067S) are as follows: Take out of the -80℃ freezer E. coli BL21(DE3) competent cells were placed on ice until completely thawed. 30 µL of competent cells were taken, and 2 µL of correctly sequenced plasmid was added. The mixture was gently pipetted and incubated on ice for 30 min. The mixture was then heat-shocked in a 42°C water bath for 1 min. The heat-shocked competent cells were quickly returned to ice and incubated for 3 min. 700 μL of LB liquid medium was added to the ice-shocked competent cells, and the mixture was incubated at 37°C with shaking for 45–60 min to recover. The recovered bacterial culture was centrifuged at 12,000 rpm for 1 min, and 100 μL of supernatant was collected. The precipitate was pipetted and spread onto LB agar plates containing 100 mg / mL Kana, and incubated upside down at 37°C overnight.

[0042] Four vigorous single colonies were selected and placed in 3 mL LB liquid medium containing Kana in shake tubes. The culture was shaken until the logarithmic growth phase. 1 mL of the bacterial culture was added to 20% glycerol and stored at -80℃. 1 mL of the bacterial culture was also added to 10 μL of 100 mM MIPTG inducer (Shanghai Aladdin Biochemical Technology Co., Ltd., isopropyl-β-D-thiogalactoside, I104812) and induced at low temperature for 4-6 h. 1 mL of the bacterial culture served as a control. The control and induced bacterial cultures were collected and centrifuged at 8000 rpm for 2 min. 250 μL of PBS (with 1% protease inhibitor (Kailian Gene Technology Co., Ltd., protease inhibitor Cocktail (EDTA-Free, 100x in DMSO), HY-K0010) was added, mixed, and sonicated. The mixture was centrifuged at 10000 rpm for 10 min at 4℃. The supernatant was used as the protein solution, and 20 μL of 5× protein loading buffer [1 M Tris-HCl (pH: 6.8)] was added. Mix 25% (w / v) + SDS (sodium dodecyl sulfate) 10% (w / v) + bromophenol blue 0.5% (w / v) + glycerol 50% (w / v) + β-mercaptoethanol 5% (w / v) and incubate at 95°C for 5 min to denature the protein. Prepare a 10% SDS-PAGE gel, and load 30 μL of each protein induction group and control group onto the gel. After gel running, quickly stain with Coomassie Brilliant Blue (Shanghai Beyotime Biotechnology Co., Ltd., Coomassie Brilliant Blue Rapid Staining Solution, P0017) for 2 h. Recover the Coomassie Brilliant Blue solution and decolorize with water until the bands are clearly visible. The induction efficiency can be judged based on the band size. Figure 4 As shown, a specific target protein band was observed at approximately 89.7 kDa, indicating that the DDX54 fusion protein is soluble and has significant induction efficiency.

[0043] Example 3: High-scale protein expression and affinity purification After obtaining the strain containing the induced target protein, the culture was expanded to 500 mL LB medium, and the bacterial suspension was collected. 81 mL of 0.5 M Na₂HPO₄ and 19 mL of 0.5 M NaH₂PO₄ were mixed and brought to a final volume of 1 L to prepare 50 mM PBS. A lysis buffer was prepared by adding 0.15 M NaCl, 2 mM β-mercaptoethanol, 25 mM imidazole, 1% Triton X-100, and 20% glycerol to 100 mL of the 50 mM PBS. 30 mL of the lysis buffer was added to the bacterial suspension, and the suspension was sonicated until complete lysis. The suspension was centrifuged at low temperature for 30 min, and the supernatant was collected. The supernatant was then added to His-tagged protein purification medium (Yisheng Biotechnology (Shanghai) Co., Ltd., His-tagged protein agarose purification resin, 20502ES50) and shaken for 1 hour to allow the protein to adhere to the purification medium. Prepare washing buffer 1 by dissolving 0.15 M NaCl, 1 mM β-mercaptoethanol, 25 mM imidazole, and 0.1% Triton X-100 in 1 L of 50 mM PBS. Prepare washing buffer 2 by dissolving 0.5 M NaCl, 1 mM β-mercaptoethanol, 25 mM imidazole, and 0.1% Triton X-100 in 1 L of 50 mM PBS. Wash the beads 5 times by inverting them with 10 mL each of washing buffer 1 and washing buffer 2. Then elute the target protein with elution buffer containing 250 mM imidazole (0.5 M NaCl, 1 mM β-mercaptoethanol, 250 mM imidazole, and 0.1% Triton X-100 dissolved in 1 L of 50 mM PBS).

[0044] The eluted protein samples were identified by SDS-PAGE, and the results are as follows: Figure 5 As shown, a specific target protein band was observed at approximately 89.7 kDa. Using protein quantification reagents, the purified protein concentration in eluent 1 reached 2.2 mg / mL. This means that the total yield of DDX54 fusion protein (purity >80%) can be extracted from a 0.5 L bacterial culture system of 3-5 mg.

[0045] Experimental results show that the DDX54 fusion protein has a significant induction efficiency and can produce DDX54 fusion protein with high purity and high concentration.

[0046] Example 4: ATPase activity assay Firefly luciferase (also known as luciferase) requires ATP to catalyze the production of fluorescence from luciferin. When both firefly luciferase and luciferin are in excess, within a certain concentration range, fluorescence production is directly proportional to the ATP concentration. This allows for highly sensitive detection of ATP concentration in solution. DDX54 is an ATP-dependent RNA helicase, which significantly consumes ATP during the unwinding reaction of double-stranded DNA. Generally, the greater the decrease in chemiluminescence signal, the stronger the ATP hydrolytic activity of the DDX54 protein. Following this method, the ATPase activity of the DDX54 fusion protein was measured in this example as follows: 1) Preparation of DNA substrates: Two DNA primers with different substrate labels were designed and synthesized: biotin-labeled DNA: 5'-biotin-GCTGACCCTGCTCCCAATCGTAATCTATAGTGTCACCTA-3'; digoxigenin-labeled DNA: 5'-DIG-CGATTGGGAGCAGGGTCAGC-3'. The two DNA oligomeric single-stranded molecules with different labels were resuspended at a molar ratio of 1:1 and mixed in an annealing reaction solution (2 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), pH 7.0, 0.05 M NaCl, 0.1 mM EDTA (ethylenediaminetetraacetic acid), and 0.01% (w / v) SDS). The reaction system was heated to 100℃ and maintained for 5 min, then cooled to 65℃ and maintained for 30 min. The DNA annealing reaction was set at 22℃ and carried out for 4 h. The obtained DNA double-stranded molecules were diluted with deionized water to a final concentration of 2.5 ng / µL, aliquoted, and stored at -20°C for later use.

[0047] 2) Prepare the enzyme reaction solution (25 mM MOPS, 5 µM ATP, 2 mM DTT, 3 mM MnCl2, 100 µg / mL BSA). Add 90 µL of enzyme reaction solution, 2.5 ng of DNA substrate, and 4 µL of DDX54 protein extract to each well. Incubate at 37°C for 1 h.

[0048] 3) Preparation of test reagents: Prepare ATP test solution: Mix ATP test reagent and diluent (Shanghai Beyotime Biotechnology Co., Ltd., ATP test kit, S0026-1, S0026-2) at a ratio of 1:9. Add 100 µL of ATP test solution to each well of a 96-well plate and let stand at room temperature for 5 min.

[0049] 4) ATP detection: Add 40 µL of ATP reaction solution to the well, mix well, and then use a multi-functional microplate reader (VICTOR Nivo 3S, VICTOR Biomedical (Shanghai) Co., Ltd.) to shake the plate at 600 rpm for 1 min. Then use the chemiluminescence function to read the value at 700 nm IR Blocker. The reading time is 5 s / well.

[0050] Experimental results show that DDX54 exhibits significant ATPase activity; specific data can be found in [link to data]. Figure 6 ,Depend on Figure 6 It can be seen that the luminescence signal of the experimental group with DDX54 is significantly lower than that of the control group (without enzyme), and the difference in readings is obvious. It can be determined that the DDX54 protein consumes a large amount of ATP in the enzyme reaction solution, proving that DDX54 has significant ATPase activity.

[0051] Referring to Table 7, the ATPase activity data, the average light signal values ​​of the control group and the DDX54 protein group were compared, showing that DDX54 has ATP hydrolysis activity. The inter-sample p-value was much less than 0.0001, indicating a significant difference between the two groups, and DDX54 has obvious ATPase activity. The Z-factor was 0.895, indicating that the signal of the DDX54 group had a high degree of differentiation from the background. The data has high reliability and repeatability, making it suitable for further analysis and research.

[0052] Table 7: ATPase activity data

[0053] Example 5: Helicase Activity Assay Biotin-labeled oligoDNA molecules anneal and pair with digoxigenin-labeled oligoDNA molecules to form a double-stranded DNA molecule with a 3'-protrusion. This double-stranded DNA molecule can be adsorbed by avidin, which is deposited at the bottom of a 96-well plate. After the helicase performs the helicogenic reaction, the digoxigenin-labeled single-stranded DNA molecule will detach due to helicogenic reaction. Then, alkaline phosphatase-labeled anti-digoxigenin secondary antibody and alkaline phosphatase substrate CSPD are added to the 96-well plate sequentially, and the light signal intensity generated in each well is analyzed to identify the helicase activity. Generally, the greater the decrease in chemiluminescence signal intensity, the stronger the helicase activity. Following this method, the helicase activity of the DDX54 fusion protein was measured as follows: Helicase activity assays were performed using white 96-well plates. The following example, used to detect DDX54 truncated protein, was performed in six replicates. 12 mL of Na₂CO₃ was mixed with 185 μL of 1 mg / mL neutral avidin (Thermo Fisher Scientific-CN, Thermo Scientific™ NeutrAvidin protein, 31000). The 1 mg / mL avidin was diluted to a final concentration of 15 μg / mL, and 100 μL was plated per well. The plates were sealed with sealing film and stored overnight at 4°C. The next day, the plates were washed three times with 200 μL / well of 10 mM PBS, patted dry, and air-dried for 15 min. Weigh 0.04 g BSA and dissolve it in 40 mL of 10 mM PBS to prepare 1 mg / mL BSA (bovine serum albumin) as blocking solution. Add 100 μL / well and block at room temperature for 1 h. Wash the plate 3 times with 200 μL / well of 10 mM PBS, pat dry and air dry for 15 min.Add 14 μL of 2.5 ng / μL oligo-DNA (prepared as DNA substrate in Example 4) to 1 mL of 1 M PBS and NaCl to prepare 2.5 ng of DNA substrate per well. Add 75 μL / well and incubate at room temperature for 2 h. Wash twice with 200 μL / well of 10 mM PBS and once with 200 μL / well of 50 mM Tris-HCl-NaCl. Prepare a reaction solution with 1200 μL of 25 mM MOPS (3-morpholinopropanesulfonic acid), 600 μL of 5 mM ATP, 24 μL of 2 mM DTT (DL-dithiothreitol), 120 μL of 3 mM MnCl2, and 120 μL of 100 μg / mL BSA. Add 95 μL to each well and add 4 μL / well of DDX54 fusion protein. Incubate at 37°C for 1 h. Wash twice with NaCl, pat dry, and air dry for 15 min. Add 3 mL of 0.1 M maleic acid (pH 7.5) and 0.15 M NaCl to 9 μL of Tween-20 to prepare washing buffer (200 μL / well). Let stand for 5 min. Weigh 400 mg of BSA and dissolve it in 4 mL of 0.1 M maleic acid (pH 7.5) and 0.15 M NaCl to prepare blocking buffer (300 μL / well). Block for 30 min. Add 1 μL of anti-DIG antibody (Beckman Coulter Life Sciences (Shanghai) Co., Ltd., Ms mAb to Digoxigenin [21H8] (AP), ab119345) (20 μL / well) to 5 mL of blocking buffer and incubate at room temperature for 30 min. After recovering the antibody, wash twice with 100 μL / well of 0.1 mM Tris-NaCl (pH 9.5). Add 2 mL of 0.1 mM Tris-NaCl (pH 9.5) to 9 μL / well. Add 20 μL of CSPD (Thermo Fisher Scientific -CN, CSPD™ substrate (0.25 mM ready-to-use), T2141) to mM Tris-NaCl, mix well, add 20 μL of colorimetric reagent to each well, let stand for 5 min, and use a multi-plate reader to read the RLU (relative light unit) value of each well at a time of 10 s / well to determine enzyme activity.

[0054] Experimental results show that DDX54 exhibits significant helicase activity; specific data can be found in [link to data]. Figure 7 .Depend on Figure 7 It can be seen that the luminescence signal of the experimental group with DDX54 is significantly lower than that of the control group (without enzyme), and the difference in readings is obvious. It can be determined that DDX54 protein catalyzes a large amount of oligo-DNA helicase reaction, proving that DDX54 has obvious helicase activity.

[0055] Referring to Table 8, the raw data of helicase activity were compared with the average light signal of the control group and the truncated DDX54 protein group in the raw data. It can be seen that the truncated DDX54 has helicase activity. The inter-sample p value is much less than 0.0001, and the difference between the two groups is obvious. The truncated DDX54 has obvious helicase activity. The Z factor is 0.41, which indicates that the signal of the truncated DDX54 group is clearly distinguishable from the background. The data is reliable and reproducible. It can be further optimized for high-throughput screening and research of DDX54 inhibitors.

[0056] Table 8: Helicase Activity Data

Claims

1. A DDX54 fusion protein, characterized in that, The amino acid sequence of the DDX54 fusion protein is shown in SEQ ID NO:

1.

2. The DDX54 fusion protein according to claim 1, characterized in that, The N-terminus of the DDX54 fusion protein carries a SUMO tag, a post-translational modification protein with a structure similar to ubiquitin.

3. Nucleic acid, characterized in that, The nucleic acid encodes the DDX54 fusion protein of claim 1.

4. The nucleic acid according to claim 3, characterized in that, The nucleotide sequence of the nucleic acid is shown in SEQ ID NO:

2.

5. An expression vector, characterized in that, The expression vector contains the nucleic acid encoding the nucleic acid of claim 3, and preferably the expression vector is a prokaryotic expression vector, such as pET28a.

6. A bacterial strain, characterized in that, The strain contains the expression vector according to claim 5, preferably the strain is... E. coli Strains, such as DH5α, Rossette2 (DE3), BL21 (DE3), or BL21 pLysS.

7. A method for preparing the DDX54 fusion protein, characterized in that, The method includes the following steps: 1) Amplify the nucleic acid sequence encoding the DDX54 fusion protein; 2) The nucleic acid sequence is cloned into a prokaryotic expression vector; 3) Transform the prokaryotic expression vector into... E. coli In the strains; 4) Inducing the expression of the DDX54 fusion protein, and 5) Purify the DDX54 fusion protein. The preferred prokaryotic expression vector is pET28a. And among them, the preferred one is the one described above. E. coli The strains were Rossette DH5α, BL21 (DE3), or BL21 pLysS.

8. The use of the DDX54 fusion protein according to claim 1 in the following: 1) Preparation of formulations that untangle the double-stranded structure of oligonucleotides; 2) RNA modification and processing, preferably mRNA precursor splicing; or 3) High-throughput screening of DDX54 helicase or ATP hydrolase activity inhibitors.