Protein interaction screening system based on bacterial two-hybrid technology and high-throughput protein interaction screening method and application thereof

Abstract

The invention relates to a protein interaction screening system based on a bacterial two-hybrid technology, which comprises a bait protein and prey protein co-expression plasmid pCDFduet1-lambda cI-RNAP, the sequence of which is as shown in SEQ ID No. 1; a reporter plasmid is pACYC184-cIamp; the sequence of the lac promoter-GFP is as shown in SEQ ID No. 2, and the lac promoter-GFP is as shown in SEQ ID No. 2; the positive control plasmid is a pCDFduet1-lambda cI-LG2-RNAP-Gal11p plasmid, and the sequence of the positive control plasmid is as shown in SEQ ID No. 3; the invention further relates to a high-throughput protein interaction screening method of mycobacterium tuberculosis toxin-antitoxin and application of the protein interaction screening system. The protein interaction screening system can realize high-throughput, high-sensitivity and semi-quantitative many-to-many protein interaction analysis by utilizing a flow cytometry sorting technology and three-generation sequencing analysis, effectively solves the problem of false negative caused by non-uniform conversion efficiency of a traditional double-plasmid system, remarkably improves the practicability of high-throughput screening, and has a good application prospect. The large-scale screening bottleneck is broken through, and wide application prospects are achieved.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to the field of protein interaction screening technology, specifically to a protein interaction screening system based on bacterial two-hybrid technology, its high-throughput protein interaction screening method, and its application. Background Technology

[0002] In living organisms, protein-protein interactions (PPIs) are the primary executors of cellular functions. DNA replication and transcription, protein translation and post-translational modifications, cellular signal transduction, metabolic regulation, macromolecule assembly, and the development of diseases all rely on PPIs. PPIs ensure the completion of various complex life activities primarily due to their broad-spectrum binding strength, wide range of binding intensities, and dynamic, multi-layered network topology. Currently, in the field of anti-infectives, more than 75% of antibacterial drugs target a single protein, leading to increased drug resistance rates, while over 80% of tumor-targeting drugs fail due to compensatory PPI networks. The development of novel targeted drugs based on protein-protein interactions is playing an increasingly important role in anti-tumor, anti-infective, and neurodegenerative disease treatments. Therefore, discovering new protein-protein interactions in cells and elucidating their mechanisms of action is of great significance for revealing the essence of life activities, elucidating the mechanisms of disease development, discovering new drug targets, and developing corresponding drugs to overcome drug resistance.

[0003] Methods for studying protein-protein interactions (PPIs) are mainly divided into two categories: in vivo and in vitro, each with its own characteristics and advantages. In vivo methods (such as bacterial two-hybrid, yeast two-hybrid, fluorescence resonance energy transfer (FRET / BiFC), affinity purification-mass spectrometry (AP-MS), and proximity labeling techniques (BioID / TurboID) are performed in living cells or biological environments. Their greatest advantage lies in reflecting interactions under physiological conditions, including post-translational modifications, subcellular localization, and dynamic changes, making them particularly suitable for discovering new interaction partners and capturing weak / transient interactions (proximity labeling). However, their disadvantages include complex background, the risk of false positives and false negatives, potential interference with normal cellular physiology during manipulation, and difficulty in accurately quantifying kinetic parameters or identifying direct interaction sites. In vitro methods (such as surface plasmon resonance (SPR), isothermal titration calorimetry (ITC), microthermophoresis-mass spectrometry (MST), and pull-down) use purified proteins analyzed in a controlled environment, providing precise quantitative data (such as binding affinity KD, kinetic rates Kon / Koff, and thermodynamic parameters), clearly validating direct interactions, with relatively less background interference and higher sensitivity. However, since in vitro detection methods are separated from the cellular environment, they may lose important regulatory factors or modifications, and cannot reflect the true interaction state under physiological conditions. They also have high requirements for protein purity and stability, and low screening throughput, making them unsuitable for large-scale initial screening of protein interactions. Instead, they are suitable for subsequent validation after screening.

[0004] Bacterial two-hybrid (B2H) systems, as a type of in vivo protein interaction screening method (similar to yeast two-hybrid), are a powerful tool for detecting protein-protein interactions in Escherichia coli. They can efficiently utilize the physiological environment of live bacterial cells for interaction screening, have a short research cycle, are simple to operate, and can reflect the interaction state of proteins in a near-native cellular environment (such as folding, subcellular localization, and partial modification). Although there are many methods for studying protein-protein interactions, bacterial two-hybrid systems still have significant practical value, especially in studying prokaryotic protein interactions and large-scale screening of protein interactions.

[0005] The core principle of the bacterial two-hybrid system is to reconstruct a functional transcription activator, thereby activating the expression of the reporter gene. This transcription activator can only be reconstructed when two target proteins interact. Currently, classic bacterial two-hybrid systems based on transcription activation are mainly divided into the following two categories: (1) BACTH (Bacterial Adenylate Cyclase Two-Hybrid); (2) BacterioMatch™ (Agilent). The BACTH system utilizes the modularity of adenylate cyclase (AC) to fuse the protein under study with the T25 and T18 fragments of AC for expression. When the two target proteins interact, the T25 and T18 fragments recombine to form an active AC, thereby catalyzing the production of cAMP from ATP, which in turn activates the expression of the downstream reporter gene. The reporter gene in the BACTH system is generally β-galactosidase (lacZ), and screening is generally performed by a colorimetric reaction. The BacterioMatch system uses the λ phage repressor protein cI to bind to the "bait" protein, while the target protein is attached to the N-terminus of the α subunit of RNA polymerase. When the target and "bait" proteins bind, they recruit and stabilize RNA polymerase in the promoter region, thereby activating the transcription of the first reporter gene HIS3 (involved in histidine synthesis) and the second reporter gene aadA (encoding streptomycin resistance). Because the BacterioMatch system has two reporter genes, it exhibits a lower false positive rate.

[0006] While bacterial two-hybrid systems offer numerous advantages, they also have inherent limitations, restricting their scope and application scenarios. Although in principle, bacterial two-hybrid systems can be used to screen for many-to-many protein interactions, their application is typically limited to verifying or screening the interaction between a pair of "bait" proteins and a library of prey proteins, or verifying known protein pairs. This is primarily because bacterial two-hybrid systems rely on the interaction of two fusion proteins (Bait-DBD + Prey-AD) to activate reporter genes (such as lacZ, antibiotic resistance genes). If multiple baits and multiple prey proteins are co-expressed in the same bacterium, it becomes impossible to distinguish which protein pair's interaction caused the signal when the reporter gene is activated. Furthermore, traditional bacterial two-hybrid systems require co-transformation of two plasmids, one expressing the bait protein and the other the prey protein. Many-to-many screening requires the simultaneous expression of dozens or hundreds of proteins. If separate vectors are constructed for each "bait" and "prey" protein, the number of plasmid types increases exponentially (e.g., 10 Bait × 100 Prey = ...). With 1000 possible combinations, it's impossible to guarantee that all "bait" and "prey" plasmids are co-transformed into a single bacterium with equal efficiency. The "bait" and "prey" proteins cannot be effectively co-expressed in the same cell, making it impossible to test all possible "bait"-"prey" protein combinations, leading to false negatives and low screening efficiency. In "one-to-many" screening, when one Bait is compared to a Prey library, a positive clone can be identified by sequencing to determine the Prey binding identity. However, in a system of multiple Bait mixtures + multiple Prey mixtures, the positive signal... It cannot be directly linked to specific interaction pairs, requiring additional cumbersome deconvolution steps (such as isolating single clones and then verifying), thus losing its high-throughput significance; moreover, the traditional bacterial two-hybrid reporter system is located on the F' episome of the reporter strain, and the F' episome exists in the reporter strain in the form of a single copy, which leads to insufficient sensitivity of the reporter system; the reporter system generally relies on plate colorimetric reaction or the presence or absence of colony growth to determine positive interactions, which can only perform qualitative analysis and cannot perform quantitative analysis, and subsequent analysis of positive interactions requires picking single clones for analysis one by one, which is also inefficient.

[0007] Therefore, there is an urgent need for an optimized bacterial two-hybrid system that offers high screening efficiency, convenient high-throughput screening operation, high sensitivity, and the ability to quantify interacting proteins. Summary of the Invention

[0008] To overcome at least one deficiency in the existing technology, this invention develops an optimized bacterial two-hybrid system based on the principle of bacterial two-hybrid technology. It constructs a co-expression plasmid of "bait" protein and "prey" protein, as well as a bacterial two-hybrid reporter plasmid. It can be analyzed using flow cytometry and third-generation sequencing technology to achieve high-throughput, high-sensitivity, and semi-quantitative many-to-many protein interaction analysis, thus solving the bottleneck problem of existing bacterial two-hybrid systems.

[0009] The optimized bacterial two-hybrid system developed in this invention ensures efficient and equal co-expression of bait-prey gene pairs in single cells, thus solving the false negative problem caused by uneven transformation efficiency in traditional dual-plasmid systems. It establishes a high-throughput parallel detection capability for multiple protein-protein interactions, enabling simultaneous screening of large-scale protein interaction matrices (N×M) and saving screening time. Furthermore, it enables precise tracing of complex interaction signals, clearly identifying the association between positive signals and specific interaction pairs. It also provides quantitative / semi-quantitative analysis of interaction intensity, offering significant advantages over traditional qualitative detection, allowing for quantitative / semi-quantitative analysis based on the output results.

[0010] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention is to provide a bacterial two-hybrid protein interaction screening system comprising a co-expression plasmid of a bait protein and a prey protein, wherein the co-expression plasmid is a pCDFduet1-λcI-RNAP plasmid, the sequence of which is shown in SEQ ID No. 1.

[0011] Furthermore, the preparation steps of the pCDFduet1-λcI-RNAP plasmid include: S11. PCR amplification of the λcI gene yielded the λcI fragment; the pCDFduet1 vector was digested with the λcI fragment using enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI plasmid. S12. PCR amplification of the RNAP gene to obtain the RNAP fragment; pCDFduet1-(MCS1)-λcI plasmid and RNAP fragment were digested with enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP plasmid.

[0012] Further, in step S11, the PCR amplification of the λcI gene uses the bacterial two-hybrid system plasmid pBT as a template, and its primer sequences are shown in SEQ ID No. 5 ~ SEQ ID No. 6. The PCR reaction system is as follows: 50 μL of 2×pfu mix, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 1-2 μL of template DNA (≥ 200 ng), and enzyme-free pure water to a final volume of 100 μL. The PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min, for a total of 34 cycles; 72℃ final extension for 5 min; and incubation at 12℃.

[0013] Understandably, the sequence and position of the restriction sites in the above primers can be adaptively adjusted according to the specific type of restriction endonuclease used. The restriction endonucleases involved include: BamH Ⅰ, Hind Ⅲ, Bgl Ⅱ, Xho Ⅰ, Sal Ⅰ, Pst Ⅰ, Not Ⅰ, Nde Ⅰ, Nco Ⅰ, Bgl Ⅱ, etc.

[0014] Further, in step S11, the enzyme digestion conditions for the pCDFduet1 vector are as follows: take 5 μg of pCDFduet1 plasmid, add 10 μL of 10×QuickCut Green Buffer, 5 μL of NcoI, 5 μL of BamHI, and enzyme-free pure water to make up to 100 μL, and digest in a water bath at 37℃ for 1 h to obtain the linearized pCDFduet1 vector.

[0015] Further, in step S11, the enzyme digestion conditions for the λcI fragment are as follows: take 5 μg of the recovered λcI fragment, add 5 μL of NcoI, 5 μL of BamHI, and 10 μL of 10×QuickCut Green Buffer, and digest at 37℃ for 1 h.

[0016] Further, in step S11, the ligation system of the enzyme digestion product is as follows: 50 ng of linearized pCDFduet1 vector, 50 ng of NcoI / BamHI digested λcI fragment, with a vector to fragment molar ratio of less than or equal to 1:3; 1 μL of T4 DNA ligase, 2 μL of 10×T4 DNA Ligase Buffer, and enzyme-free pure water to a final volume of 20 μL; ligation is performed overnight (12-16 h) in a metal bath at 16℃.

[0017] Further, in step S11, the transformation system for the ligation product is as follows: add the ligation product to competent cells and incubate on ice for 30 min; heat shock at 42℃ for 90 s, then immediately incubate on ice for 2 min; add antibiotic-free LB liquid medium and culture at 37℃ and 220 rpm for 1 h with shaking; spread the bacterial culture onto LB solid medium containing streptomycin and incubate upside down at 37℃ for 12-16 h to obtain transformant colonies.

[0018] Furthermore, in step S12, the PCR amplification of the RNAP gene uses pTRG plasmid as a template, and its primer sequences are shown in SEQ ID No. 7 ~ SEQ ID No. 8. The PCR reaction system and reaction conditions are the same as in step S11, but the restriction endonuclease used is different.

[0019] Furthermore, in step S12, the enzyme digestion steps are the same as those for the pCDFduet1 vector in step S11, but the restriction endonuclease used is different.

[0020] Furthermore, in step S12, the ligation and transformation steps of the enzyme digestion product are the same as in step S11.

[0021] Furthermore, the above steps also include the verification and purification of each amplification product and the identification of each plasmid.

[0022] Furthermore, the protein interaction screening system also includes a bacterial two-hybrid reporter plasmid, the reporter plasmid being pACYC184-cI&lac promoter-GFP plasmid, the sequence of which is shown in SEQ ID No. 2.

[0023] Further, the preparation steps of the pACYC184-cI&lac promoter-GFP plasmid include: S21. Amplify the GFP gene by PCR using primers containing cI & lac promoters to obtain the GFP fragment; perform enzyme digestion on the GFP fragment to obtain the GFP digestion product: The S22 and pACYC184 plasmids were digested with enzymes to obtain the pACYC184 backbone. S23. The GFP enzyme digestion product is ligated to the pACYC184 backbone and transformed to construct the pACYC184-cI&lacpromoter-GFP plasmid.

[0024] Furthermore, in step S21, the PCR amplification of the GFP gene uses the GFP sequence as a template, as shown in SEQ ID No. 4, and its PCR reaction system and reaction conditions are the same as in step S11.

[0025] Further, in step S21, the primer sequence containing the cI & lac promoter is shown in SEQ ID No. 9 ~ SEQ ID No. 10.

[0026] Further, in step S21, the amplified product is recovered from the gel and digested with XbaI / BamHI at 37℃ for 1 h.

[0027] Further, in step S22, the pACYC184 plasmid was digested with XbaI / BamHI for 1 h, and the vector backbone was recovered by gel extraction.

[0028] Further, in step S23, the ligation and transformation step is as follows: the enzyme-digested GFP fragment and the pACYC184 backbone are ligated overnight at 16°C using T4 DNA ligase, transformed into competent cells, and plated on LB plates containing chloramphenicol.

[0029] Furthermore, the above steps also include the verification and purification of each amplification product and the identification of each plasmid.

[0030] Furthermore, the protein interaction screening system also includes a positive control plasmid, which is pCDFduet1-λcI-LG2-RNAP-Gal11p plasmid, the sequence of which is shown in SEQ ID No. 3.

[0031] Furthermore, the preparation steps of the pCDFduet1-λcI-LG2-RNAP-Gal11p plasmid include: S31. PCR amplification of the λcI-LG2 fusion gene yielded the λcI-LG2 fragment; the pCDFduet1 vector was digested with the λcI-LG2 fragment using enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI-LG2 plasmid. S32. The RNAP-Gal11p fusion gene was amplified by PCR to obtain the RNAP-Gal11p fragment; the pCDFduet1-(MCS1)-λcI-LG2 plasmid and the RNAP-Gal11p fragment were digested with enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p plasmid.

[0032] Furthermore, in step S31, the PCR amplification of the λcI-LG2 fusion gene uses the pBT-cI-LG2 plasmid as a template, and its primer sequences are shown in SEQ ID No. 11 ~ SEQ ID No. 12. The PCR reaction system and reaction conditions are the same as in step S11.

[0033] Furthermore, in step S31, the enzyme digestion conditions for the λcI-LG2 fusion gene and the pCDFduet1 vector are the same as in step S11.

[0034] Furthermore, in step S31, the connection reaction and conversion conditions are the same as in step S11.

[0035] Further, in step S32, the PCR amplification of the RNAP-Gal11p fusion gene uses plasmid pTRG-RNAP-GAL11p as a template, and its primer sequences are shown in SEQ ID No. 13 ~ SEQ ID No. 14. The PCR reaction system and reaction conditions are the same as in step S12.

[0036] Furthermore, in step S32, the restriction enzyme digestion conditions for the pCDFduet1-(MCS1)-λcI-LG2 plasmid and the RNAP-Gal11p fragment are the same as in step S12.

[0037] Furthermore, in step S32, the connection reaction and transformation conditions are the same as in step S12.

[0038] Furthermore, the above steps also include the verification and purification of each amplification product and the identification of each plasmid.

[0039] A second aspect of the present invention is to provide a method for constructing a Mycobacterium tuberculosis toxin-antitoxin co-expression plasmid library, comprising the steps of: a) PCR amplification of antitoxin and toxin to obtain antitoxin fragments and toxin fragments; b) Construction of antitoxin plasmid library: The pCDFduet1-λcI-RNAP co-expression plasmid described in any of the first aspects of the present invention is digested with enzymes and homologously recombined with each antitoxin fragment. The recombinant products are transformed to obtain plasmids that express antitoxin alone. The plasmids that express antitoxin alone are mixed to obtain antitoxin plasmid library. c) Construction of toxin-antitoxin co-expression plasmid library: Using the antitoxin plasmid library as a template, a linearized vector was obtained by reverse PCR, and homologous recombination was performed with each toxin fragment. The recombination product was transformed and cultured to obtain the toxin-antitoxin co-expression plasmid library.

[0040] Further, in step a), primers are designed based on the DNA sequences of the antitoxin and the toxin. The primer design principle is as follows: homologous sequences from both ends of the linearized vector are introduced into the 5' end of the forward and reverse amplification primers of the insert fragment, so that the 5' and 3' ends of the amplified insert fragment have homologous sequences (15-20 bp, excluding restriction enzyme sites) that correspond to the ends of the linearized cloning vector.

[0041] Furthermore, in step a), the antitoxin fragment and the toxin fragment are amplified using the MTB H37Rv genome as a template, wherein there are 77 antitoxin fragments and 77 toxin fragments. It is understood that the number of antitoxin fragments and toxin fragments can be adjusted according to actual detection needs.

[0042] Furthermore, the primers for the antitoxin are designed as follows: Primer F: 5'-AGAGACGTTTGGCca + GGATCC (BamHI restriction site) + g + gene-specific forward amplification primer sequence - 3'; Primer R: 5'-CGACTTAAGCATTAT + GCGGCCGC (NotI restriction site) + gene-specific reverse amplification primer sequence - 3'.

[0043] Furthermore, the primers for the toxin are designed as follows: Primer F: 5'-AGAGAAACCAGAGct + AGATCT (BglII restriction site) + gene-specific forward amplification primer sequence - 3' Primer R: 5'-TGGCCGGCCGATATC + CAATTg (MfeI restriction site) + gene-specific reverse amplification primer sequence - 3'.

[0044] Further, the specific operations in step b) include: digesting the pCDFduet1-λcI-RNAP plasmid with BamHI / NotI enzyme, performing homologous recombination with each antitoxin fragment, transforming competent cells, and screening to obtain plasmids that express antitoxin alone; mixing them in equimolar amounts to construct an antitoxin plasmid library (concentration 500 ng / μL).

[0045] Further, the specific operations in step c) include: using the antitoxin plasmid library as a template, obtaining a linearized vector through reverse PCR; performing homologous recombination with a mixture of various toxin fragments (equimolar amounts), transforming competent cells with the recombination product, adding SOC medium, and resuscitating at 37℃ and 220 rpm; spreading the bacterial culture on streptomycin plates (for counting), and culturing at 37℃; counting shows that the number of clones is ≥ twice the theoretical size (77×77=5929), meeting the requirements for library construction; scraping off the clones from the plate, extracting the plasmid, and obtaining a toxin-antitoxin co-expression plasmid library (TA library plasmid).

[0046] Furthermore, the primer sequences for the reverse PCR amplification are shown in SEQ ID No. 15 ~ SEQ ID No. 16.

[0047] Furthermore, after constructing the toxin-antitoxin co-expression plasmid library, the procedure also includes sequencing to check the library integrity: the toxin-antitoxin co-expression plasmid library is amplified by PCR using primer sequences shown in SEQ ID No. 17 ~ SEQ ID No. 18 and then sent for third-generation sequencing; the sequencing data is then compared with a reference sequence of 77 AT and 77 T.

[0048] Furthermore, in the construction of the co-expression plasmid, dual reporter plasmid, positive plasmid, and toxin-antitoxin co-expression plasmid libraries, the competent cells used were all DH5α competent cells.

[0049] A third aspect of the present invention is to provide a high-throughput protein interaction screening method for Mycobacterium tuberculosis toxin-antitoxin, comprising the steps of: A) Obtain a plasmid library of tuberculosis mycotoxin-antitoxin co-expression plasmids using any of the construction methods described in the second aspect of the present invention; B) Transform competent cells into any of the pACYC184-cI&lac promoter-GFP reporter plasmids described in the first aspect of the present invention and culture them to prepare competent cells containing the pACYC184-cI&lac promoter-GFP reporter plasmid; transform the toxin-antitoxin co-expression plasmid library into competent cells containing the pACYC184-cI&lac promoter-GFP reporter plasmid, add an inducer and culture them, and at the same time set up the positive control plasmid pCDFduet1-λcI-LG2-RNAP-Gal11p described in any of the first aspect of the present invention as a positive control group; C) Perform flow cytometry sorting on the clones obtained after culturing in step B), using the positive control group as the screening criterion to separate the FITC positive and negative populations; D) Extract plasmids from each population, amplify them by PCR, and sequence the amplification products to screen out effective interacting proteins.

[0050] Furthermore, in step B), the competent cells used are BL21(DE3) competent cells, and the inducer is isopropyl-β-D-thiogalactoside (IPTG).

[0051] Further, the specific operations in step B) include: transforming the pACYC184-cI&lac promoter-GFP reporter plasmid into competent cells, selecting single clones and inoculating them into LB medium, and culturing overnight at 37°C and 250 rpm; transferring the plasmid to LB medium at a 1:100 ratio and culturing until OD200. 600=0.4, ice bath, centrifugation, washing with pre-cooled ultrapure water, and finally resuspending with pre-cooled 10% glycerol, aliquoting, and storing at -80℃; take competent cells, add TA library (toxin-antitoxin co-expression plasmid library) plasmid, and simultaneously set up positive control plasmid pCDFduet1-λcI-LG2-RNAP-Gal11p, and ice bath simultaneously; add to electroporation cuvette, electroporate at 1800V, and immediately add LB medium (containing inducer IPTG, final concentration 0.25 mM), and revive at 37℃ and 180 rpm; take the revived bacterial solution, spread it on double antibody plates, and incubate at 37℃.

[0052] Further, in step C), the FITC-positive group is defined as having a fluorescence intensity in the top 5%, and the FITC-negative group is defined as having a fluorescence intensity below 100.

[0053] Further, the specific operations in step C) include: scraping plate clones with PBS, washing with PBS and resuspending; using a flow cytometer, adjusting the flow rate to 3000 evt / s, removing impurities based on FSC / SSC, and using the positive control group as the screening criterion, sorting out 1×10⁻⁶ FITC-positive population (P4 gate) and negative population (P5 gate) of the TA library (toxin-antitoxin co-expression plasmid library) group. 6 Each cell.

[0054] Further, in step D), the interaction degree FC of each toxin-antitoxin pair is defined as the frequency of occurrence of the interaction in the positive population / the frequency of occurrence in the negative population; wherein, when FC > 1.5, the toxin-antitoxin pair is determined to be an effective interaction.

[0055] Furthermore, in step D), the sequencing is third-generation sequencing. It is understood that other suitable sequencing methods in the art may also be used.

[0056] Furthermore, in step D), 1243 pairs of valid interactions were selected; among them, toxin Rv2801c has cross-interactions with 67 ATs, which are the core interaction nodes.

[0057] A fourth aspect of the invention is to provide an application of the protein interaction screening system described in any of the first aspects of the invention, selected from at least one of the following applications: application in constructing an interaction protein library, application in screening interaction proteins in pathogenic microorganisms or eukaryotes, application in screening antimicrobial drugs that target protein interactions, and application in formulations for determining pathogenicity and drug resistance mechanisms of pathogens.

[0058] Furthermore, the pathogenic microorganisms include Mycobacterium tuberculosis, Escherichia coli, Staphylococcus aureus, etc.

[0059] Furthermore, the eukaryotes include yeast, mammals, etc.

[0060] Furthermore, the interacting proteins include Mycobacterium tuberculosis toxin-antitoxin interacting proteins.

[0061] Furthermore, the antimicrobial agents targeting the interacting proteins include antimicrobial agents targeting the interaction between Mycobacterium tuberculosis toxin and antitoxin.

[0062] Furthermore, the Mycobacterium tuberculosis TA system may form complex functional modules through cross-regulation, providing insights into the pathogenicity and drug resistance mechanisms of pathogens.

[0063] Compared with the prior art, the present invention, by adopting the above technical solution, has the following beneficial effects: (1) This invention achieves a 77×77 scale TA system (Mycobacterium tuberculosis) through an integrated "bait-prey" co-expression plasmid and library construction method. Mycobacterium tuberculosis (1) The Toxin-Antitoxin Systems (TA systems) full matrix screening reduces the number of plasmid combinations from 5929 to 1, improving operational efficiency by ≥500 times; combined with the signal tracing mechanism of third-generation sequencing, no deconvolution experiment is required, and the tracing time is shortened to 24 h, significantly improving the practicality of high-throughput screening and breaking through the bottleneck of large-scale screening; (2) This invention quantifies the interaction strength through FC value, providing a quantitative basis for the priority ranking of protein interactions, improving detection sensitivity and quantitative ability, and assisting in the screening of high-value drug targets; (3) The integrated co-expression plasmid of this invention can reduce the expression level of toxic proteins by regulating the promoter strength (T7 promoter), successfully constructing a stable screening system of Mycobacterium tuberculosis toxin-antitoxin, solving the problem that traditional systems cannot study toxic protein interactions, and expanding its applicable scope; (4) This invention is the first systematic The cross-interaction network of the Mycobacterium tuberculosis type II TA system was analyzed, and the broad-spectrum cross-interaction characteristics of toxin Rv2801c were discovered. This provides new data support for the study of the mechanism by which the TA system participates in the regulation of bacterial stress tolerance and drug resistance, and reveals a new biological mechanism. (5) The plasmid system and screening process of this invention can be directly applied to the study of protein interactions of other pathogenic microorganisms (such as Escherichia coli and Staphylococcus aureus) or eukaryotes (such as yeast and mammals), and can also be used for drug screening (such as antibacterial drugs that target TA interactions). It has a wide range of application scenarios and industrialization value. Attached Figure Description

[0064] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are for illustrative purposes only, and do not constitute an undue limitation of the invention. In the drawings: Figure 1This is a circular map of the "bait-prey" co-expression plasmid pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP plasmid in one embodiment of the present invention; Figure 2 This is a circular pattern of the pACYC184-cI&lac promoter-GFP reporter plasmid in one embodiment of the present invention; Figure 3 This is the circular pattern of the pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p positive control plasmid in the embodiments of the present invention; Figure 4 This is a double-enzyme digestion verification diagram of the "bait-prey" co-expression plasmid pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP (full length 5209 bp, sequence number SEQ ID No. 1) reporter plasmid in one embodiment of the present invention. Lane 1: negative control group (no band); Lane 2: double-digested reporter plasmid (5.2 kb vector backbone + 711 bp λcI fragment); Lanes 3 and 4: double-digested reporter plasmid (5.2 kb vector backbone + 744 bp RNAP fragment); M: 5 kb DNA Ladder.

[0065] Figure 5 This is a verification diagram of double enzyme digestion of the pACYC184-cI&lac promoter-GFP reporter plasmid in one embodiment of the present invention. Lanes 2, 4, 6, 8, 10: undigested reporter plasmid (4643 bp); Lanes 3, 5, 7, 9, 11: double-digested reporter plasmid (3.8 kb vector backbone + 843 bp GFP fragment); M: 5 kb DNA Ladder.

[0066] Figure 6 This is an electrophoresis diagram of the PCR product of the λcI-LG2 and RNAP-Gal11p fusion gene in one embodiment of the present invention; wherein, lane 1: λcI-LG2 fragment (864 bp); lane 3: RNAP-Gal11p fragment (1069 bp); lane 2: 100 bp DNA Ladder (purchased from Takara).

[0067] Figure 7 This is the colony PCR verification result of the pCDFduet1-(MCS1)-λcI-LG2 recombinant plasmid in one embodiment of the present invention; wherein, lanes 1-10: 10 randomly selected single colonies; lane 2: no target fragment amplified (negative); the remaining lanes: amplified 864 bp λcI-LG2 fragment (positive); M: 100 bp DNA Ladder.

[0068] Figure 8 This is a schematic diagram of the colony PCR verification results of the pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p recombinant plasmid in one embodiment of the present invention; wherein, lanes 1-10: 10 randomly selected single colonies; lanes 2 and 5: simultaneously amplified a 1069 bp fragment (positive); the remaining lanes: no target fragment amplified (negative); M: 100 bp DNA Ladder.

[0069] Figure 9 This is a flow cytometry chromatogram of negative / positive controls in one embodiment of the present invention; wherein, top row: negative control (λcI-RNAP), FITC positivity rate 0.56%; bottom row: positive control (λcI-LG2-RNAP-Gal11p), FITC positivity rate 80.99%.

[0070] Figure 10 This is a flow cytometry diagram of the TA system (Mycobacterium tuberculosis toxin-antitoxin) interaction in one embodiment of the present invention; wherein, the top row: TA pairs with interaction (positive rate 78.68%-99.07%); the bottom row: TA pairs without interaction (positive rate 0.52%-3.90%).

[0071] Figure 11 This is a plate image of a 77×77 TA library transformed into DH5α in one embodiment of the present invention; the left side shows the result of a 1:100 dilution, and the right side shows the result of a 200 μL bacterial suspension plating.

[0072] Figure 12 This is a 77×77 TA integrity analysis diagram in one embodiment of the present invention; wherein, the left figure shows the abundance distribution of the 77×77 TA combination; the middle figure shows the coverage matrix of the 77×77 TA combination (white represents coverage, red represents missing); and the right figure shows the abundance distribution of AT and T.

[0073] Figure 13 This is a flow cytometry sorting diagram of high-throughput screening of 77×77 TA interaction pairs in one embodiment of the present invention; wherein, P4 gate: FITC positive population (high fluorescence intensity); P5 gate: FITC negative population (low fluorescence intensity).

[0074] Figure 14 This is a 77×77 TA interaction network diagram in one embodiment of the present invention; wherein, the left figure is a Circos diagram (the lines represent interactions, and the line width represents the FC value); the right figure is a heat map (the darker the red, the larger the FC value).

[0075] Figure 15This is an SPR sensing image of the interaction pair in one embodiment of the present invention; wherein, left image: Rv2801c-Rv2274A; right image: Rv2801c-Rv2801A.

[0076] Figure 16 This is a Co-IP verification diagram of the interaction pairs in one embodiment of the present invention; wherein, lanes 1 & 2: Input (total protein); lane 3: IP-Strep (Rv2801c) + Flag-Rv2801A (positive); lane 4: IP-Strep (Rv2801c) + Flag-Rv0456B (negative). Detailed Implementation

[0077] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0078] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0079] The pCDFduet1-λcI-RNAP co-expression plasmid, pACYC184-cI&lacpromoter-GFP reporter plasmid, pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p positive control plasmid, and GFP gene sequences involved in the following examples are shown in the table below: pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP co-expression plasmid (full length 5209bp) (as shown in SEQ ID No. 1): pACYC184-cI&lac promoter-gfp reporter plasmid (full length 4643bp) (as shown in SEQ ID No. 2): pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p positive control plasmid (full length 5640bp) (as shown in SEQ ID No. 3): GFP sequence (full length 717 bp) (as shown in SEQ ID No. 4): ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACT TGTCACTACTTTCGGGTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTG TTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCA GACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA The technical solution of the present invention will be illustrated by way of example in the following embodiments.

[0080] Example 1 - Construction of the co-expression plasmid pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP for "bait" and "prey" proteins This embodiment presents a preferred method for constructing the pCDFduet1-λcI-RNAP co-expression plasmid, which specifically includes the following steps: 1. Construction of the intermediate plasmid pCDFduet1-(MCS1)-λcI; (1) PCR amplification of the λcI gene; Using the bacterial two-hybrid system plasmid pBT (Agilent Technologies, catalog number 240065) as a template, PCR amplification was performed using the following primers: PCDFduetMCS1-λcI-NcoI-F:5'-CATG ccatgg GCATGAGCACAAAAAAGAAACC-3' (SEQ ID No. 5), the underlined part is the NcoI restriction site; PCDFduetMCS1-λcI-BamHI-R:5'-GCG ggatcc TGGCCAAACGTCTCTTCAGGC-3' (SEQ ID No. 6), the underlined part is the BamHI restriction site; PCR reaction system (100 μL): 50 μL of 2×pfu mix, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 1-2 μL of template DNA (≥200 ng), and enzyme-free pure water to a final volume of 100 μL; PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 34 cycles; 72℃ final extension for 5 min; 12℃ incubation.

[0081] Five μL of PCR product was subjected to 1% agarose gel electrophoresis (120V, 30min). Observation using a gel imaging system (Bio-Rad) confirmed that the size of the λcI fragment (711 bp) was consistent with expectations. Figure 4 The target fragment was recovered using the Novizan DNA gel extraction kit, and Nanodrop 2000 analysis showed A… 260 / A 280 The ratio is 1.8-2.0, with no nucleic acid / protein contamination.

[0082] (2) Double digestion of pCDFduet1 vector and λcI fragment; double digestion of pCDFduet1 plasmid: pCDFduet1 plasmid was purchased from Nanjing Genscript Biotech Co., Ltd. Take 5 μg of pCDFduet1 plasmid, add 10 μL of 10×QuickCut Green Buffer (Takara), 5 μL of NcoI, 5 μL of BamHI, and enzyme-free pure water to make up to 100 μL. Digest at 37℃ for 1 h (for MCS1 treatment). Double digestion of λcI fragment: Take 5 μg of λcI recovered fragment, add NcoI (5 μL), BamHI (5 μL), and 10×QuickCut Green Buffer (10 μL), and digest at 37℃ for 1 h; After separation by 1% agarose gel electrophoresis, the enzyme digestion products were recovered using a gel recovery kit, and the concentration was detected to be ≥50 ng / μL.

[0083] (3) Connecting reaction and transformation screening; Ligation reaction system (20 μL): linearized pCDFduet1 vector (50 ng), NcoI / BamHI digested λcI fragment (50 ng, vector to fragment molar ratio ≤ 1:3), T4 DNA ligase (1 μL), 10×T4 DNA Ligase Buffer (2 μL), and enzyme-free pure water to a final volume of 20 μL; ligation was performed overnight in a 16℃ metal bath (12-16 h, to ensure ligation efficiency).

[0084] Transformation of competent cells: Add 10 μL of ligation product to 100 μL of E. coli DH5α competent cells and incubate on ice for 30 min; heat shock at 42℃ for 90 s (to promote vector entry into cells), and immediately incubate on ice for 2 min (to inhibit cell lysis); add 900 μL of antibiotic-free LB liquid medium and culture at 37℃ and 220 rpm for 1 h (to revive cells and express the streptomycin resistance gene); spread 100 μL of bacterial culture onto LB solid medium containing 50 μg / mL streptomycin and incubate upside down at 37℃ for 12-16 h to obtain transformant colonies.

[0085] (4) Identification of the intermediate plasmid pCDFduet1-(MCS1)-λcI Colony PCR validation: Ten single colonies were picked and inoculated into EP tubes containing 10 μL of antibiotic-free LB liquid medium. After vortexing, 1 μL was used as template. PCR amplification was performed using universal vector primers ACYCDuetUP1 (5'-GGATCTCGACGCTCTCCCT-3') and DuetDOWN1 (5'-GATTATGCGGCCGTGTACAA-3'). The reaction system (20 μL) consisted of: 10 μL of 2×Taqmix, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 1 μL of colony template, and enzyme-free pure water to a final volume of 20 μL. The reaction conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min, for a total of 30 cycles, followed by a final extension at 72℃ for 5 min. 5... μL of the amplification product was subjected to 1% agarose gel electrophoresis to screen for the band that amplified 711 bp (λcI target fragment). Figure 4 ).

[0086] Sequencing verification: The positive recombinant plasmid was sent to Sanger sequencing by Sangon Biotech Co., Ltd. to confirm that the λcI gene sequence had no base mutations, the insertion direction was correct and the reading frame was complete, which is the successfully constructed intermediate plasmid pCDFduet1-(MCS1)-λcI.

[0087] 2. Construction of co-expression plasmid pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP; (1) PCR amplification of the RNAP gene; Using pTRG plasmid (Agilent Technologies, catalog number 240065) as a template, PCR amplification was performed using the following primers: PCDFduetMCS2-RNAP-NdeI-F:5'-GGAATTC catatg ATGCAGGGTTCTGTGACAGA-3' (SEQ ID No. 7), the underlined part is the NdeI restriction site; PCDFduetMCS2-RNAP-BglII-R:5'-CGG agatct AGCTCTGGTTTCTCTTCTTTCA-3' (SEQ ID No. 8), the underlined part is the BglII restriction site.

[0088] PCR reaction system (100 μL): 50 μL of 2×pfu mix, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 1-2 μL of template DNA (pTRG plasmid, concentration ≥50 ng / μL) (to a final content ≥200 ng), and enzyme-free pure water to a final volume of 100 μL.

[0089] PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min (RNAP gene full length 744 bp, extension rate calculated at 1 kb / min), for a total of 34 cycles; 72℃ final extension for 5 min; incubation at 12℃.

[0090] Amplification product verification and purification: 5 μL of PCR product was subjected to 1% agarose gel electrophoresis (120 V, 30 min) to confirm that the amplified fragment size was an RNAP fragment (744 bp). Figure 4 The target fragment was recovered using a gel extraction kit, and A was detected using Nanodrop 2000. 260 / A 280The ratio is 1.8-2.0, and the concentration is adjusted to ≥100 ng / μL.

[0091] (2) Double digestion of intermediate plasmid and RNAP fragment; Double digestion of intermediate plasmid: Take 5 μg of pCDFduet1-(MCS1)-λcI plasmid, add 10 μL of 10×QuickCut Green Buffer, 5 μL of restriction endonuclease NdeI, 5 μL of BglII, and enzyme-free pure water to a final volume of 100 μL; digest at 37℃ for 1 h to linearize the MCS2 site; after separation of the digestion product by 1% agarose gel electrophoresis, recover the linearized plasmid backbone (approximately 5.1 kb, containing the vector + λcI fragment) using a gel recovery kit, and detect a concentration ≥50 ng / μL.

[0092] RNAP fragment double digestion: Take 5 μg of recovered RNAP fragment, add 5 μL of 10×QuickCut Green Buffer, 5 μL of restriction endonuclease NdeI, 5 μL of BglII, and enzyme-free pure water to a final volume of 100 μL; digest at 37℃ for 1 h; after separation of the digestion product by 1% agarose gel electrophoresis, recover the digested fragment using a gel recovery kit, and detect the concentration ≥100 ng / μL.

[0093] (3) Connecting reaction and transformation screening; Ligation reaction system (20 μL): linearized pCDFduet1-(MCS1)-λcI plasmid (50 ng), NdeI / BglII digested RNAP fragment (50 ng, vector to fragment molar ratio ≤ 1:3), T4 DNA ligase (1 μL), 10×T4 DNALigase Buffer (2 μL), and enzyme-free pure water to a final volume of 20 μL; ligation was performed overnight (12-16 h) in a metal bath at 16℃.

[0094] Transformation of competent cells: 10 μL of ligation product was used to transform DH5α competent cells, which were then spread on LB solid medium containing 50 μg / mL streptomycin and incubated upside down at 37℃ for 12-16 h to obtain transformant colonies.

[0095] (4) Identification of co-expression plasmids; Colony plasmid digestion identification: Four single colonies were picked and the plasmid was extracted by shaking. Those showing two bands after digestion were the successfully constructed "bait-prey" co-expression plasmid pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP (full length 5209 bp, sequence number SEQ ID No. 1). Figure 4The circular map of the co-expression plasmid pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP is shown below. Figure 1 As shown.

[0096] Example 2 - Construction of the two-hybrid system reporter plasmid pACYC184-cI&lac promoter-GFP This embodiment describes a preferred method for constructing the pACYC184-cI&lac promoter-GFP reporter plasmid, which specifically includes the following steps: 1. Amplification and restriction enzyme digestion of GFP fragments; Using the GFP sequence (as shown in SEQ ID No. 4) as a template, the cI & lac promoter sequence (bold italicized) was used as a primer for PCR amplification to obtain a GFP fragment (843 bp) containing the cI & lac promoter and XbaI / BamHI restriction sites. The PCR system and conditions were the same as in Example 1. After gel extraction, the fragment was digested with XbaI / BamHI (Takara) at 37°C for 1 h, and the digested fragment was recovered. The primers used are as follows: pACYC184-GFP-XbaI-F: 5'-CTAG tctaga GTCGAAGATCTTCGA CAACACGCACGGTGTTACATTAGGCACCCCGGGCTTTACA CTTTATGCTTCCGGCTCGTATGTTGTGTCGACCGAGCGGATAACAATTTCACACAGGAAACAGCT atggtgagcaagggcgagga-3' (SEQ ID No. 9), the underlined part is the XbaI restriction site; pACYC184-GFP-BamHI-R:5'-CGC ggatcc TTATTTGTATAGTTCATCCATGC ttatttgtatagttcat-3' (SEQ ID No. 10), the underlined part is the BamHI restriction site.

[0097] 2. Vector construction and identification; 10 μg of pACYC184 plasmid purchased from Wuhan Miaoling Biotechnology Co., Ltd. was digested with XbaI / BamHI for 1 h, and the vector backbone (approximately 3.8 kb) was recovered by gel extraction. The enzyme-digested GFP fragment (50 ng) and pACYC184 backbone (50 ng) were ligated overnight at 16°C using T4 DNA ligase, transformed into DH5α competent cells, and plated on LB plates containing 34 μg / mL chloramphenicol. Positive colonies were selected, plasmids were extracted, and double enzyme digestion was performed for verification. Electrophoresis showed a 4643 bp fragment (undigested plasmid) and a 3.8 kb+843 bp fragment (digested product), which was consistent with expectations. Figure 5Sequencing confirmed that the promoter and GFP gene sequences were free of mutations and that the linkage direction was correct, thus confirming the successful construction of the pACYC184-cI&lac promoter-GFP plasmid (full length 4643 bp, sequence number SEQ ID No. 2). The circular pattern of the aforementioned reporter plasmid pACYC184-cI&lac promoter-GFP is shown below. Figure 2 As shown.

[0098] Example 3 - Construction of positive control plasmid pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p This embodiment describes a preferred method for constructing the pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p positive control plasmid, which specifically includes the following steps: 1. Construction of the intermediate plasmid pCDFduet1-(MCS1)-λcI-LG2; (1) PCR amplification and purification of the λcI-LG2 fusion gene; Using pBT-cI-LG2 plasmid (Agilent Technologies, catalog number 240065) as a template, PCR amplification was performed. The PCR system and conditions were the same as in Example 1. Agarose gel electrophoresis showed that the size of the λcI-LG2 fragment (864 bp) was as expected. Figure 6 ); A was detected after gel recovery. 260 / A 280 =1.8-2.0. The primers used are as follows: PCDFduetMCS1-λcI-LG2-NcoI-F:5'-CATG ccatgg GCATGAGCACAAAAAAGAAACC-3' (SEQ ID No. 11), the underlined part is the NcoI restriction site; PCDFduetMCS1-λcI-LG2-BamHI-R:5'-GCG ggatcc TCAAAATAATCCTGTTAACAA-3' (SEQ ID No. 12), the underlined part is the BamHI restriction site.

[0099] (2) Double digestion of pCDFduet1 vector and λcI-LG2 fragment; To achieve the directional ligation of the λcI-LG2 fusion gene with the pCDFduet1 vector, the vector and the target fragment were subjected to NcoI / BamHI double digestion, and the specific operation was the same as in Example 1.

[0100] (3) Connection reaction and transformation screening The pCDFduet1 vector was linearly ligated with the λcI-LG2 restriction fragment via T4 DNA ligase and then transformed into E. coli DH5α competent cells for cloning screening. The specific operation was the same as in Example 1.

[0101] Agarose gel electrophoresis showed that the λcI-LG2 fragment (864 bp) was the size as expected. Figure 7 First-generation sequencing confirmed that the λcI-LG2 fusion gene sequence had no base mutations, the insertion direction was correct, and the reading frame was complete (no frameshift between λcI and LG2), which is the successfully constructed intermediate plasmid pCDFduet1-(MCS1)-λcI-LG2.

[0102] 2. Construction of the positive control plasmid pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p; (1) PCR amplification and purification of RNAP-Gal11p fusion gene; Using plasmid pTRG-RNAP-GAL11p (Agilent Technologies, catalog number 240065) as a template, PCR amplification was performed. The PCR system and conditions were the same as in Example 1. Agarose gel electrophoresis showed that the RNAP-Gal11p fragment (1069 bp) was the expected size. Figure 6 ); A was detected after gel recovery. 260 / A 280 =1.8-2.0. The primers used are as follows: PCDFduetMCS2-RNAP-Gal11p-NdeI-F: 5'-GGAATTC catatg ATGCAGGGTTCTGTGACAGA-3' (SEQ ID No. 13), the underlined part is the NdeI restriction site; PCDFduetMCS2-RNAP-Gal11p-BglII-R:5'-CGG agatct TCACAAAGCTTGGATTTTTCT-3' (SEQ ID No. 14), the underlined part is the BglII restriction site.

[0103] (2) Double digestion of the intermediate plasmid and the RNAP-Gal11p fragment; The intermediate plasmid pCDFduet1-(MCS1)-λcI-LG2 (MCS2 site) and the RNAP-Gal11p fragment were double-digested with NdeI / BglII to ensure that RNAP-Gal11p was directionally inserted into MCS2. The specific operation was the same as in Example 1.

[0104] (3) Connecting reaction and transformation screening; The linearized intermediate plasmid was ligated with RNAP-Gal11p restriction fragments via T4 DNA ligase and then transformed into E. coli DH5α competent cells for cloning screening. The specific operation was the same as in Example 1.

[0105] Agarose gel electrophoresis showed that the RNAP-Gal11p fragment (1069 bp) was the expected size. Figure 8 The positive clone was sent for first-generation sequencing to confirm that the fusion gene sequence of λcI-LG2 and RNAP-Gal11p had no base mutations, the insertion direction was correct, and the reading frames were continuous (no frameshift between λcI and LG2, and between RNAP and Gal11p). This confirmed the successful construction of the positive control plasmid pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p (full length 5640 bp, sequence number SEQ ID No. 3). This plasmid can activate the reporter gene through the strong specific interaction between λcI-LG2 and RNAP-Gal11p (dissociation constant KD≈10nM), providing a positive standard for subsequent functional verification of the bacterial two-hybrid system. The circular map of the above positive control plasmid pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p is shown below. Figure 3 As shown.

[0106] Example 4 - Verification of the sensitivity and reliability of the two-hybrid system This embodiment verifies the sensitivity and reliability of the two-hybrid system containing the co-expression plasmid, reporter plasmid, and positive control plasmid from Examples 1-3. The specific steps include: 1. Flow cytometry detection with negative / positive controls; The co-expression plasmid of Example 1 (negative control) and the positive control plasmid of Example 3 were co-transformed with the reporter plasmid of Example 2 into BL21(DE3) competent cells, plated on streptomycin (50 μg / mL) + chloramphenicol (34 μg / mL) double antibody plates, and cultured at 37°C for 12 h. Select single colonies and inoculate them into 5 mL of double-antibiotic LB medium, and incubate overnight at 37°C and 220 rpm; then transfer them at a 1% ratio to 50 mL of fresh medium and incubate until OD. 600 When the concentration is 0.2-0.3, add IPTG to a final concentration of 0.25 mM and induce at 37℃ for 3 h; Take 1 mL of the induced bacterial culture, centrifuge at 4℃ and 10000 rpm for 2 min, wash twice with PBS, and resuspend in 1 mL of PBS (OD500). 600=1), diluted 20-fold, and the GFP fluorescence intensity was detected by Beckman CytoFlex S flow cytometer (excitation wavelength 488 nm, emission wavelength 520 nm).

[0107] The results showed that the average fluorescence intensity of the positive control group (Mean FITC-A = 1.2 × 10⁻⁶) was significantly higher than that of the control group. 4 The difference was 15 times that of the negative control group (Mean FITC-A = 8 × 10²), and the distinction between the negative and positive groups was significant. Figure 9 This proves that the system sensitivity meets the detection requirements.

[0108] 2. Validation of the interaction between Mycobacterium tuberculosis and the TA system; Using the Mycobacterium tuberculosis MTB H37Rv genome as a reference template, six pairs of known TA systems (RelB-RelE, RelJ-RelK, RelF-RelE, RelJ-RelE, RelF-RelK, RelJ-RelG) of pCDFduet1-λcI-RNAP co-expression plasmids were synthesized by Sangon Biotech Co., Ltd., and co-transformed with the reporter plasmid of Example 2 into BL21(DE3) cells. Induction and flow cytometry detection were performed according to step 1.

[0109] The results showed that the FITC positivity rates of the three interacting TA systems (RelB-RelE, RelJ-RelK, and RelF-RelE) reported in the UniProt database were all ≥78%, while the FITC positivity rates of the three non-interacting TA systems (RelJ-RelE, RelF-RelK, and RelJ-RelG) were all ≤4%. Figure 10 The results are completely consistent with known results, proving the reliability of the system.

[0110] Example 5 - Construction of a plasmid library for co-expression of Mycobacterium tuberculosis 77*77 toxin and antitoxin This embodiment describes a preferred method for constructing a plasmid library co-expressing Mycobacterium tuberculosis 77*77 toxin and antitoxin, which specifically includes the following steps: 1. Antitoxin and toxin fragment amplification; Download the DNA sequences of all 77 antitoxins and 77 toxins of Mycobacterium tuberculosis from the toxin-antitoxin database TADB2.0 (https: / / bioinfo-mml.sjtu.edu.cn / TADB2 / index.php). Design primers using the Novizan primer design website (https: / / crm.vazyme.com / cetool / singlefragment.html). The general principle of primer design is to introduce homologous sequences from both ends of the linearized vector into the 5' end of the forward and reverse amplification primers of the insert fragment, so that the 5' and 3' ends of the amplified insert fragment contain homologous sequences (15-20 bp, excluding restriction enzyme sites) that correspond to the ends of the linearized cloning vector.

[0111] Specifically, the primer design for the antitoxin is as follows: Primer F: 5'-AGAGACGTTTGGCca + GGATCC (BamHI restriction site) + g + gene-specific forward amplification primer sequence - 3'; Primer R: 5'-CGACTTAAGCATTAT + GCGGCCGC (NotI restriction site) + gene-specific reverse amplification primer sequence - 3'; The primers for the toxin are designed as follows: Primer F: 5'-AGAGAAACCAGAGct + AGATCT (BglII restriction site) + gene-specific forward amplification primer sequence - 3' Primer R: 5'-TGGCCGGCCGATATC + CAATTg (MfeI restriction site) + gene-specific reverse amplification primer sequence - 3' Using the MTB H37Rv genome as a template, 77 antitoxins and 77 toxin fragments were amplified by PCR. After gel recovery, the fragments were mixed and the concentration was adjusted to 100 ng / μL. The above-mentioned Mycobacterium tuberculosis MTB H37Rv genome (GenBank accession number: AL123456) was obtained from the Institute of Microbiology, Chinese Academy of Sciences.

[0112] 2. Construction of antitoxin library; The pCDFduet1-λcI-RNAP co-expression plasmid from Example 1 was digested with BamHI / NotI and homologously recombined with 77 antitoxin fragments (Novizan, catalog number C112). The resulting plasmids were transformed into DH5α competent cells, and 77 plasmids expressing antitoxin were obtained by screening. The plasmids were then mixed in equimolar amounts to construct an antitoxin library (concentration 500 ng / μL).

[0113] 3. Construction of a 77×77 toxin-antitoxin co-expression library; Using an antitoxin library as a template, 77 linearized antitoxin vectors were obtained by reverse PCR using primers RNAP-F: GGCAGCAGCGATTACAAGGATGAC GACGATAAG (SEQ ID No. 15); RNAP-R: GCTGCTGCCGGCCGCCTCTGG (SEQ ID No. 16). Homologous recombination was performed on a mixture of the 77 toxin fragments obtained using the same steps. 10 μL of the recombination product was transformed into DH5α competent cells, and 700 μL of SOC medium was added. The cells were incubated at 37°C and 220 rpm for 1 h. Spread 8 μL of bacterial culture onto a 10 cm streptomycin agar plate (for counting), and spread 200 μL of bacterial culture onto 15 cm streptomycin agar plates (4 plates in total). Incubate at 37°C for 12 h; the colony count showed a clone count of 5 × 10⁻⁶. 4 The number of clones is 8.4 times the theoretical size of the library (77×77=5929), which meets the library construction requirements (number of clones ≥ twice the theoretical size). Scrape the clones from the plate and extract the plasmids using a plasmid miniprep kit (MACHEREY-NAGEL, catalog number 740410.50), which yields the 77×77 toxin-antitoxin co-expression plasmid library. Figure 11 ).

[0114] 4. Third-generation sequencing to detect library integrity; The 7×77 toxin-antitoxin co-expression library was amplified by PCR using primers Sequence F: CCTGAAGAGACGTTTGGCca (SEQ ID No. 17) and Sequence R: CGTGGCCGGCCGATATC (SEQ ID No. 18), and then sent for third-generation sequencing (PacBio Sequel II). The sequencing data was aligned with reference sequences of 77 AT and 77 T using Minimap2 software (Linux system, conda installation). The steps were briefly described as follows: the original sequencing data file was aligned with the reference antitoxin / toxin sequences in Minimap2 software; the antitoxin and toxin alignment results were merged; a Python file was created and run. The results showed that out of 5929 theoretical combinations of 77×77, only 23 combinations were not detected (deletion rate 0.39%, presumably due to genotoxicity causing the host bacteria to fail to survive); the sequencing coverage of the remaining 5906 combinations was ≥10×, and the coefficient of variation for AT and T abundance was ≤15%. Figure 12 This proves that the library is of good integrity.

[0115] Example 6 - High-throughput screening of Mycobacterium tuberculosis 77*77 toxin and antitoxin interaction pairs This embodiment presents a preferred high-throughput screening method for the interaction pair of Mycobacterium nucleatum 77*77 toxin and antitoxin, which specifically includes the following steps: 1. Preparation of BL21(DE3) electrocompetent cells containing reporter plasmid; The pACYC184-cI&lac promoter-GFP reporter plasmid from Example 2 was transformed into BL21(DE3) competent cells. Single clones were selected and seeded into 5 mL LB medium, and cultured overnight at 37°C and 250 rpm. The cells were then transferred at a 1:100 ratio to 50 mL LB medium and cultured until OD500. 600 =0.4, ice bath for 30 min; centrifuge at 4℃, 6000×g for 5 min, wash 3 times with pre-cooled ultrapure water, and finally resuspend in 500 μL of pre-cooled 10% glycerol, dispense 50 μL / tube, and store at -80℃.

[0116] 2. Library electroporation and culture; Take 50 μL of competent cells, add 100 ng of the 77×77 TA library plasmid constructed in Example 5, and simultaneously set up the positive control plasmid pCDFduet1-λcI-LG2-RNAP-Gal11p, and incubate on ice for 10 min. Add to a 1 mm electroporation cuvette, electroporate at 1800V, and immediately add 1 mL of LB medium (containing the inducer IPTG, final concentration of 0.25 mM), and revive at 37℃ and 180 rpm for 1 h. Take 100 μL of the revive bacterial solution, spread it on a double-antibody plate, and incubate at 37℃ for 12 h.

[0117] 3. Flow cytometry sorting and sequencing analysis; Clones were scraped from plates using 5 mL PBS, washed twice with PBS, and resuspended. Using a BD FACSAria II flow cytometer at a flow rate of 3000 evt / s, impurities were removed using FSC / SSC, and 1 × 10⁻⁶ FITC-positive (P4 gate) and 1 × 10⁻⁶ FITC-negative (P5 gate) populations were separated. 6 Cells ( Figure 13 ), where P4 group: FITC positive group (fluorescence intensity in the top 5%); P5 group: FITC negative group (fluorescence intensity below 100).

[0118] Plasmids were extracted from both populations and amplified by PCR using Sequence F / R primers, followed by third-generation sequencing. The fold change (FC) of each toxin-antitoxin pair was defined as the frequency of that interaction in the positive population / the frequency of that interaction in the negative population. The FC value of each TA pair was calculated, and the results showed that a total of 1243 effective interactions (FC > 1.5) were detected, among which toxin Rv2801c had cross-interactions with 67 ATs, which were the core interaction nodes. Figure 14 ).

[0119] Example 7 - Validation of Interaction Pairs (In Vivo, In Vitro) This embodiment verifies the effective interaction pairs of TA proteins obtained in Example 6 both in vivo and in vitro, specifically including the following steps: 1. In vitro SPR validation; (1) Protein expression and purification; Recombinant plasmids pET28a-Strep-Rv2801c (toxin), pET28a-His-Flag-Rv2801A (original AT), and pET28a-His-Flag-Rv2274A (non-original AT) were constructed and transformed into BL21(DE3) cells; cultured at 37℃ until OD2801. 600 =0.3, add 0.25 mM IPTG to induce for 4 h; The bacterial cells were lysed using TieChui™ E. coli Lysis Buffer (ACE), and Rv2801c was purified using Strep-TactinBeads (Tiandi Renhe Company), while Rv2801A and Rv2274A were purified using Ni-NTA Beads (Qiagen Company). SDS-PAGE showed that the protein purity was ≥90%.

[0120] (2) SPR detection; Rv2801c (20 μg / mL) was immobilized on a CM5 chip via amino coupling. Rv2801A and Rv2274A were serially diluted (0.39-100 nM) as mobile phases and detected by a Biacore 8K instrument. The results showed that Rv2801c had a KD of 15.4 pM (strong interaction) with Rv2801A and a KD of 234 nM (moderate interaction) with Rv2274A, both meeting the criteria for valid interaction. Figure 15 ).

[0121] 2. In vivo Co-IP validation; Recombinant plasmids pBAD33-Strep-Rv2801c, pTRC99a-Flag-Rv2801A, and pTRC99a-Flag-Rv0456B (non-interacting AT) were constructed and co-transformed into BL21(DE3) cells; cells were cultured at 37°C until OD600. 600 =0.4, add 0.2% arabinose + 100 μM IPTG to induce for 4 h; 10 mL of bacterial culture was lysed and immunoprecipitated with Strep-Tactin Beads. Western blotting showed that Rv2801c could form a complex with Rv2801A (positive for Flag antibody detection), but no complex was formed with Rv0456B (negative for Flag antibody detection). Figure 16 This further verifies the authenticity of the interaction.

[0122] Comparative Example 1 This comparative example aims to screen for TA interactions on a 30×30 scale. The traditional two-plasmid B2H system (BacterioMatch™, Agilent) and the two-hybrid system of this invention, containing co-expression plasmids, reporter plasmids, and positive control plasmids from Examples 1-3, were used for screening. The comparison indicators are as follows: The above comparison results show that the system of the present invention is significantly better than the traditional B2H system in terms of screening efficiency, sensitivity and reliability, and is especially suitable for large-scale high-throughput screening scenarios.

[0123] As can be seen from the above embodiments, this invention fundamentally changes the application of bacterial two-hybrid systems: upgrading from a single "single bait vs. prey library" model to a networked interaction map construction of "multiple baits vs. multiple prey," and advancing from binary qualitative judgment (yes / no interaction) to quantitative analysis of binding strength. To verify the functional completeness and technical advantages of the protein interaction screening system of this invention, the Mycobacterium tuberculosis toxin-antitoxin systems (TA systems) were selected as a typical research object. An expression library containing multiple toxin and antitoxin proteins was constructed, and the bacterial two-hybrid system developed in this invention was used to implement high-throughput, full-matrix interaction screening. Experimental results revealed that, in addition to known classic pairing interactions, there is a significant cross-interaction network between non-primitive toxin-antitoxin proteins from different families, suggesting that the Mycobacterium tuberculosis TA system may form complex functional modules through cross-regulation, providing a new perspective for the study of pathogen pathogenesis and drug resistance mechanisms. This validation experiment confirms that the system has overcome the key bottleneck in the screening of multiple protein interactions using traditional two-hybrid technology, providing an efficient and reliable integrated solution for large-scale proteomics research.

[0124] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A protein interaction screening system based on bacterial two-hybrid technology, characterized in that, The protein interaction screening system includes a co-expression plasmid for bait and prey proteins. The co-expression plasmid is pCDFduet1-λcI-RNAP, and its sequence is shown in SEQ ID No.

1.

2. The protein interaction screening system according to claim 1, characterized in that, The preparation steps of the pCDFduet1-λcI-RNAP plasmid include: S11. PCR amplification of the λcI gene yielded the λcI fragment; the pCDFduet1 vector was digested with the λcI fragment using enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI plasmid. S12. PCR amplification of the RNAP gene to obtain the RNAP fragment; pCDFduet1-(MCS1)-λcI plasmid and RNAP fragment were digested with enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI-(MCS2)-RNAP plasmid.

3. The protein interaction screening system according to claim 1, characterized in that, The protein interaction screening system also includes a bacterial two-hybrid reporter plasmid, the reporter plasmid being pACYC184-cI&lac promoter-GFP plasmid, the sequence of which is shown in SEQ ID No.

2.

4. The protein interaction screening system according to claim 3, characterized in that, The preparation steps of the pACYC184-cI&lacpromoter-GFP plasmid include: S21. Amplify the GFP gene by PCR using primers containing cI & lac promoters to obtain the GFP fragment; perform enzyme digestion on the GFP fragment to obtain the GFP digestion product: The S22 and pACYC184 plasmids were digested with enzymes to obtain the pACYC184 backbone. S23. The GFP enzyme digestion product is ligated to the pACYC184 backbone and transformed to construct the pACYC184-cI&lacpromoter-GFP plasmid.

5. The protein interaction screening system according to claim 3, characterized in that, The protein interaction screening system also includes a positive control plasmid, which is pCDFduet1-λcI-LG2-RNAP-Gal11p plasmid, the sequence of which is shown in SEQ ID No.

3.

6. The protein interaction screening system according to claim 5, characterized in that, The preparation steps of the pCDFduet1-λcI-LG2-RNAP-Gal11p plasmid include: S31. PCR amplification of the λcI-LG2 fusion gene yielded the λcI-LG2 fragment; the pCDFduet1 vector was digested with the λcI-LG2 fragment using enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI-LG2 plasmid. S32. The RNAP-Gal11p fusion gene was amplified by PCR to obtain the RNAP-Gal11p fragment; the pCDFduet1-(MCS1)-λcI-LG2 plasmid and the RNAP-Gal11p fragment were digested with enzymes; the digestion products were ligated and transformed to construct the pCDFduet1-(MCS1)-λcI-LG2-(MCS2)-RNAP-Gal11p plasmid.

7. A method for constructing a Mycobacterium tuberculosis toxin-antitoxin co-expression plasmid library, characterized in that, The construction method includes the following steps: a) PCR amplification of antitoxin and toxin to obtain antitoxin fragments and toxin fragments; b) Construction of antitoxin plasmid library: The pCDFduet1-λcI-RNAP co-expression plasmid described in claim 1 or 2 is digested with enzymes and homologously recombined with each antitoxin fragment. The recombinant products are transformed to obtain plasmids that express antitoxin alone. The plasmids that express antitoxin alone are mixed to obtain antitoxin plasmid library. c) Construction of toxin-antitoxin co-expression plasmid library: Using the antitoxin plasmid library as a template, a linearized vector was obtained by reverse PCR, and homologous recombination was performed with each toxin fragment. The recombination product was transformed and cultured to obtain the toxin-antitoxin co-expression plasmid library.

8. A high-throughput protein interaction screening method for Mycobacterium tuberculosis toxin-antitoxin, characterized in that, Including the following steps: A) Obtain a plasmid library of tuberculosis mycotoxin-antitoxin co-expression using the construction method described in claim 7; B) Transform the pACYC184-cI&lac promoter-GFP reporter plasmid as described in claim 3 or 4 into competent cells and culture them to prepare competent cells containing the pACYC184-cI&lac promoter-GFP reporter plasmid; transform the toxin-antitoxin co-expression plasmid library into competent cells containing the pACYC184-cI&lac promoter-GFP reporter plasmid, add an inducer and culture them, and at the same time set up the positive control plasmid pCDFduet1-λcI-LG2-RNAP-Gal11p as described in claim 5 or 6 as a positive control group; C) Perform flow cytometry sorting on the clones obtained after culture in step B), using the positive control group as the screening criterion to separate the FITC positive population and the FITC negative population. D) Extract plasmids from each population, amplify them by PCR, and sequence the amplification products to screen out effective interacting proteins.

9. The high-throughput protein interaction screening method according to claim 8, characterized in that, In step C), the FITC-positive group is defined as those with fluorescence intensity in the top 5%, and the FITC-negative group is defined as those with fluorescence intensity below 100; and / or, In step D), the interaction degree FC of each toxin-antitoxin pair is defined as the frequency of occurrence of the interaction in the positive population / the frequency of occurrence in the negative population; wherein, when FC > 1.5, the toxin-antitoxin pair is determined to be an effective interaction.

10. An application of the protein interaction screening system as described in any one of claims 1 to 6, characterized in that, The application is selected from at least one of the following applications: application in constructing an interaction protein library, application in screening interaction proteins of pathogenic microorganisms or eukaryotes, application in screening antimicrobial drugs that target protein interactions, and application in formulations for determining pathogenicity and drug resistance mechanisms of pathogens.

Images