A Taq DNA polymerase mutant, its construction method and application

Abstract

The application discloses a Taq DNA polymerase mutant and a construction method and application thereof. The Taq DNA polymerase mutant is obtained by mutating any two or three of R37A, K314A and P387L sites of a sequence shown in SEQ ID NO. 1. The Taq DNA polymerase mutant is more suitable for PCR amplification of samples containing human whole blood, and is more conducive to improving the accuracy of result evaluation of samples containing human whole blood inhibitors, and provides a new DNA polymerase for PCR amplification and detection of clinical samples containing human whole blood.

Description

Technical Field

[0001] This application relates to the field of DNA polymerase technology, and in particular to a Taq DNA polymerase mutant, its construction method, and its application. Background Technology

[0002] Taq DNA polymerase, a core enzyme in polymerase chain reaction (PCR), is currently the most widely used DNA polymerase. However, studies have shown that conventional Taq DNA polymerase completely loses its polymerization activity in whole blood samples containing 0.2% (v / v) or higher. Potential PCR inhibitors identified in blood mainly include heme, immunoglobulin G (IgG), hemoglobin, and lactoferrin. Given that both human whole blood and lactoferrin contain iron ions, their ability to release iron is considered one of the potential inhibitory mechanisms. Existing research has preliminarily elucidated the molecular mechanisms of action of these inhibitors: hemoglobin and heme can impair amplification efficiency by reducing DNA polymerase activity; simultaneously, in real-time fluorescence detection-based methods (such as qPCR and dPCR), hemoglobin and heme are also key molecules in blood samples causing fluorescence quenching. Furthermore, IgG is thought to delay the PCR amplification process by binding to single-stranded genomic DNA (ssDNA), interfering with the effective binding of primers or templates, thus manifesting as an increased cycle threshold (Ct). Given that existing studies mostly focus on whole blood samples or single inhibitor analysis, and generally use commercially available DNA polymerases that have been engineered (such as buffer system optimization, site-directed mutagenesis, or domain fusion), there is still a lack of systematic evaluation of the inhibitory effects of whole blood environment and key inhibitors on wild-type Taq DNA polymerase.

[0003] Taq DNA polymerase, the first thermostable DNA polymerase discovered, has a molecular weight of 94 kDa. It was initially extracted by Saiki et al. from a strain of thermophilic bacterium *Thermus aquaticus* isolated from hot springs. This enzyme is heat-resistant; after 2 hours at 70°C, its residual activity is greater than 90% of the original activity; after 2 hours at 93°C, its residual activity is 60% of the original activity; and after 2 hours at 95°C, its residual activity is 40% of the original activity. In molecular cloning, Taq DNA polymerase can be used for DNA sequencing and for in vitro amplification of specific DNA fragments using polymerase chain reaction (PCR). During PCR, because Taq DNA polymerase is not inactivated during the denaturation step (approximately 94°C), it can directly enter the second cycle, eliminating the need to add fresh enzyme at each cycle. This makes Taq DNA polymerase a unique enzyme in PCR reactions.

[0004] PCR technology is a cornerstone of modern molecular biology, and Taq DNA polymerase is the classic mainstay of PCR technology. Based on the inherent functions and characteristics of Taq DNA polymerase, it has been modified through techniques such as site-directed mutagenesis, domain recombination, and directed evolution. This has resulted in many mutants of Taq DNA polymerase with improved catalytic performance or exhibiting new functions, which are widely used in molecular biology fields such as direct PCR, allele detection, Sanger sequencing, quantitative real-time PCR, and Taq DNA cloning. However, because commonly used clinical samples contain many substances, especially human whole blood, that significantly inhibit PCR amplification, there is a problem of low tolerance of Taq DNA polymerase to human whole blood.

[0005] Therefore, how to solve the problem of Taq DNA polymerase tolerance to human whole blood and develop new Taq DNA polymerase blood tolerance protocols remains a key research focus and challenge in this field. Summary of the Invention

[0006] The purpose of this application is to provide a novel Taq DNA polymerase mutant, its construction method, and its application.

[0007] To achieve the above objectives, this application adopts the following technical solution:

[0008] The first aspect of this application discloses a Taq DNA polymerase mutant obtained by mutating any two or three of the R37A, K314A, and P387L sites in the sequence shown in SEQ ID NO. 1.

[0009] For example, the K314A / R37A mutation involves replacing lysine at position 314 with alanine and arginine at position 37 of the Taq DNA polymerase, as shown in SEQ ID NO.1, with the amino acid sequence shown in SEQ ID NO.2. The K314A / P387L mutation involves replacing lysine at position 314 with alanine and proline at position 387 with leucine of the Taq DNA polymerase, as shown in SEQ ID NO.1, with the amino acid sequence shown in SEQ ID NO.3. The K314A / R37A / P387L mutation involves replacing lysine at position 314 with alanine, arginine at position 37 with alanine, and proline at position 387 with leucine of the Taq DNA polymerase, as shown in SEQ ID NO.4, with the amino acid sequence shown in SEQ ID NO.4.

[0010] It should be noted that this application involves mutating any two or three of the R37A, K314A, and P387L sites of the Taq DNA polymerase in the sequence shown in SEQ ID NO. 1, resulting in a Taq DNA polymerase mutant that is more suitable for PCR amplification of samples containing human whole blood, and is more conducive to improving the accuracy of result evaluation for samples containing human whole blood inhibitors.

[0011] The second aspect of this application discloses a method for preparing the Taq DNA polymerase mutant of this application, comprising the following steps:

[0012] (1) Using the nucleic acid encoding the sequence shown in SEQ ID NO.1 as a template, according to the rationally designed mutation site, design site-directed mutation primers, perform PCR amplification to obtain the gene encoding the Taq DNA polymerase mutant, and construct a vector containing the gene encoding the Taq DNA polymerase mutant;

[0013] (2) Transform the vector containing the gene encoding the Taq DNA polymerase mutant into the host cell;

[0014] (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Culture and ferment the positive clones. After fermentation, collect the cells by centrifugation, break the cells, and separate and purify the Taq DNA polymerase mutant.

[0015] A third aspect of this application discloses a nucleic acid for encoding the Taq DNA polymerase mutant of this application.

[0016] The fourth aspect of this application discloses a recombinant vector containing a gene encoding the Taq DNA polymerase mutant of this application.

[0017] In one implementation of this application, the recombinant vector is the pET-28a(+) vector as the expression vector.

[0018] The fifth aspect of this application discloses a recombinant cell carrying the nucleic acid of this application or the recombinant vector of this application.

[0019] The sixth aspect of this application discloses a genetically engineered bacterium for expressing the Taq DNA polymerase mutant of this application.

[0020] In one implementation of this application, the genetically engineered bacteria use Escherichia coli as the host.

[0021] In one implementation of this application, the genetically engineered bacteria use Escherichia coli BL21(DE3) or pET-28a(+) vectors as expression hosts.

[0022] In one implementation of this application, the genetically engineered bacteria use Bacillus subtilis or Corynebacterium glutamicum as the expression system.

[0023] The seventh aspect of this application discloses the use of the Taq DNA polymerase mutant of this application in PCR amplification of whole blood samples or samples containing whole blood.

[0024] The eighth aspect of this application discloses a kit for PCR amplification of whole blood samples or samples containing whole blood, which contains the Taq DNA polymerase mutant of this application.

[0025] It should be noted that the kit of this application, containing the Taq DNA polymerase mutant of this application, is capable of PCR amplification of whole blood samples or samples containing whole blood. For example, in one implementation of this application, the Taq DNA polymerase mutant of this application can amplify in the presence of 30% (v / v) human whole blood, while the natural Taq DNA polymerase can only amplify in the presence of 0.02% (v / v) human whole blood. The amount of human whole blood that the Taq DNA polymerase mutant of this application can amplify is 1500 times that of the natural Taq DNA polymerase.

[0026] Due to the adoption of the above technical solutions, the beneficial effects of this application are as follows:

[0027] The Taq DNA polymerase mutant of this application is more suitable for PCR amplification of samples containing human whole blood, and is more conducive to improving the accuracy of result evaluation of samples containing human whole blood inhibitors, providing a new DNA polymerase for PCR amplification detection of clinical samples containing human whole blood. Attached Figure Description

[0028] Figure 1 This is a chromatogram of sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the washing solution during the purification of Taq DNA polymerase in the embodiments of this application.

[0029] Figure 2 This is a standard curve diagram for Taq DNA polymerase activity assay in the embodiments of this application;

[0030] Figure 3 The images show agarose gel electrophoresis results of Taq-wt, Taq-K314A / R37A, Taq-K314A / P387L, and Taq-K314A / R37A / P387L in human whole blood at gradients of 0%, 5% (v / v), 10% (v / v), 15% (v / v), 20% (v / v), 30% (v / v), and 40% (v / v) in the embodiments of this application. Detailed Implementation

[0031] To address the issue of low tolerance of wild-type Taq DNA polymerase to human whole blood, this application involves mutating and modifying the natural Taq DNA polymerase, resulting in a series of new Taq DNA polymerase mutants with higher tolerance to human whole blood.

[0032] Specifically, this application modifies the molecular structure of Taq DNA polymerase based on natural Taq DNA polymerase through rational design and site-directed mutagenesis biotechnology. The effects of mutated residues on the enzyme's tolerance to human whole blood were analyzed, and ultimately, the Taq DNA polymerase mutant of this application was obtained by mutating any two or three of the R37A, K314A, and P387L sites in the sequence shown in SEQ ID NO. 1. For example, the K314A / R37A mutant, the K314A / P387L mutant, and the K314A / R37A / P387L mutant.

[0033] Natural Taq DNA polymerase can amplify in the presence of 0.02% (v / v) human whole blood, while the Taq DNA polymerase mutant of this application can amplify in the presence of 20%-30% (v / v) human whole blood, which is 1000-1500 times that of natural Taq DNA polymerase. For example, the Taq DNA polymerase mutant K314A / R37A (abbreviated Taq-K314A / R37A) can amplify in the presence of 20% (v / v) human whole blood, which is 1000 times that of natural Taq DNA polymerase; the Taq DNA polymerase mutant K314A / P387L (abbreviated Taq-K314A / P387L) can amplify in the presence of 20% (v / v) human whole blood, which is 1000 times that of natural Taq DNA polymerase; and K314A / R37A / P387L (abbreviated Taq-K314A / R37A / P387L) can amplify in the presence of 30% (v / v) human whole blood, which is 1500 times that of natural Taq DNA polymerase.

[0034] The Taq DNA polymerase mutant obtained in this application is more suitable for PCR amplification of human whole blood samples than the wild type, and is more conducive to the accuracy of result evaluation of samples containing human whole blood inhibitors.

[0035] The present application will be further described in detail below through specific embodiments. The following embodiments are only for further illustration of the present application and should not be construed as limiting the present application.

[0036] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0037] Example

[0038] The pET-28a(+) vector used in this example was purchased from Invitrogen.

[0039] The culture medium involved in this example is as follows:

[0040] (1) LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0041] (2) LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0042] The detection methods involved in this example are as follows:

[0043] Taq DNA polymerase activity assay uses a fluorescence method. This method utilizes the ability of Taq DNA polymerase to amplify double-stranded DNA using long-chain oligonucleotides as templates and a short single-stranded oligonucleotide complementary to the long-chain oligonucleotide at its 5' end as a primer. The fluorescent dye SYBR Green binds to the minor groove of the double-stranded DNA and emits fluorescence; the more DNA double strands synthesized, the stronger the fluorescence signal. The real-time fluorescence signal collected by the DNA polymerase amplification is analyzed, and the initial slope of the real-time fluorescence signal curve can be used to determine the enzyme activity units at the beginning of the reaction. The method for determining enzyme activity mainly consists of two steps: (1) plotting a standard curve of known commercial Taq DNA polymerase activity units; (2) determining the activity units of unknown enzymes.

[0044] In the PCR detection system, a 236 bp amplicon from the human genome was used to investigate the tolerance of Taq DNA polymerase to human whole blood. The 25 µL PCR reaction mixture consisted of: 1×PCR buffer, 2.5 mM MgCl2, 0.2 µM upstream primer, 0.02 µM downstream primer, 200 µM dNTPs, 0.4×SYBR Green, and 1 U of enzyme. The template concentration was 1 ng / µL, and 2 µL was loaded. The concentration of human whole blood in the system was increased in a gradient, and the PCR products were analyzed by nucleic acid electrophoresis.

[0045] Experiment 1: Construction of recombinant plasmid containing Taq DNA polymerase mutant

[0046] The specific steps are as follows:

[0047] (1) Construction of recombinant plasmids containing wild-type Taq DNA polymerase

[0048] Construction of recombinant plasmids

[0049] The polA gene (Uniprot ID: P19821) from *Thermus aquaticus* was codon-optimized, and the whole gene was synthesized by Suzhou Genewise Biotechnology Co., Ltd. The wild-type Taq DNA polymerase gene polA, with the amino acid sequence shown in SEQ ID NO. 1, was ligated to the pET-28a(+) vector using NdeI and MluI enzymes to prepare the recombinant vector pET-28a(+)-polA.

[0050] (2) Obtaining recombinant vectors containing mutants

[0051] Using whole plasmid PCR technology, the recombinant vector pET-28a(+)-polA prepared in step (1) was used as a template for site-directed mutagenesis to obtain recombinant plasmids pET-28a(+)-K314A / R37A, pET-28a(+)-K314A / P387L, and pET-28a(+)-K314A / R37A / P387L containing mutant genes.

[0052] The designed primer sequences are as follows (all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.):

[0053] R37A-F: CTGACCACGAGCgcgGGCGAACCGGTG (SEQ ID NO.5)

[0054] R37A-R: CTTGCACCGGTTCGCCcgcGCTCGTG (SEQ ID NO.6)

[0055] K314A-F: CTTTGTGCTGAGCCGCgcgGAGCCGATG (SEQ ID NO.7)

[0056] K314A-R: CACATCGGCTCcgcGCGGCTCAGCAC (SEQ ID NO.8)

[0057] P387L-F: CAACACCACCttaGAAGGCGTGGCG (SEQ ID NO.9)

[0058] P387L-R: GCCACGCCTTCtaaGGTGGTGTTGC (SEQ ID NO.10)

[0059] The PCR amplification program was set as follows: first, pre-denaturation at 95℃ for 5 min; then 30 cycles: denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 1.5 min; final extension at 72℃ for 5 min; and incubation at 4℃. PCR products were detected by 0.8% agarose gel electrophoresis.

[0060] The final amplified fragment was treated with Dpn I enzyme in a 37°C water bath for 1 h to remove the template. The PCR mixture was then chemically transformed into E. coli JM109 competent cells. The transformation solution was plated on LB solid medium containing kanamycin (50 μg / mL), and the plasmid was extracted and sequenced. The sequencing was performed by Genewiz Suzhou.

[0061] pET-28a(+)-K314A / R37A is a recombinant plasmid expressing the Taq DNA polymerase mutant shown in SEQ ID NO.2, pET-28a(+)-K314A / P387L is a recombinant plasmid expressing the Taq DNA polymerase mutant shown in SEQ ID NO.3, and pET-28a(+)-K314A / R37A / P387L is a recombinant plasmid expressing the Taq DNA polymerase mutant shown in SEQ ID NO.4.

[0062] SEQ ID NO.1:

[0063] *。

[0064] SEQ ID NO.2:

[0065] *。

[0066] SEQ ID NO.3:

[0067] *。

[0068] SEQ ID NO.4:

[0069] MRGMLPLFEPKGRVLLVDGHHLAYRTFHALKGLTTSAGEPVQAVYGFAKSLLKALKEDGDAVIVVFDAKAPSFRHEAYGGYKAGRAPTPEDFPRQLALIKELVDLLGLARLEVPGYEADDVLASLAKKAEKEGYEVRILTADKDLYQLLSDRIHVLHPEGYLITPAWLWEKYGLRPDQWADYRALTGDESDNLPGVKGIGEKTARKLLEEWGSLEALLKNLDRLKPAIREKILAHMDDLKLSWDLAKVRTDLPLEVDFAKRREPDRERLRAFLERLEFGSLLHEFGLLESPKALEEAPWPPPEGAFVGFVLSRAEPMWADLLALAAARGGRVHRAPEPYKALRDLKEARGLLAKDLSVLALREGLGLPPGDDPMLLAYLLDPSNTTLEGVARRYGGEWTEEAGERAALSERLFANLWGRLEGEERLLWLYREVERPLSAVLAHMEATGVRLDVAYLRALSLEVAEEIARLEAEVFRLAGHPFNLNSRDQLERVLFDELGLPAIGKTEKTGKRSTSAAVLEALREAHPIVEKILQYRELTKLKSTYIDPLPDLIHPRTGRLHTRFNQTATATGRLSSSDPNLQNIPVRTPLGQRIRRAFIAEEGWLLVALDYSQIELRVLAHLSGDENLIRVFQEGRDIHTETASWMFGVPREAVDPLMRRAAKTINFGVLYGMSAHRLSQELAIPYEEAQAFIERYFQSFPKVRAWIEKTLEEGRRRGYVETLFGRRRYVPDLEARVKSVREAAERMAFNMPVQGTAADLMKLAMVKLFPRLEEMGARMLLQVHDELVLEAPKERAEAVARLAKEVMEGVYPLAVPLEVEVGIGEDWLSAKE*。

[0070] Experiment 2: Construction of Recombinant Escherichia coli Engineering Bacteria with Taq DNA Polymerase Mutants and Expression, Isolation, and Purification of Taq DNA Polymerase

[0071] The specific steps are as follows:

[0072] (1) The recombinant plasmids pET-28a(+)-K314A / R37A, pET-28a(+)-K314A / P387L, and pET-28a(+)-K314A / R37A / P387L obtained in Experiment 1 were transformed into E. coli BL21 competent cells to prepare the following genetically engineered bacteria: E. coli BL21 / pET-28a(+)-polA, E. coli BL21 / pET-28a(+)-K314A / R37A, E. coli BL21 / pET-28a(+)-K314A / P387L, and E. coli BL21 / pET-28a(+)-K314A / R37A / P387L.

[0073] Among them, *E. coli* BL21 / pET-28a(+)-polA is the engineered bacterium expressing the wild-type Taq DNA polymerase shown in SEQ ID NO. 1. *E. coli* BL21 / pET-28a(+)-K314A / R37A is the engineered bacterium expressing the Taq DNA polymerase mutant shown in SEQ ID NO. 2. *E. coli* BL21 / pET-28a(+)-K314A / P387L is the engineered bacterium expressing the Taq DNA polymerase mutant shown in SEQ ID NO. 3. *E. coli* BL21 / pET-28a(+)-K314A / R37A / P387L is the engineered bacterium expressing the Taq DNA polymerase mutant shown in SEQ ID NO. 4.

[0074] (2) The genetically engineered bacteria prepared in step (1) were inoculated into 10 mL of LB liquid medium containing 50 µg / mL kanamycin sulfate and cultured overnight at 37 °C and 200 rpm to prepare seed culture.

[0075] The prepared seed culture was transferred to 100 mL of LB liquid medium containing 50 µg / mL kanamycin sulfate at an inoculation rate of 2% (v / v), and cultured at 30 °C for 20 h to obtain the fermentation broth. The fermentation broth was centrifuged at 8000×g and 4 °C for 5 min to obtain cell cells. After washing the cells three times, they were resuspended in 10 mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0).

[0076] The resuspended cells were treated with an ultrasonic disruptor under ice bath conditions for 30 min, centrifuged for 30 min (8000×g, 4℃), and the supernatant was discarded to obtain the crude enzyme solution.

[0077] The supernatant was filtered through a 0.22 µm filter and then loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM wash buffer (20 mM Tris and 500 mM NaCl, pH 7.4). Unbound proteins and Taq DNA polymerase were then eluted with elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4) using a linear gradient. Pure enzyme solutions containing wild-type Taq DNA polymerase, K314A / R37A, K314A / P387L, and K314A / R37A / P387L were prepared.

[0078] The purified enzyme solutions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and the results are as follows: Figure 1 As shown. Figure 1 In the diagram, lane M represents the marker, lane 1 is the wild-type Taq DNA polymerase shown in SEQ ID NO. 1, lane 2 is the Taq DNA polymerase mutant shown in SEQ ID NO. 2, lane 3 is the Taq DNA polymerase mutant shown in SEQ ID NO. 3, and lane 4 is the Taq DNA polymerase mutant shown in SEQ ID NO. 4.

[0079] Figure 1 The results showed a clear band at 94 kDa, proving that Taq DNA polymerase was expressed.

[0080] (3) Perform enzyme activity assay on the pure enzyme solution prepared in step (2).

[0081] The pure enzyme solution containing wild-type Taq DNA polymerase, the pure enzyme solution containing K314A / R37A, the pure enzyme solution containing K314A / P387L, and the pure enzyme solution containing K314A / R37A / P387L prepared in step (2) were tested respectively.

[0082] The designed primer sequences are as follows (all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.):

[0083] 236bp-F: TGGGCTTGAATAGTTAGATGCT (SEQ ID NO.11)

[0084] 236bp-R:GCCTTCGCCTGTCCTCAT (SEQ ID NO.12)

[0085] Plot a standard curve for the activity units of a known commercial Taq DNA polymerase (product name: Takara Ex Taq; catalog number: RR001Q) (e.g.) Figure 2 As shown in Table 1, the curves from the real-time fluorescence PCR instrument were exported, and the initial slope of each curve was analyzed using Origin software. The statistical results of the initial slope of the curves are shown in Table 1.

[0086] Table 1 Initial slope of DNA polymerase activity quantification curve

[0087] enzyme units Repeated trial 1 Repeated trial 2 Repeated Trial 3 average value 0.1U 767.32 779.36 773.58 773.42 0.05U 390.88 400.56 415.89 402.44 0.04U 275.55 286.45 290.37 284.12 0.03U 221.85 218.38 225.63 221.95 0.02U 140.37 133.18 154.89 142.81 0.01U 90.55 89.26 88.21 89.34 0U 0 0 0 0

[0088] Experiment 3: Resistance of Taq DNA polymerase mutants to human whole blood

[0089] This test example used quantitative real-time PCR to detect the anti-human whole blood inhibitory activity of Taq-wt, Taq-K314A / R37A, Taq-K314A / P387L, and Taq-K314A / R37A / P387L. Specifically, Taq-wt is the Taq DNA polymerase shown in SEQ ID NO.1, Taq-K314A / R37A is the Taq DNA polymerase mutant shown in SEQ ID NO.2, Taq-K314A / P387L is the Taq DNA polymerase mutant shown in SEQ ID NO.3, and Taq-K314A / R37A / P387L is the Taq DNA polymerase mutant shown in SEQ ID NO.4.

[0090] Using 5 ng of human cDNA as a template, 525 bp fragments were amplified using wild-type Taq DNA polymerase and various Taq DNA polymerase mutants. The 25 μL PCR reaction system consisted of: 1×PCR buffer, 2.5 mM MgCl2, 0.2 μM upstream primer, 0.02 μM downstream primer, 200 μM dNTPs, 0.4×SYBR Green, and 1 U of enzyme. The template concentration was 1 ng / μL, and 2 μL was loaded. Human whole blood was used in gradients of 0%, 5% (v / v), 10% (v / v), 15% (v / v), 20% (v / v), 30% (v / v), and 40% (v / v). The reaction program was: 95 ℃ for 30 s; then 45 cycles: 95 ℃ for 5 s, 60 ℃ for 30 s. After the reaction, the amplification curves were analyzed, and the reaction products were detected by electrophoresis using a 3% agarose gel. The nucleotide sequences of the primers used are as follows (all primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.):

[0091] 525bp-F: TTGGTGGAGGTATGTTTAGATTT (SEQ ID NO.13)

[0092] 525bp-R:TCGCCTGTCCTCATGTATTG (SEQ ID NO.14)

[0093] Experimental results are as follows Figure 3 Show. Figure 3 In the sequence, Taq-wt represents the amplification result of the Taq DNA polymerase shown in SEQ ID NO.1, Taq-K314A / R37A represents the amplification result of the Taq DNA polymerase mutant shown in SEQ ID NO.2, Taq-K314A / P387L represents the amplification result of the Taq DNA polymerase mutant shown in SEQ ID NO.3, and Taq-K314A / R37A / P387L represents the amplification result of the Taq DNA polymerase mutant shown in SEQ ID NO.4. Figure 3 The results showed that the Taq DNA polymerase shown in SEQ ID NO.1 only amplified samples of 0% (v / v) human whole blood, meaning it only amplified samples without human whole blood, and did not amplify samples of other serially diluted human whole blood. However, according to common sense, natural Taq DNA polymerase can generally amplify samples of 0.02% (v / v) human whole blood. The Taq DNA polymerase mutants shown in SEQ ID NO.2 and SEQ ID NO.3 amplified samples of 0, 5%, 10%, 15%, and 20% (v / v) human whole blood. The Taq DNA polymerase mutant shown in SEQ ID NO.4 amplified samples of 0, 5%, 10%, 15%, 20%, and 30% (v / v) human whole blood.

[0094] In summary, the Taq DNA polymerase mutant K314A / R37A in this example can amplify in the presence of 20% (v / v) human whole blood. Considering that the natural Taq DNA polymerase can only amplify 0.02% (v / v) of human whole blood samples, the Taq DNA polymerase mutant K314A / R37A exhibits 1000 times the tolerance of the natural Taq DNA polymerase in human whole blood. Similarly, the Taq DNA polymerase mutant K314A / P387L can amplify in the presence of 20% (v / v) human whole blood. Considering that the natural Taq DNA polymerase can only amplify 0.02% (v / v) of human whole blood samples, the Taq DNA polymerase mutant K314A / P387L exhibits 1000 times the tolerance of the natural Taq DNA polymerase in human whole blood. Furthermore, the polymerase mutant K314A / R37A / P387L can amplify in the presence of 30% (v / v) human whole blood. Based on the fact that the DNA polymerase can only amplify 0.02% (v / v) of human whole blood samples, the polymerase mutant K314A / R37A / P387L has 1500 times the tolerance of the natural Taq DNA polymerase to human whole blood. Therefore, the Taq DNA polymerase mutant in this case is more suitable than the wild type for PCR amplification of samples containing human whole blood, and is more conducive to the accuracy of result evaluation for samples containing human whole blood inhibitors.

[0095] The above description, in conjunction with specific embodiments, provides a further detailed explanation of this application and should not be construed as limiting the specific implementation of this application to these descriptions. Those skilled in the art to which this application pertains can make several simple deductions or substitutions without departing from the concept of this application.

Claims

1. A Taq DNA polymerase mutant, characterized in that: Obtained by performing K314A / R37A site mutation, K314A / P387L site mutation, or K314A / R37A / P387L site mutation on the sequence shown in SEQ ID NO. 1; The K314A / R37A site mutation involves changing lysine at position 314 of the Taq DNA polymerase, as shown in SEQ ID NO.1, to alanine, and changing arginine at position 37 to alanine. The K314A / P387L site mutation involves replacing lysine at position 314 with alanine and proline at position 387 with leucine in the Taq DNA polymerase sequence shown in SEQ ID NO.

1. The K314A / R37A / P387L site mutation involves changing lysine at position 314 of the Taq DNA polymerase (as shown in SEQ ID NO.1) to alanine, arginine at position 37 to alanine, and proline at position 387 to leucine.

2. The method for preparing the Taq DNA polymerase mutant according to claim 1, characterized in that: Includes the following steps; (1) Using the nucleic acid encoding the sequence shown in SEQ ID NO.1 as a template, according to the rationally designed mutation site, design site-directed mutation primers, perform PCR amplification to obtain the gene encoding the Taq DNA polymerase mutant, and construct a vector containing the gene encoding the Taq DNA polymerase mutant; (2) Transform the vector containing the gene encoding the Taq DNA polymerase mutant into the host cell; (3) Screen and verify the recombinant cells constructed in the previous step to obtain positive clones. Culture and ferment the positive clones. After fermentation, collect the cells by centrifugation, break the cells, and separate and purify the Taq DNA polymerase mutant.

3. A nucleic acid, characterized in that: Used to encode the Taq DNA polymerase mutant of claim 1.

4. A recombinant vector, characterized in that: It contains a gene encoding the Taq DNA polymerase mutant of claim 1.

5. The recombinant vector according to claim 4, characterized in that: The recombinant vector used was pET-28a(+) as the expression vector.

6. A recombinant cell, characterized in that: Carrying the nucleic acid as described in claim 3 or the recombinant vector as described in claim 4 or 5.

7. A genetically engineered bacterium, characterized in that: Used to express the Taq DNA polymerase mutant of claim 1.

8. The genetically engineered bacteria according to claim 7, characterized in that: The genetically engineered bacteria use Escherichia coli as a host.

9. The use of the Taq DNA polymerase mutant of claim 1 in PCR amplification of whole blood samples or samples containing whole blood.

10. A kit for PCR amplification of whole blood samples or samples containing whole blood, characterized in that: Contains the Taq DNA polymerase mutant as described in claim 1.

Images