Application of SlSWEET 5b gene in maintaining pollen viability of tomato under weak light stress

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of an SlSWEET 5b gene in maintaining pollen viability of tomatoes under weak light stress. The Solyc06g071400 member of the tomato SWEET family has a key regulation and control effect on carbohydrate metabolism and transportation in the pollen development process under the stress of weak light. Specifically, the function deletion (such as sw5b-18, sw5b-22 and sw5b-24 mutants) of the gene can obviously reduce the pollen activity, which indicates that the gene is indispensable in maintaining the normal physiological function of the pollen. The discovery not only reveals a new function of the SlSWEET family member in reproductive development of tomato, but also provides an important clue for analyzing a molecular mechanism of crop fertility decline under weak light stress.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to the application of the SlSWEET 5b gene in maintaining pollen viability in tomatoes under low light stress. Background Technology

[0002] Tomato (Solanum lycopersicum L.) is an annual herbaceous plant belonging to the genus Solanum in the family Solanaceae. Native to South America, it is widely cultivated worldwide and has become an important global vegetable crop, holding a significant position in my country's agricultural production. Tomatoes are rich in lycopene, vitamin C, carotene, and other nutrients, possessing extremely high nutritional value and significant antioxidant effects, playing a vital role in maintaining human health. Statistics show that in 2021, my country's tomato production accounted for one-third of global tomato production, and its greenhouse cultivation area ranked first. However, as a light-loving crop, tomatoes inevitably encounter low-light environments during greenhouse cultivation, affecting their growth and development, ultimately leading to flower and fruit drop and reduced yield.

[0003] Tomato (Solanum lycopersicum L.) plants are highly sensitive to low light at all stages of development, especially in the early seedling stages. Light is a significant external factor influencing inflorescence abscission. Plants are capable of shedding their vegetative and reproductive organs in response to developmental signals and environmental stimuli. While this abscission process offers many adaptive benefits, in agricultural environments, premature abscission can lead to significant reductions in crop productivity, such as fruit set failure. Abscission is a highly regulated process involving structural, biochemical, and molecular changes, with the tissue of the abscission organ known as the abscission zone (AZ). These changes include protein degradation, cell wall remodeling, dissolution of the middle lamellar layer, loss of cell membrane permeability, and programmed cell death. Low light stress is the most important factor limiting plant growth and crop yield in winter and spring, inhibiting photosynthesis, inducing oxidative stress, and causing various metabolic changes.

[0004] Under low light stress, tomatoes are primarily affected during plant growth and development. Chloroplasts swell, chloroplast membranes are severely damaged, photosynthetic systems are disrupted, and ROS accumulate, damaging the antioxidant system. This further impacts the growth and development of tomato inflorescences, reducing nutrient access to reproductive organs. At this point, the tomato plant sheds its reproductive organs based on developmental signals and environmental stimuli. A series of changes occur in the cells of the abscission zone, such as protein degradation, cell wall remodeling, dissolution of the middle lamellar layer, loss of cell membrane permeability, and programmed cell death, ultimately leading to premature abscission of tomato flower organs and severely impacting tomato yield.

[0005] Current research on low light stress in tomatoes, both domestically and internationally, has not focused on its impact on anther development. Therefore, this study aims to investigate the phenomenon that tomatoes under low light stress cannot meet the nutritional needs of anther development, leading to deliberate flower drop. This research has important theoretical and applied value for promoting the cultivation of low-light tolerant varieties in tomatoes and other plants. Summary of the Invention

[0006] Based on the aforementioned deficiencies in the existing technology, the present invention first provides a primer pair for targeted knockout of Solyc06g071400.

[0007] This invention also provides the application of Solyc06g071400 in maintaining pollen viability in tomatoes under low light stress.

[0008] This invention also provides the application of Solyc06g071400 in the development and / or screening of products for enhancing pollen viability in tomatoes under low light stress.

[0009] The objective of this invention is achieved through the following technical solution:

[0010] This invention, through transcriptome data analysis, revealed significant differences in the transcriptional levels of Solyc06g071400 (NCBI No.: IPR018179), a member of the SlSWEET gene family, with expression levels far exceeding those of other genes during mature pollen development (expression level 2946 in the control group and 4453 in the low-light group). Based on this, we hypothesize that it plays a crucial role in pollen development. Therefore, we obtained transgenic plants using CRISPR / Cas9 technology and derived three mutants (sw5b-18, sw5b-22, and sw5b-24).

[0011] The mutants sw5b-18 (52 bp deletion), sw5b-24 (182 bp deletion), and sw5b-22 (55 bp deletion) resulted in severe disruption of gene function and a significant reduction in pollen viability, indicating that this gene plays a crucial role in pollen development and viability maintenance.

[0012] Therefore, the present invention first provides primer pairs for targeted knockout of Solyc06g071400, namely primer pair 1 and primer pair 2, wherein the sequence of primer pair 1 is shown as SEQ ID NO:1-2 and the sequence of primer pair 2 is shown as SEQ ID NO:3-4.

[0013] This invention also provides the application of Solyc06g071400 in maintaining pollen viability in tomatoes under low light stress.

[0014] This invention also provides the application of Solyc06g071400 in the development and / or screening of products for enhancing pollen viability in tomatoes under low light stress.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] Members of the SWEET family in tomato, specifically the Solyc06g071400 gene, play a crucial regulatory role in carbohydrate metabolism and transport during pollen development under low light stress. Specifically, loss of function of this gene (e.g., sw5b-18, sw5b-24, and sw5b-22 mutants) significantly reduces pollen viability, indicating its indispensable role in maintaining normal pollen physiological function. This discovery not only reveals a novel function of SlSWEET family members in tomato reproductive development but also provides important clues for elucidating the molecular mechanisms underlying crop fertility decline under low light stress. Attached Figure Description

[0017] Figure 1 Phenotypic observation of tomato anthers at different stages and light levels in the experimental section; (A) Light levels in the experimental section (light levels at 12:30 on the same day); (B) Phenotypic examples of tomato anthers at different stages (pollen mother cell stage: Mes, tetrad stage: Ts, uninucleate stage: UNs, binucleate stage: BNs, mature pollen stage: Ms), bar: 10 mm;

[0018] Figure 2 The values ​​represent the fructose, glucose, sucrose, and total sugar content in mature anthers and leaves under different treatments, as well as the photosynthetic characteristics of leaves. (AD) represents the fructose, glucose, sucrose, and total sugar content in mature tomato anthers, respectively; (EH) represents the fructose, glucose, sucrose, and total sugar content in tomato leaves, respectively; (IL) represents the net photosynthetic rate (Pn), transpiration rate (Tr), intercellular carbon dioxide concentration (Ci), and stomatal conductance (Gs) in tomato leaves, respectively; CK: control group; LL: low light group; LS: low light + exogenous sucrose group. Values ​​are presented as mean ± standard deviation; ns: no significance; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001;

[0019] Figure 3 This study identifies the main carbohydrate and lipid biosynthetic pathways during the Ts stage of tomato anther development under low light stress, including sucrose and starch metabolism, glycolysis, glycerol and phospholipid metabolism, fatty acid biosynthesis, and fatty acid degradation. Heatmap: Red indicates high expression, blue indicates low expression.

[0020] Figure 4A heatmap showing the expression of sugar transport-related gene families in tomato anthers under low light stress, based on differential expression analysis. Red indicates upregulation, and blue indicates downregulation. CK-Mes: Pollen mother cell stage in the control group; LL-Mes: Pollen mother cell stage in the low light group; CK-Ts: Tetrad stage in the control group; LL-Ts: Tetrad stage in the low light group; CK-UNs: Mononuclear stage in the control group; LL-UNs: Mononuclear stage in the low light group; CK-BNs: Binuclear stage in the control group; LL-BNs: Binuclear stage in the low light group; CK-Ms: Mature pollen stage in the control group; LL-Ms: Mature pollen stage in the low light group.

[0021] Figure 5 The image shows the pollen activity assay for the sw5b mutant; A is a schematic diagram of the gene sequence of the mutant material Solyc06g071400; BF are the pollen activity identification diagrams of the control group, the low light group, and each mutant material, respectively; G is the quantitative statistical result of pollen activity. Detailed Implementation

[0022] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific drawings and embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0023] Example 1: Comparison of anther and leaf sugar content and photosynthetic characteristics under low light stress

[0024] The tomato variety (Solanum lycopersicum L.) used was M82, and all seeds were planted at the Guangdong Ocean University Forestry and Fruit Base in Zhanjiang City, Guangdong Province, China. The experiment was conducted from 2024 to 2025. Germination of the experimental materials began on September 2, 2024 (M82 seeds were surface-sterilized with 4% (w / v) NaClO solution for 30 min, rinsed three times with sterile deionized water, and then germinated in petri dishes). Seedlings with uniform germination potential were selected and transplanted into non-woven bags containing substrate (Novarbo, Finnish Biolan Group) and cultivated in a greenhouse. When the plants entered reproductive growth, they were subjected to low-light treatment (shading nets were used to simulate low-light conditions in this experiment; some light conditions are detailed in [link to relevant documentation]). Figure 1A). This experiment set up three treatment groups (n = 30 plants per group): the control group (CK) grew under normal light conditions, the low-light group (LL) grew under shade netting, and the low-light + exogenous sucrose group (LL+S) grew under shade netting with exogenous sucrose added (exogenous sucrose was applied to the leaves once a day at a concentration of 0.02% (w / v), with 0.001% (v / v) Tween 20 added). The control group was sprayed with the same concentration of Tween 20 + distilled water. After 10 days of treatment, tomato anthers and leaves at different developmental stages were collected, flash-frozen in liquid nitrogen, and then transferred to an ultra-low temperature freezer at -80℃ for later use. Tomato anther sampling is based on the length of the anther tube to distinguish different stages (pollen mother cell stage (Mes): 2-2.5 mm; tetrad stage (Ts): 3-3.5 mm; uninucleate stage (UNs): 4-4.5 mm; binucleate stage (BNs): 6 mm; mature pollen stage (Ms): 9 mm; see details). Figure 1 B).

[0025] The results are as follows Figure 2 As shown, LL treatment significantly reduced the content of fructose, glucose, and total sugar in tomato anthers ( Figure 2 A, B, and D). The fructose content in the control group (CK) was approximately 6 mg / g, decreasing to approximately 4 mg / g under low light treatment, and recovering to approximately 6 mg / g after LS treatment; the glucose content in the CK was 6.5 mg / g, decreasing to 3 mg / g under LL treatment, and recovering to 5.5 mg / g after LS treatment; the total sugar content in the CK was 15 mg / g, decreasing to 10 mg / g under LL treatment, and recovering to 13 mg / g after LS treatment. In contrast, there was no significant difference in sucrose content among the three groups of anthers. Figure 2 (C) indicates that weak light treatment has no significant effect on the sucrose content of tomato anthers, while weak light + exogenous sucrose treatment can effectively restore the inhibitory effect of weak light treatment on fructose, glucose and total sugar.

[0026] On the other hand, low light treatment also significantly inhibited the accumulation of fructose, glucose, sucrose and total sugar in tomato leaves. Figure 2The fructose content in the control group (CK) was approximately 6 mg / g, decreasing to 4 mg / g after low light treatment, and recovering to 8 mg / g after LS treatment. The glucose content in the CK was 6 mg / g, decreasing to 3 mg / g in the low light treatment group, and recovering to 8 mg / g after LS treatment. The sucrose content in the CK was 3.5 mg / g, decreasing to 1.5 mg / g in the low light treatment group, and recovering to 2.5 mg / g after LS treatment, but there was no significant difference compared to the LL treatment. The total sugar content in the CK was 16 mg / g, decreasing to 10 mg / g after low light treatment, and recovering to 17 mg / g after LS treatment. This indicates that LS treatment can effectively restore the fructose, glucose, and total sugar content in tomato leaves, but its effect on sucrose recovery is not significant.

[0027] In addition, in the results of photosynthetic characteristics of tomato leaves ( Figure 2 Low light treatment significantly reduced the net photosynthetic rate (Pn) and intercellular CO2 concentration (Ci) in leaves. Figure 2 I and K). The net photosynthetic rate in CK was 47.46 μmol·m⁻²·s⁻¹, which decreased to approximately 28.58 μmol·m⁻²·s⁻¹ after low light treatment, and only recovered to 30.01 μmol·m⁻²·s⁻¹ after LS treatment (no significant difference from LL treatment); the intercellular CO₂ concentration in CK was 2997.35 μmol·m⁻²·s⁻¹, which decreased to 686.66 μmol·m⁻²·s⁻¹ in the LL group, and showed no significant improvement after LS treatment. Transpiration rate (Tr) and stomatal conductance (Gs) showed no significant differences among the treatments. Figure 2 The J and L treatments indicate that low light treatment mainly affects leaf photosynthesis by inhibiting photosynthetic carbon metabolism rather than stomatal limitation, and that the LS treatment has a limited effect on restoring photosynthetic characteristics.

[0028] Example 2: Analysis of major carbohydrate and lipid biosynthetic pathways during the Ts stage of tomato anther development under low light stress

[0029] Transcriptome sequencing results showed that differentially expressed genes (DEGs) were most abundant during the Ts stage, indicating that the Ts stage is the period when anther development is most sensitive to low light stress. To further clarify whether tomato anthers during the Ts stage are in a state of "defense activation but basic physiological suppression" under low light stress, we enriched six sugar and carbohydrate metabolism and lipid synthesis pathways through KEGG analysis, including Starch and sucrose metabolism, Glycolysis / Gluconeogenesis, Glycerophospholipid metabolism, Glycerolipid metabolism, Fatty acid biosynthesis, and Fatty acid degradation. These pathways underwent systematic remodeling, revealing the profound impact of low light stress on the basic physiological activities of tomato anthers. Specifically, in the starch and sucrose metabolic pathways, 23 differentially expressed genes (DEGs) were upregulated and 30 were downregulated under low light conditions. The significant downregulation of genes related to starch degradation (A50-A52) and UDP-glucose conversion (A6-A8) directly inhibited carbohydrate synthesis and turnover, leading to insufficient carbon source supply. The upregulation of some genes related to sucrose degradation (A12-A18) may be a response of the anthers attempting to replenish carbon sources by breaking down stored sucrose. This bidirectional regulation reflects the adjustment of carbon source allocation in tomato anthers under low light stress, while simultaneously exacerbating the energy supply imbalance. In the glycolysis metabolic pathway, 7 differentially expressed genes were upregulated and 41 were downregulated under low light conditions. Significant downregulation of multiple key enzyme genes throughout the entire process from α-D-Glucose-1P to Acetyl-CoA directly weakened the rate of glycolysis, leading to insufficient ATP production and a significant decrease in the energy supply capacity for anther development.In the glycerophospholipid metabolic pathway, 15 DEGs were upregulated and 8 were downregulated under low light conditions. Key genes involved in phosphatidylserine synthesis (D2-3, D5-D6) were significantly upregulated, promoting the de novo synthesis of membrane phosphatidylserine and other phosphatidylserines. In the glycerol metabolic pathway, 19 DEGs were upregulated and 23 were downregulated under low light conditions. Genes related to triacylglycerol synthesis (C36-C38) were significantly upregulated, accelerating the accumulation of energy-storing lipids. In the fatty acid biosynthesis pathway, 9 DEGs were upregulated and 25 were downregulated under low light conditions, showing an overall inhibitory effect on synthesis. Key genes catalyzing the conversion of acetyl-CoA to malonyl-CoA (E2-E5, E7) were significantly downregulated, directly limiting the carbon source supply for fatty acid synthesis. 3-O-acyl-ACP... Core genes involved in fatty acid synthesis (E10-E12, E14-E15) and long-chain fatty acid synthesis (E21-E22) were significantly downregulated, inhibiting the elongation of fatty acid carbon chains and leading to insufficient long-chain fatty acid synthesis. In the fatty acid degradation pathway, under weak light stress, 13 DEGs were upregulated and 9 DEGs were downregulated, indicating an overall activated fatty acid degradation state. Several genes related to the breakdown of long-chain fatty acids (F1-F4, F6-8) were significantly upregulated, accelerating the catabolism of long-chain fatty acids.

[0030] Table 1 KEGG Corresponding Pathway Sequence Numbers and Gene IDs

[0031] Serial Number Gene ID Serial Number Gene ID Serial Number Gene ID Serial Number Gene ID A1 Solyc09g098590 A52 Solyc06g009220 C9 Solyc09g011240 D18 Solyc09g020190 A2 Solyc03g098290 A53 Solyc04g053120 C10 Solyc10g054280 D19 Solyc03g019670 A3 Solyc07g042520 B1 Solyc08g066100 C11 Solyc03g117490 D20 Solyc01g008790 A4 Solyc07g042550 B2 Solyc04g015200 C12 Solyc07g056320 D21 Solyc10g074700 A5 Solyc12g009300 B3 Solyc04g072580 C13 Solyc09g014350 D22 Solyc05g046300 A6 Solyc11g011960 B4 Solyc07g045160 C14 Solyc01g094700 D23 Solyc04g072020 A7 Solyc05g054060 B5 Solyc11g010450 C15 Solyc04g011600 E1 Solyc01g094340 A8 Solyc07g037960 B6 Solyc07g065900 C16 Solyc08g076470 E2 Solyc12g056940 A9 Solyc04g009630 B7 Solyc01g110360 C17 Solyc08g080340 E3 Solyc09g013080 A10 Solyc02g069670 B8 Solyc02g062340 C18 Solyc04g079880 E4 Solyc06g069530 A11 Solyc10g085640 B9 Solyc10g083570 C19 Solyc11g065890 E5 Solyc01g008330 A12 Solyc10g085360 B10 Solyc05g008600 C20 Solyc10g079410 E6 Solyc00g500065 A13 Solyc10g085650 B11 Solyc09g009260 C21 Solyc10g079110 E7 Solyc05g056290 A14 Solyc03g121680 B12 Solyc03g111010 C22 Solyc01g109370 E8 Solyc01g006980 A15 Solyc10g083290 B13 Solyc05g005820 C23 Solyc12g056420 E9 Solyc03g097470 A16 Solyc09g010090 B14 Solyc06g071920 C24 Solyc10g079770 E10 Solyc07g042315 A17 Solyc03g083910 B15 Solyc05g014470 C25 Solyc07g005580 E11 Solyc08g082620 A18 Solyc10g083300 B16 Solyc07g066610 C26 Solyc09g005910 E12 Solyc12g009260 A19 Solyc09g010080 B17 Solyc07g066600 C27 Solyc10g084540 E13 Solyc03g122120 A20 Solyc08g079080 B18 Solyc09g008130 C28 Solyc04g025400 E14 Solyc08g016170 A21 Solyc02g091830 B19 Solyc04g072800 C29 Solyc02g086370 E15 Solyc02g070790 A22 Solyc11g065220 B20 Solyc07g044840 C30 Solyc04g079100 E16 Solyc06g071070 A23 Solyc06g066440 B21 Solyc10g085550 C31 Solyc05g008810 E17 Solyc06g071060 A24 Solyc03g121070 B22 Solyc03g114500 C32 Solyc05g008820 E18 Solyc06g071910 A25 Solyc12g008510 B23 Solyc09g009020 C33 Solyc12g005380 E19 Solyc08g008430 A26 Solyc04g081400 B24 Solyc09g008840 C34 Solyc07g054830 E20 Solyc01g105060 A27 Solyc11g042850 B25 Solyc11g007690 C35 Solyc07g041210 E21 Solyc01g006450 A28 Solyc10g017620 B26 Solyc01g106780 C36 Solyc03g121960 E22 Solyc10g078740 A29 Solyc02g091490 B27 Solyc08g077180 C37 Solyc06g074680 E23 Solyc03g097390 A30 Solyc06g073190 B28 Solyc01g049650 C38 Solyc06g062870 E24 Solyc11g018580 A31 Solyc03g006860 B29 Solyc04g008590 C39 Solyc11g066710 E25 Solyc12g009040 A32 Solyc04g076090 B30 Solyc05g024160 C40 Solyc03g098020 E26 Solyc09g092450 A33 Solyc03g006870 B31 Solyc12g009400 C41 Solyc02g086040 E27 Solyc09g075770 A34 Solyc04g045340 B32 Solyc12g009410 C42 Solyc02g069930 E28 Solyc08g082280 A35 Solyc12g011120 B33 Solyc06g072580 D1 Solyc02g068240 E29 Solyc08g008310 A36 Solyc07g056140 B34 Solyc08g016750 D2 Solyc12g008970 E30 Solyc01g109180 A37 Solyc01g079790 B35 Solyc05g006520 D3 Solyc01g098110 E31 Solyc01g079240 A38 Solyc01g109790 B36 Solyc02g077240 D4 Solyc12g098850 E32 Solyc01g099100 A39 Solyc02g088000 B37 Solyc10g076510 D5 Solyc07g040740 F1 Solyc10g008110 A40 Solyc03g083090 B38 Solyc06g082130 D6 Solyc09g083330 F2 Solyc10g085200 A41 Solyc08g083320 B39 Solyc09g005110 D7 Solyc06g060780 F3 Solyc01g066310 A42 Solyc08g082810 B40 Solyc05g009530 D8 Solyc04g007520 F4 Solyc05g054370 A43 Solyc07g052690 B41 Solyc11g017250 D9 Solyc05g008580 F5 Solyc07g019670 A44 Solyc08g077530 C1 Solyc03g120430 D10 Solyc10g038170 F6 Solyc12g007170 A45 Solyc08g007130 C2 Solyc03g114150 D11 Solyc02g068920 F7 Solyc01g066620 A46 Solyc02g066950 C3 Solyc02g086970 D12 Solyc01g100020 F8 Solyc12g099440 A47 Solyc03g095710 C4 Solyc03g122310 D13 Solyc04g082000 F9 Solyc09g091470 A48 Solyc04g078930 C5 Solyc05g005700 D14 Solyc10g017650 F10 Solyc09g061840 A49 Solyc05g007070 C6 Solyc06g060250 D15 Solyc03g116620 F11 Solyc04g015100 A50 Solyc07g014590 C7 Solyc01g01151( D16 Solyc02g061850 F12 Solyc05g017760 A51 Solyc09g064800 C8 Solyc02g084640 D17 Solyc08g066800 F13 Solyc07g045350

[0032] These findings suggest that tomato anthers under low light stress may alleviate the aforementioned "basal physiological depression" by breaking down stored lipids, partially mitigating energy deficiency caused by inhibited glucose metabolism. This regulatory pattern of "inhibiting synthesis and activating degradation" reflects the energy metabolism remodeling of anthers under stress, representing an adaptive response to maintain basic cellular functions.

[0033] Furthermore, in the previous analysis, the glycolytic metabolic pathway was significantly inhibited, and we further analyzed the differential expression of glucose transport-related genes in the transcriptome. Figure 4 The heatmap shows the changes in expression patterns of eight gene families (VIN, SWEET, SUT, SPS, MST, INVCW, CWIN, CIN) in tomato anthers under five developmental stages (Mes, Ts, UNs, BNs, Ms), low light (LL), and control (CK) treatments.

[0034] 1. Overall expressive characteristics

[0035] Developmental stage specificity: Gene expression patterns show significant dynamic changes as anthers develop, with the most significant differences observed in the Ms stage (pollen maturation stage), while expression fluctuations are relatively gradual in the Mes stage (early stage).

[0036] The gradual nature of the low light response: The regulatory effect of low light on sugar transport genes gradually increases with the developmental process. In the UNs to Ms stage, the expression difference between LL and CK treatments is significantly amplified, reflecting that the effect of low light stress on sugar metabolism in the middle and late stages of anthers is more prominent.

[0037] 2. Corresponding patterns of key gene families

[0038] The MST (monosaccharide transporter) family: As the largest gene family, its members exhibit diverse expression responses at different developmental stages. Some genes are significantly upregulated during the UNs and BNs stages, while others are significantly downregulated during the Ms stage, revealing the dynamic regulation of monosaccharide transport in anther development.

[0039] CWIN (cell wall invertase) and VIN (vacuole invertase) family: During Ts and Ms phases, some genes were significantly downregulated under LL treatment, indicating that weak light inhibited the extracellular and intravacuole degradation of sucrose, which may directly affect carbon source supply and distribution.

[0040] SWEET and SUT (sucrose transporter) family: The expression changes of its members under LL treatment show bidirectional regulation, with some genes being significantly upregulated in the Ms phase, which may be a compensatory response of the anthers in an attempt to enhance sucrose transport to compensate for insufficient carbon sources.

[0041] The dynamic expression changes of these sugar transport and metabolism genes reveal the mechanism of sugar metabolism remodeling in tomato anthers under low light stress:

[0042] The slight fluctuations in the early stages (Mes-Ts) indicate that the anthers respond mildly to low light in the early stages of development.

[0043] The significant differences between the mid-to-late stages (UNs-Ms) reflect the anthers' sensitive response to low light during the peak carbon source demand phase.

[0044] This regulation is highly consistent with the conclusions of "inhibition of glucose metabolism and insufficient energy supply" in previous metabolic pathway analyses, providing key transport-level evidence for elucidating the molecular mechanism of decreased pollen activity under weak light stress.

[0045] Example 3: Mutant Acquisition and Phenotypic Identification

[0046] Transcriptome data revealed significant differences in the transcriptional levels of Solyc06g071400 (NCBI number: IPR018179), a member of the SlSWEET gene family, with expression levels far exceeding those of other genes during mature pollen development (2946 in the control group and 4453 in the low-light group). Based on this, we hypothesize its important role in pollen development. Therefore, we obtained transgenic plants using CRISPR / Cas9 technology and derived three mutants (sw5b-18, sw5b-22, and sw5b-24). Firstly, in Sol Genomics Network Download the gene sequence of Solyc06g071400 and use it. http: / / crispr.hzau.edu.cn / CRISPR2 / It seems there is a small error in the original text where "Solyc01g01151( " should probably be "Solyc01g011510 ". I've translated it as best as possible with the given text. The website allows for online target design. Target length is 20 bp. Target locations must avoid conservative structural domains, and the distance between two eight-point targets must not exceed 800 bp (Target 1: GTGTCTGGATCTACACCACTAGGA, target 2: AGAAGAGGAAGATTCTTGTCCCCA Primers were designed based on the target sequence (see Table 2), and a complete editing vector map was constructed. Using the pDIRECT 22C vector, the corresponding fragment was amplified by PCR (Bio-Rad), and ligated using T4 DNA ligase, Bsa I, and Sap I. The ligation was then performed into *E. coli* (DH5α), and after sequencing and alignment confirmation, the fragment was transferred into *Agrobacterium* (GV3101), and finally infected into tomato (M82) to cultivate tissue culture seedlings. Positive identification was performed on the tissue culture seedlings. After confirming positive plants, editing identification was performed using primers for the corresponding gene (positive identification and editing identification primers are shown in Table 3). Mutant materials were obtained by comparing the sequencing results.

[0047] Table 2. Sequences of fragments corresponding to the constructed vectors

[0048] Excerpt forward primer reverse primer 1 TGCTCTTCGCGCTGGCAGACATACTGTCCCAC TGGTCTCCGTGTCTGGATCTCTGCCTATACGGCAGTGAAC 2 TGGTCTCAACACCACTAGGAGTTTTAGAGCTAGAAATAGC TGGTCTCCAGAAGAGGAAGACTGCCTATACGGCAGTGAAC 3 TGGTCTCATTCTTGTCCCCAGTTTTAGAGCTAGAAATAGC TGCTCTTCTGACCTGCCTATACGGCAGTGAAC

[0049] Table 3. Primer sequences for positive identification and editing.

[0050] forward primer reverse primer Positive identification GGAGAACCAGCTGTTGTTCCACAT TCTGGTAGCCTCAGCAGTTTCACCA Editor's Review ACCATGCATGTGCAATTGTTT CTGGACAAATGTTGGCCTGC

[0051] The results of the mutation materials are as follows Figure 5As shown, this gene contains 5 exons (exon 1–exon 5). Compared to the wild-type (WT), sw5b-18: a large deletion (52 bp) occurs after the 180th base of exon 1, resulting in the loss of subsequent coding sequences, potentially leading to truncated or non-functional proteins. sw5b-22: a deletion (55 bp) occurs after the 178th base of exon 1, causing a complete change in the subsequent amino acid sequence, which may lead to loss of protein function. sw5b-24: a large deletion (182 bp) occurs starting at the start base of exon 1, with the deleted bases accounting for 76% of exon 1, covering the key coding region of exon 1, resulting in significant changes in gene structure and function.

[0052] In the observation of pollen morphology and staining: CK (control group): pollen morphology was full, with fewer unstained pollen grains, indicating high activity. LL (treatment group): pollen staining was significantly lower than CK. In mutants (sw5b-18, sw5b-22, sw5b-24): compared with the control group, the number of unstained pollen grains increased significantly, indicating a significant decrease in pollen activity. Further statistical analysis of pollen viability revealed that: CK: pollen viability was approximately 90%, the highest level. LL: pollen viability was approximately 85%, significantly lower than CK. sw5b-18: pollen viability was approximately 75%, significantly lower than CK and LL. sw5b-22: pollen viability was approximately 70%, significantly lower than CK and LL. sw5b-24: pollen viability was approximately 80%, significantly lower than the CK group and close to the LL group.

[0053] In summary, sw5b-18 (52 bp deletion) and sw5b-22 (55 bp deletion) severely disrupt gene function and significantly reduce pollen viability, indicating that this gene plays a crucial role in pollen development and viability maintenance. sw5b-24 (182 bp deletion) has a smaller impact on gene function, and pollen viability is close to that of the wild type, suggesting that this deleted region may not be a core region of gene function, or that a functional compensation mechanism exists.

[0054] Based on the above results, we believe that members of the SWEET family, specifically the Solyc06g071400 gene, play a crucial regulatory role in carbohydrate metabolism and transport during pollen development under low light stress. Specifically, loss of function of this gene (e.g., sw5b-18 and sw5b-22 mutants) significantly reduces pollen viability, indicating its indispensable role in maintaining normal pollen physiological function. This discovery not only reveals a novel function of SlSWEET family members in tomato reproductive development but also provides important clues for elucidating the molecular mechanisms underlying crop fertility decline under low light stress.

Claims

1. A primer pair for targeted knockout of Solyc06g071400, characterized in that, The primer pairs are primer pair 1 and primer pair 2, the sequence of primer pair 1 is shown in SEQ ID NO:1-2, and the sequence of primer pair 2 is shown in SEQ ID NO:3-4.

2. Application of Solyc06g071400 in maintaining pollen viability in tomatoes under low light stress.

3. Application of Solyc06g071400 in the development and / or screening of products for enhancing pollen viability in tomatoes under low light stress.

Images