Equipment-independent nucleic acid detection method and detection device

Abstract

The invention belongs to the technical field of medical detection equipment, and particularly discloses a nucleic acid detection device. The device comprises a pathogen enrichment unit which is configured to enrich pathogens in a sample to be detected and comprises a sample pool and an enrichment part; the nucleic acid extraction unit is communicated with the pathogen enrichment unit, comprises a nucleic acid releasing agent chamber in which a nucleic acid releasing agent is preset, and is configured to release and dissolve the nucleic acid of the pathogen enriched by the enrichment part; the hybridization sample preparation unit is communicated with the nucleic acid extraction unit and is configured to prepare a single-stranded nucleic acid sample to be hybridized; and the hybridization and detection result display unit is communicated with the hybridization sample preparation unit and is configured to hybridize the single-stranded nucleic acid sample to be hybridized and display a detection result. On the basis of relatively high precision and accuracy, the self-inspection of the viruses and bacteria by the user can be realized without depending on laboratory environment and equipment and having operation speciality.

Description

Technical Field

[0001] This invention belongs to the field of medical testing technology, and in particular relates to a nucleic acid testing method and device that does not rely on equipment. Background Technology

[0002] Nucleic acid testing, as a core technology for accurately identifying pathogens (such as viruses, bacteria, mycoplasma, and chlamydia), diagnosing genetic diseases, and guiding clinical treatment, is widely used to address various practical clinical needs. Nucleic acid testing technologies typically include real-time quantitative PCR, nucleic acid hybridization, isothermal amplification, and precise quantitative and low-load cell detection technologies. However, some of these technologies are highly dependent on laboratory equipment, environment, and operational expertise. While some technologies can be performed through simple and rapid self-testing methods, they lack accurate typing and have low sensitivity, leading to inaccurate results.

[0003] Therefore, there is an urgent need for a nucleic acid detection method and device that can enable users to self-test for pathogens with high precision and accuracy, without relying on laboratory environment and equipment, and without requiring professional operation skills.

[0004] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to provide a nucleic acid detection method and device that does not rely on equipment. This method allows users to self-test for pathogens without relying on laboratory environment and equipment, and without requiring specialized operational skills, while maintaining high precision and accuracy. Details are as follows: This invention provides a nucleic acid detection method, comprising: S1 Nucleic Acid Extraction Step: A liquid sample is passed through an enrichment membrane, whereby pathogens in the liquid sample are enriched on the surface of the enrichment membrane. Then, a nucleic acid releasing agent is brought into contact with the pathogens enriched on the surface of the enrichment membrane, so that the nucleic acids of the pathogens are released into the nucleic acid releasing agent, thereby obtaining a nucleic acid extract. S2 Nucleic Acid Amplification Step: The nucleic acid extraction solution is mixed with ERA basic reagents and primer mixture to form a nucleic acid amplification system, and the microenvironment temperature of the nucleic acid amplification system is maintained at 38-42℃. The reaction is allowed to stand to obtain nucleic acid amplification products. The primer mixture includes restriction primers and non-restriction primers, and the molar concentration ratio of the restriction primers to the non-restriction primers is 1:20~30. The non-restriction primers are labeled with biotin. S3 Hybridization and Detection Result Visualization Steps: The nucleic acid amplification product is mixed with the hybridization solution to obtain a nucleic acid hybridization solution. The nucleic acid hybridization solution is hybridized with the nucleic acid probes immobilized on the hybridization membrane. After hybridization, the nucleic acid hybridization solution is removed. Then, an avidin-chromogenic enzyme solution is used to contact the hybridization membrane to allow avidin to bind with biotin. Unreacted avidin-chromogenic enzyme is removed. A chromogenic substrate is then used to contact the hybridization membrane. The chromogenic enzyme catalyzes the chromogenic substrate to develop color, thereby revealing the nucleic acid probe positions of the hybridized target pathogen nucleic acid.

[0006] Specifically, the enrichment membrane has a porous structure with pore sizes smaller than the diameter of the pathogens in the sample to be tested, or smaller than the diameter of the pathogen carrier, enabling it to retain cells, bacteria, and mycoplasma, thereby achieving pathogen enrichment. The enrichment membrane can be made of materials such as cellulose acetate membranes, nylon membranes, and silicone membranes. The specific pore size of the enrichment membrane can be determined according to the size of the pathogen being detected, generally within the range of 0.05 μm to 0.25 μm, preferably 0.1 μm. Even smaller pore sizes, smaller than the diameter of nucleic acids, can be used to enrich the extracted nucleic acids on one side of the filter membrane, facilitating subsequent processing in detection.

[0007] In one embodiment of the present invention, the extraction efficiency can be improved by repeatedly passing the nucleic acid releasing agent through the enrichment membrane, allowing the nucleic acid releasing agent to fully contact the pathogen. According to preliminary experimental results, the nucleic acid extraction efficiency will not continue to improve after passing through the enrichment membrane more than 10 times. Therefore, the number of times the nucleic acid releasing agent repeatedly passes through the enrichment membrane can be 2-10 times, preferably 3-8 times, and more preferably 5-6 times.

[0008] In one embodiment of the present invention, the avidin-chromogenic enzyme is streptavidin-labeled horseradish peroxidase, and the chromogenic substrate is TMB; or the avidin-chromogenic enzyme is streptavidin-labeled AP enzyme, and the chromogenic substrate is NBT / BCIP.

[0009] In one embodiment of the present invention, the hybridization and visualization step further includes: rinsing the hybridization membrane with a rinsing solution after removing unreacted avidin-chromogenic enzyme. Rinsing the hybridization membrane removes avidin-chromogenic enzymes that are not bound to the membrane, thus preventing false positives.

[0010] In one embodiment of the present invention, the rinsing solution is a 1X-SSC buffer solution.

[0011] In one embodiment of the present invention, the nucleic acid release agent is composed of Triton X-100, Tris-HCl, and EDTA. The concentration of Tris-HCl in the nucleic acid release agent is 0.5 M, the concentration of EDTA is 20 mM, and the volume percentage of Triton X-100 is 1%. Triton X-100 is responsible for disrupting cell membranes to release nucleic acids, EDTA chelates metal ions to inhibit nuclease activity and prevent nucleic acid degradation, and the Tris buffer provides a microenvironment for nucleic acid preservation. This formulation achieves rapid nucleic acid release with minimal components and low cost.

[0012] In one embodiment of the present invention, the primer combination in the primer mixture consists of 5 sets of primer pairs, namely primer pairs targeting high-risk human papillomavirus subtypes 16 / 18, primer pairs targeting Ureaplasma urealyticum, primer pairs targeting Chlamydia trachomatis, primer pairs targeting Neisseria gonorrhoeae, and internal standard primer pairs.

[0013] In one embodiment of the present invention, the molar ratio of the restriction primer to the non-restriction primer is 1:25, the forward primer is a restriction primer, the reverse primer is a non-restriction primer, and the 5' end of the reverse primer is labeled with biotin. This step, through asymmetric amplification, uses a significantly excessive amount of reverse primer compared to the forward primer, resulting in a predominantly single-stranded product with biotin labeling. The product can be directly used for hybridization, avoiding the step of preparing single-stranded molecules and improving hybridization specificity and sensitivity.

[0014] In one embodiment of the present invention, the static reaction time for the nucleic acid amplification step is more than 15 minutes. Considering both the amplification effect and the time consumption, it is more appropriate to select 20 minutes of incubation for amplification to obtain nucleic acid amplification products.

[0015] In one embodiment of the present invention, the probes immobilized on the hybridization membrane are labeled with amino groups. There are six types of probes: a probe targeting high-risk human papillomavirus type 16, a probe targeting high-risk human papillomavirus type 18, a probe targeting Ureaplasma urealyticum, a probe targeting Chlamydia trachomatis, a probe targeting Neisseria gonorrhoeae, and an internal standard probe. By setting an internal standard probe, the sampling effect and the quality of the detection process can be monitored, ensuring the accuracy of the detection results.

[0016] In one embodiment of the invention, the hybridization solution contains 10% (v / v) formamide, 2X saline-sodium citrate mixed buffer, and 0.2% (w / v) sodium dodecyl sulfate buffer. By combining the hybridization solution with asymmetric isothermal amplification, single-stranded nucleic acids for hybridization detection can be obtained using a simple detection cartridge, eliminating the need for laboratory equipment.

[0017] The present invention also provides a nucleic acid detection device, comprising: The nucleic acid extraction unit includes a sample pool, an enrichment section, and a nucleic acid release agent chamber; the sample pool is equipped with a liquid inlet and is configured to contain liquid samples; the enrichment section has an enrichment membrane inside, the pore size of which is smaller than the diameter of the target pathogen; the nucleic acid release agent chamber is pre-filled with a nucleic acid release agent. A nucleic acid amplification unit includes an amplification reaction chamber, wherein an amplification reagent is pre-placed inside the amplification reaction chamber. The amplification reagent is in lyophilized form and consists of ERA basic reagents and a primer mixture. The hybridization and detection result visualization unit includes a hybridization solution chamber, an observation chamber, an avidin-chromogenic enzyme solution chamber, and a chromogenic solution chamber; the observation chamber is equipped with a hybridization membrane on which nucleic acid probes are immobilized.

[0018] In one embodiment of the present invention, the nucleic acid detection device further includes a housing; the nucleic acid extraction unit, the nucleic acid amplification unit, and the hybridization and detection result visualization unit are all disposed within the housing and connected sequentially via pipelines; the pipelines are made of flexible material; and at least one of the pipelines is provided with a shut-off valve.

[0019] In one embodiment of the present invention, a liquid driving mechanism is provided inside the sample pool, the nucleic acid release agent chamber, the hybridization solution chamber, the avidin-chromogenic enzyme solution chamber, and the chromogenic solution chamber.

[0020] In one embodiment of the present invention, the nucleic acid extraction unit further includes a nucleic acid chamber configured to contain nucleic acid extraction solution; the hybridization and detection result visualization unit further includes a rinsing solution chamber pre-filled with rinsing solution.

[0021] Compared with the prior art, the technical effects achieved by the present invention are as follows: 1. The method of this invention combines room temperature rapid nucleic acid extraction, isothermal multiplex amplification and hybridization visualization technology, which can complete the detection of pathogen nucleic acid without relying on laboratory equipment and professional experimental personnel. Users can perform the test themselves without relying on hospitals or professional testing institutions, and the entire process can be completed in about 30 minutes.

[0022] 2. By optimizing the nucleic acid release agent formulation, rapid nucleic acid release with minimal components and low cost is achieved. This can be done at room temperature without centrifugation, heating, boiling, or other steps, and without the need for a laboratory environment or sophisticated instruments. It achieves room temperature and gentle release of nucleic acid, enabling one-step detection of large-volume samples. While simplifying the operation and reducing costs, the nucleic acid extraction effect remains at the same level as commercially available magnetic bead extraction reagents and nucleic acid release agents, making it suitable for home self-testing.

[0023] 3. By using the ERA isothermal amplification method with low temperature requirements and applying the asymmetric concept to the isothermal system to obtain a large number of single-stranded products, the need for thermal denaturation when obtaining single strands from conventional double strands is reduced. At the same time, in combination with the improved hybridization solution formula, single strands that can be used for subsequent hybridization detection can be obtained without high temperature, thus eliminating the dependence on equipment such as PCR instruments.

[0024] 4. The nucleic acid detection device designed based on the principle of the present invention has a simple structure and low cost. When using it, you only need to push and pull the piston rods of each chamber in sequence according to the instructions to complete the detection. No special equipment or special complicated operation process is required.

[0025] 5. The isothermal amplification reagent is lyophilized, and the avidin-chromogenic enzyme solution and chromogenic solution are formulated with room temperature stabilizers, so that the nucleic acid detection device of the present invention can be stored and used at room temperature.

[0026] 6. The nucleic acid testing device adopts a closed, disposable cartridge design, which structurally eliminates the risk of aerosol contamination, protects the safety of users, expands the application scenarios, and has high safety, making it suitable for home self-testing.

[0027] 7. Specific primers and probes were designed for the two most severe high-risk HPV types (HPV16 and HPV18), Ureaplasma urealyticum (UU), Chlamydia trachomatis (CT), and Neisseria gonorrhoeae (NG), covering common pathogens of genital tract infections. An internal standard was designed to monitor the sampling effect and the quality of the detection process, ensuring the accuracy of the test results and a sensitivity of over 90%.

[0028] 8. The test samples are liquid samples such as urine. The collection is non-invasive and convenient. The test can be performed at home. The test results can be obtained by referring to the instructions. It has good privacy. Attached Figure Description

[0029] Figure 1 This is a three-dimensional structural schematic diagram of a nucleic acid detection device according to an embodiment of the present invention; Figure 2 This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 3 This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 4 This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 5 This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 6This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 7 This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 8 This is a schematic diagram of the internal overall structure of a nucleic acid detection device according to an embodiment of the present invention; Figure 9 This is a diagram showing the detection results of a representative sample according to an embodiment of the present invention.

[0030] Explanation of key figure labels: 101-Sample pool, 1011-Liquid inlet, 1012-Sealing cap, 1013-First liquid-driven mechanism, 102-Enrichment section, 1021-Enrichment membrane, 1022-Enrichment membrane chamber, 103-Sample chamber, 104-Waste liquid chamber, 1041-Partition, 105-Waste liquid outlet, 106-Waste liquid pool, 201-Nucleic acid release agent chamber, 2011-Second liquid-driven mechanism, 202-Nucleic acid chamber, 2021-Third liquid-driven mechanism, 301-Amplification reaction chamber, 302-Hybridization solution chamber, 3021-Fourth liquid-driven mechanism, 401-Observation chamber, 4011-Hybridization membrane, 4012-Observation window, 4013-Staining spot, 402-Avidin-chromogenic enzyme solution chamber, 4021-Fifth liquid-driven mechanism, 4 03-Rinse solution chamber, 4031-Sixth liquid drive mechanism, 404-Developing solution chamber, 4041-Seventh liquid drive mechanism, 5-Housing, 601-First shut-off valve, 602-Second shut-off valve, 603-Third shut-off valve, 604-Fourth shut-off valve, 605-Fifth shut-off valve, 606-Sixth shut-off valve, 607-Seventh shut-off valve, 608-Eighth shut-off valve, 609-Ninth shut-off valve, 610-Operating unit, 701-First pipeline, 702-Second pipeline, 703-Third pipeline, 704-Fourth pipeline, 705-Fifth pipeline, 706-Sixth pipeline, 707-Seventh pipeline, 708-Eighth pipeline, 709-Ninth pipeline, 710-Tenth pipeline, 8-Air hole, 9-Piston, 10-Piston rod. Detailed Implementation

[0031] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.

[0032] It should be noted that the dimensions and shapes of the components in the accompanying drawings are primarily for illustrating technical features and do not represent actual physical dimensions or shapes. When a component is referred to as "fixed to," "placed," "equipped with," "provided with," "arranged on," or "connected to" another component, it may be directly on the other component or may have an intervening component. When a component is considered to be "connected" to another component, it may be directly connected to the other component or may have an intervening component.

[0033] The technical solution of the present invention is illustrated below through specific embodiments. It should be understood that the one or more steps mentioned in the present invention do not preclude the existence of other methods and steps before or after the combined steps, or that other methods and steps may be inserted between these explicitly mentioned steps. It should also be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Unless otherwise stated, the numbering of each method step is only for the purpose of identifying each method step, and not for limiting the order of each method or limiting the scope of the present invention. Changes or adjustments to their relative relationships, without substantial changes to the technical content, can also be considered as within the scope of the present invention.

[0034] The raw materials and instruments used in the examples are not subject to any specific restrictions on their source; they can be purchased from the market or prepared according to conventional methods known to those skilled in the art.

[0035] Example 1 Nucleic Acid Detection Method A nucleic acid detection method includes the following steps: S1 Nucleic Acid Extraction Steps: The liquid sample is added to the sample pool and flows through an enrichment membrane, which is a cellulose acetate filter membrane with a pore size of 0.1 μm, so that the pathogens in the liquid sample are enriched on the surface of the enrichment membrane; then the nucleic acid releasing agent is repeatedly flowed through the enrichment membrane 5 times, so as to come into contact with the pathogens enriched on the surface of the enrichment membrane, and the nucleic acid of the pathogens is released into the nucleic acid releasing agent to obtain the nucleic acid extract.

[0036] S2 Nucleic Acid Amplification Steps: The nucleic acid extraction solution is mixed with ERA basic reagents and primer mixture to form a nucleic acid amplification system. The microenvironment temperature of the nucleic acid amplification system is maintained at 38-42℃, and the reaction is allowed to stand for 20 minutes to obtain the nucleic acid amplification product. The primer mixture consists of different primer pairs, with the forward primer being a restriction primer and the reverse primer being a non-restriction primer. The molar ratio of the forward primer to the corresponding reverse primer is 1:25, and the non-restriction primer is labeled with biotin.

[0037] S3 Hybridization and Detection Result Visualization Steps: The nucleic acid amplification product is mixed with the hybridization solution to obtain a nucleic acid hybridization solution. This solution is then hybridized with the nucleic acid probes immobilized on the hybridization membrane. After 5 minutes of hybridization, the solution is removed. Next, a streptavidin-labeled horseradish peroxidase solution is applied to the hybridization membrane to allow avidin to bind with biotin. After 3 minutes of reaction, the unreacted streptavidin-labeled chromogenic enzyme is removed. The membrane is then rinsed twice with rinsing buffer. Finally, a chromogenic substrate is applied to the membrane for 2 minutes. The substrate is catalyzed by the chromogenic enzyme, resulting in color development at the nucleic acid probe sites of the target pathogen nucleic acid. Blue spots indicate a positive result, while the absence of blue spots indicates a negative result.

[0038] Specifically, the sample to be tested can be, but is not limited to, urine, blood, saliva, and other liquid tissues secreted by the human body. The pathogens to be detected in this invention can be viruses, bacteria, mycoplasma, chlamydia, etc., specifically such as human papillomavirus subtype 16, human papillomavirus subtype 18, ureaplasma urealyticum, chlamydia trachomatis, and gonococci.

[0039] Specifically, the nucleic acid release agent consists of Triton X-100, Tris-HCl and EDTA, wherein the concentration of Tris-HCl is 0.5M, the concentration of EDTA is 20mM, and the volume percentage of Triton X-100 is 1%.

[0040] Specifically, the basic ERA reagents can be obtained through commercial purchases.

[0041] Specifically, when detecting human papillomavirus subtype 16, human papillomavirus subtype 18, Ureaplasma urealyticum, Chlamydia trachomatis, and Neisseria gonorrhoeae, the primer mixture consists of 5 primer pairs: primer pairs targeting high-risk human papillomavirus subtypes 16 / 18, primer pairs targeting Ureaplasma urealyticum, primer pairs targeting Chlamydia trachomatis, primer pairs targeting Neisseria gonorrhoeae, and an internal standard primer pair. Primer pairs targeting high-risk human papillomavirus subtypes 16 / 18 include the forward primer TTCAAAGCRCAGGGHCACAATAATGGTATT and the reverse primer CACAATTGAAAWATAAACTGTAAWTCATATTCCTC. Primer pairs targeting Ureaplasma urealyticum include the forward primer TAATGGTATGTCACCACTTAAATCCTAAGGTTC and the reverse primer ATCTGATGACATAATTGARATTGCACCCATATC. Primer pairs targeting Chlamydia trachomatis include the forward primer ATCGCCCCAGACAA. The primer pairs for Neisseria gonorrhoeae include the forward primer GGAGTATCTTGCGGATTTCGTGGATTTAGAC and the reverse primer CCTTGCACCGTGTAGCCCTGCTGTTTGAAC. The internal standard primer pair includes the forward primer TGATAGGCACTGACTCTCTCTCTGCCTATTGGTC and the reverse primer AAAGGTGCCCTTGAGGTTGTCCAGGTGAGC. HPV16 and HPV18 share a single primer pair to reduce the challenge of achieving single-tube multiplex detection using enzymatic recombination isothermal amplification (ERA) and to achieve specific differentiation via probes. The 5' end of the reverse primer in the multiplex primer mixture is labeled with biotin. The amount of reverse primer is 25 times that of the forward primer. To facilitate efficient subsequent hybridization reactions, biotin-labeled reverse primers were designed with a fold difference in usage compared to the forward primers. This asymmetric synthesis method was used to assist in generating more single-stranded products that could bind to the forward probe.

[0042] Specifically, the hybridization solution contains 10% (v / v) formamide, 2X-SSC buffer (Saline Sodium Citrate buffer, 2X concentration, containing 0.3M NaCl and 0.03M sodium citrate), and 0.2% (w / v) SDS (sodium dodecyl sulfate) buffer. All concentrations mentioned above are the final concentrations of the hybridization solution.

[0043] Correspondingly, the probes immobilized on the hybridization membrane are probes targeting high-risk human papillomavirus type 16 (HPV), high-risk HPV type 18 (HPV), Ureaplasma urealyticum, Chlamydia trachomatis, Neisseria gonorrhoeae, and an internal control probe. The probes can also be those found in existing technologies. The nucleotide sequence of the probe targeting high-risk HPV type 16 is GTGCTGCCATATCTACTTCAGAAAC; the nucleotide sequence of the probe targeting high-risk HPV type 18 is AGTCTCCTGTACCTGGGCAA; the nucleotide sequence of the probe targeting Ureaplasma urealyticum is TAGCCAAACAATTGCAGCTGAA; the nucleotide sequence of the probe targeting Chlamydia trachomatis is TCCCTGAAGTCTTAAGCTTGGA; the nucleotide sequence of the probe targeting Neisseria gonorrhoeae is TAACGTGGAAGCGGTCGGATTAA; and the nucleotide sequence of the internal control probe is ATGGCAAGAAAGTGCTCGGT.

[0044] Specifically, the hybrid membrane is a negatively charged nylon membrane.

[0045] Specifically, the avidin-chromogenic enzyme uses a streptavidin-labeled horseradish peroxidase (SA-HRP) solution containing 0.1% (w / v) bovine serum albumin (BSA), 0.03% (v / v) Proclin 300, and 1X SA-HRP solution (0.1 U / mL). All concentrations mentioned above are final concentrations of the SA-HRP solution. Correspondingly, the chromogenic substrate is TMB chromogenic solution containing 1% (w / v) polyvinyl alcohol, 0.03% (v / v) Proclin 300, and 1X TMB chromogenic solution (0.02% (w / v) TMB). TMB is an abbreviation for 3,3',5,5'-tetramethylbenzidine. Alternatively, the avidin-chromogenic enzyme is a streptavidin-labeled alkaline phosphatase (AP) solution containing 0.1% (w / v) bovine serum albumin (BSA), 0.03% (v / v) Proclin 300, and 1X SA-AP solution (2 U / mL). Correspondingly, the chromogenic substrate is an NBT / BCIP chromogenic solution containing 1% (w / v) polyvinyl alcohol, 0.03% (v / v) Proclin 300, and 0.4 mg / mL NBT + 0.2 mg / mL BCIP. BCIP (5-Bromo-4-chloro-3-indolyl phosphate) + NBT (tetrazole nitro blue) is one of the optimal substrate combinations for alkaline phosphatase.

[0046] Specifically, the rinsing solution is 1X-SSC buffer.

[0047] The target of detection can also be other pathogens. Based on the method of the present invention, the primer sequences and probe sequences of this embodiment can be replaced with the corresponding primer sequences and probe sequences of the pathogen to be detected.

[0048] Example 2 Nucleic Acid Detection Device Please refer to the following: Figures 1 to 2 The contents shown are for better understanding of the specific structure of the present invention. Among them, Figure 1 This is a three-dimensional diagram of the appearance of a nucleic acid testing device. The appearance will vary depending on the internal structure. Figure 2 This is a schematic diagram of the overall internal structure of a nucleic acid testing device.

[0049] like Figure 2 The image shows a nucleic acid testing device, comprising: The nucleic acid extraction unit includes a sample pool 101, an enrichment section 102, a waste liquid pool 106, a nucleic acid release agent chamber 201, and a nucleic acid chamber 202. The sample pool 101 is provided with a liquid inlet 1011 and is configured to contain liquid samples. The enrichment section 102 is provided with an enrichment membrane 1021, the pore size of which is smaller than the diameter of the target pathogen. The nucleic acid release agent chamber 201 is pre-filled with a nucleic acid release agent. A nucleic acid amplification unit includes an amplification reaction chamber 301, wherein the amplification reaction chamber 301 is pre-filled with amplification reagent, the amplification reagent being in lyophilized form and composed of ERA basic reagents and a primer mixture; and... The hybridization and detection result visualization unit includes a hybridization solution chamber 302, an observation chamber 401, an avidin-chromogenic enzyme solution chamber 402, a rinsing solution chamber 403, and a chromogenic solution chamber 404. The observation chamber 401 contains a hybridization membrane 4011 on which nucleic acid probes are immobilized. The hybridization solution chamber 302 is pre-filled with hybridization solution. The avidin-chromogenic enzyme solution chamber 402 is pre-filled with avidin-chromogenic enzyme solution. The rinsing solution chamber 403 is pre-filled with rinsing solution. The chromogenic solution chamber 404 is pre-filled with chromogenic solution.

[0050] The nucleic acid detection device also includes a housing 5; the nucleic acid extraction unit, the nucleic acid amplification unit, and the hybridization and detection result visualization unit are all disposed within the housing 5 and are connected in sequence through pipelines; The tubing is made of a flexible material; at least one of the tubing is equipped with a shut-off valve 6; the shut-off valve 6 includes an operating part 610, configured to close and open the tubing. The operating part 610 can be a sheet-like structure, and the operating part 610 extends from the inside of the housing 5 to the outside of the housing 5. The user can press down on the operating part 610 to deform the tubing, thereby closing the internal channel and achieving tubing closure. By controlling the opening and closing of the shut-off valve, combined with adjusting the direction of the nucleic acid detection device, the flow of liquid in each chamber during the detection process can be controlled using the effect of gravity.

[0051] Specifically, sample pool 101 is connected to enrichment membrane chamber 1022 via first pipe 701; waste liquid pool 106 is connected to enrichment membrane chamber 1022 via second pipe 702; nucleic acid release agent chamber 201 is connected to enrichment membrane chamber 1022 via third pipe 703; nucleic acid chamber 202 is connected to enrichment membrane chamber 1022 via fourth pipe 704; amplification reaction chamber 301 is connected to nucleic acid chamber 202 via fifth pipe 705, to hybridization solution chamber 302 via sixth pipe 706, and to observation chamber 401 via seventh pipe 707; observation chamber 401 is connected to avidin-chromogenic enzyme solution chamber 402 via eighth pipe 708, to washing solution chamber 403 via ninth pipe 709, and to chromogenic solution chamber 404 via tenth pipe 710.

[0052] Specifically, a first shut-off valve 601 is installed on the second pipeline 702. The first shut-off valve 601 can be initially set to an open state or a closed state, preferably an open state. A second shut-off valve 602 is installed on the third pipeline 703, a third shut-off valve 603 is installed on the fourth pipeline 704, a fourth shut-off valve 604 is installed on the fifth pipeline 705, a fifth shut-off valve 605 is installed on the sixth pipeline 706, a sixth shut-off valve 606 is installed on the seventh pipeline 707, a seventh shut-off valve 607 is installed on the eighth pipeline 708, an eighth shut-off valve 608 is installed on the ninth pipeline 709, and a ninth shut-off valve 609 is installed on the tenth pipeline 710. The initial state of the second shut-off valve 602, the third shut-off valve 603, the fourth shut-off valve 604, the fifth shut-off valve 605, the sixth shut-off valve 606, the seventh shut-off valve 607, the eighth shut-off valve 608, and the ninth shut-off valve 609 is all closed.

[0053] A first liquid driving mechanism 1013 is installed inside the sample pool 101. In its initial state, the piston of the first liquid driving mechanism 1013 is located at the end of the sample pool 101 near the inlet. After the sample to be tested is injected, the piston rod is pushed, driving the sample to flow through the enrichment section 102. A second liquid driving mechanism 2011 is installed inside the nucleic acid release agent chamber 201. The second liquid driving mechanism 2011 is used to output and / or recover the liquid inside the nucleic acid release agent chamber 201. In its initial state, the piston of the second liquid driving mechanism 2011 is located at the end of the nucleic acid release agent chamber 201 away from the third conduit 703. A third liquid driving mechanism 2021 is installed inside the nucleic acid chamber 202. In its initial state, the piston of the third liquid driving mechanism 2021 is located at the end of the nucleic acid chamber 202 near the fourth conduit 704. A fourth liquid driving mechanism 3021 is installed inside the hybridization liquid chamber 302. In its initial state, the piston of the fourth liquid driving mechanism 3021 is located in the middle of the hybridization liquid chamber 302. The avidin-chromogenic enzyme solution chamber 402 is equipped with a fifth liquid driving mechanism 4021, which is initially located at the end of the avidin-chromogenic enzyme solution chamber 402 away from the eighth conduit 708. The wash solution chamber 403 is also equipped with a sixth liquid driving mechanism 4031, which is initially located at the end of the wash solution chamber 403 away from the ninth conduit 709. The chromogenic solution chamber 404 is equipped with a seventh liquid driving mechanism 4041, which is initially located at the end of the chromogenic solution chamber 404 away from the tenth conduit 710. The first liquid driving mechanism 1013 is provided in the sample pool 101, which facilitates active operation and avoids the problem of slow flow and poor filtration of the sample through the enrichment section 102 relying solely on gravity, thus providing favorable conditions for the detection work. A second liquid-driven mechanism 2011 is installed in the nucleic acid release chamber 201, which facilitates active operation and avoids the slow process and poor extraction effect caused by relying solely on gravity to move the nucleic acid release agent to the enrichment section 102, thus providing favorable conditions for detection. A third liquid-driven mechanism 2021 is installed in the nucleic acid chamber 202, which also facilitates active operation. Through alternating push and pull with the second liquid-driven mechanism 2011 in the nucleic acid release chamber 201, the nucleic acid release agent can flow back and forth on both sides of the enrichment section 102, thereby greatly improving the efficiency and quality of nucleic acid extraction and providing favorable conditions for detection. The repeated push and pull of the fourth liquid-driven mechanism 3021 ensures thorough mixing of the amplified nucleic acid sample with the hybridization solution. The repeated pushing and pulling of the sixth liquid driving mechanism 4031 achieves thorough purification, enabling the rinsing solution to rinse the hybridization membrane in the observation chamber 401. This carries the avidin-chromogenic enzyme that has not bound to the hybridization membrane back to the rinsing solution chamber 403 along with the rinsing solution, thus avoiding false positives caused by the avidin-chromogenic enzyme that has not bound to the hybridization membrane catalyzing color development.

[0054] Specifically, the hybridization membrane 4011 can be a negatively charged nylon membrane. The hybridization membrane 4011 is immobilized with specific probes, including probes targeting different pathogens and internal control probes.

[0055] An observation window 4012 is located in the observation chamber 401, directly opposite the hybridization membrane 4011. The observation window 4012 is colorless and transparent, allowing users to view the test results. The observation window 4012 can be made of colorless and transparent materials, such as polymethyl methacrylate (PMMA), polycarbonate (PC), polyethylene terephthalate (PET), polypropylene (PP), polyvinyl chloride (PVC), polystyrene (PS), thermoplastic polyurethane elastomer rubber (TPU), polysulfone (PSF), transparent ABS plastic, or transparent nylon.

[0056] Furthermore, sample chamber 101 should have sufficient capacity, the specific volume of which should be set according to the required amount of samples to be tested. Similarly, the volumes of other chambers should also be set according to the required amount of samples to be tested, and the connectivity between different chambers needs to be considered. Specifically, the volume of sample chamber 101 can be 5 mL to 15 mL, the volume of the waste liquid chamber 106 can be 5 to 15 mL, the volume of nucleic acid release agent chamber 201 can be 0.1 to 0.2 mL, the volume of nucleic acid chamber 202 can be 0.1 to 0.2 mL, the volume of amplification reaction chamber 301 can be 0.05 to 0.15 mL, the volume of hybridization solution chamber 302 can be 0.3 to 0.4 mL, the volume of avidin-chromogenic enzyme solution chamber 402 can be 0.3 to 0.4 mL, the volume of rinsing solution chamber 403 can be 0.3 to 0.4 mL, and the volume of chromogenic solution chamber 404 can be 0.3 to 0.4 mL. Because liquids flow between these chambers, the volumes of interconnected chambers are often related and need to be specifically set based on their functions (such as the volume of pre-prepared reagents) and the direction of liquid flow. For example, liquid samples in sample pool 101 will be discharged into waste liquid pool 106 via the waste liquid from the enrichment section; therefore, the volume of waste liquid pool 106 should be greater than or equal to the volume of sample pool 101. Similarly, by circulating the nucleic acid releasing agent back and forth between nucleic acid releasing agent chamber 201 and nucleic acid chamber 202, sufficient extraction of nucleic acids is achieved; therefore, nucleic acid releasing agent chamber 201 and nucleic acid chamber 202 should preferably be set to have equal volumes. In one specific embodiment of the present invention, the sample pool 101 has a volume of 10 mL, the waste liquid pool 106 has a volume of 11 mL, the nucleic acid release agent chamber 201 has a volume of 0.15 mL, the nucleic acid chamber 202 has a volume of 0.15 mL, the amplification reaction chamber 301 has a volume of 0.1 mL, the hybridization solution chamber 302 has a volume of 0.35 mL, the avidin-chromogenic enzyme solution chamber 402 has a volume of 0.35 mL, the rinsing solution chamber 403 has a volume of 0.35 mL, and the chromogenic solution chamber 404 has a volume of 0.35 mL.

[0057] The pre-prepared nucleic acid release agent has a volume of 0.1 mL. The isothermal amplification reagent is in lyophilized form and contains ERA basic reagents and a primer mixture. The pre-prepared hybridization solution, avidin-chromogenic enzyme solution, washing buffer, and chromogenic solution each have a volume of 0.25 mL. The reagent composition is the same as in Example 1.

[0058] In this embodiment, the tubing is made of a flexible material, such as silicone tubing or PVC tubing. To reduce sample loss during flow, the inner diameter of the tubing should be ≤0.5mm, preferably 0.4mm.

[0059] Furthermore, the liquid inlet 1011 of the sample pool 101 should be equipped with a sealing cap 1012. After the sample to be tested is added, the sealing cap 1012 should be fastened to the liquid inlet 1011 to prevent sample leakage.

[0060] Specifically, the enrichment membrane 1021 can be, but is not limited to, a cellulose acetate filter membrane. The pore size of the enrichment membrane 1021 can be in the range of 0.05 μm to 0.25 μm, but should be smaller than the diameter of the pathogen in the sample being tested. The specific pore size can be determined according to the size of the pathogen being tested. Even smaller pore sizes, smaller than the diameter of nucleic acids, can be used to enrich the extracted nucleic acids on one side of the filter membrane, facilitating subsequent processing in some self-testing devices. By setting up the enrichment section 102, pathogens in the sample to be tested can be enriched, reducing interference from waste liquid in the test sample, reducing the volume of nucleic acid release agent used, improving nucleic acid extraction efficiency, and providing favorable conditions for subsequent testing.

[0061] The 201 pre-filled nucleic acid release agent in the nucleic acid release agent chamber allows for effective nucleic acid extraction without the need for specialized laboratory equipment, conditions, or professional operating procedures (such as centrifugation, heating, or boiling), providing favorable conditions for subsequent self-testing.

[0062] Specifically, the housing 5 can be made of medical-grade PVC material. A vent (not shown in the figure) can be provided on the upper surface of the housing 5, and a waterproof and breathable membrane is attached to the inner wall of the housing 5 at the location of the vent to facilitate gas exchange, prevent air blockage, and prevent leakage of the test sample. Specifically, the waterproof and breathable membrane can be a film made of materials such as polytetrafluoroethylene (PTFE), polypropylene (PP), or polyethylene (PE). The waterproof and breathable membrane effectively prevents leakage of the test sample and avoids contamination, and also prevents the formation of internal air blockages, facilitating the flow of the test sample between the internal units.

[0063] In this embodiment, the dimensions of the detection device are: 5cm wide, 10cm long, and 1cm thick, and the dimensions of the transparent plastic window are: 1cm wide and 2cm long.

[0064] The operating steps for this nucleic acid testing device are as follows: First, sample enrichment is performed: the sample to be tested is injected into the sample pool 101 through the liquid inlet 1011, the first shut-off valve 601 is opened, the first liquid driving mechanism 1013 is pushed, so that the sample to be tested flows through the enrichment section 102, the pathogens in the sample to be tested are enriched on the surface of the enrichment membrane 1021, the waste liquid flowing through the enrichment section 102 enters the waste liquid pool 106, and the first shut-off valve 601 is closed. Next, the sample nucleic acid extraction operation is performed: the second stop valve 602 and the third stop valve 603 are opened, the second liquid driving mechanism 2011 is pushed to allow the nucleic acid release agent to flow through the enrichment section 102 and into the nucleic acid chamber 202, the third liquid driving mechanism 2021 is pushed to allow the nucleic acid release agent to flow back into the nucleic acid release agent chamber 201, and this operation is repeated 5 times; finally, the second liquid driving mechanism 2011 is pushed to allow the nucleic acid release agent to enter the nucleic acid chamber 202, the sample nucleic acid solution is detected, and the third stop valve 603 is closed; The third step is to perform multiplex isothermal amplification of nucleic acid: keep the microenvironment temperature of the nucleic acid self-testing device at 38-42℃ (a hot water bottle or hand warmer can be used for heating), open the fourth stop valve 604, push the third liquid drive mechanism 2021 to let the test sample enter the amplification reaction chamber 301, close the fourth stop valve 604, let it stand for 20 minutes to obtain the amplification reaction product. The fourth step involves hybridization and result visualization: Open the fifth stop valve 605, pull the fourth liquid drive mechanism 3021 to draw the amplification reaction product into the hybridization solution chamber 302, mix it with the hybridization solution, then push the fourth liquid drive mechanism 3021 back, and the mixture enters the amplification reaction chamber 301. Repeat the pushing and pulling of the fourth liquid drive mechanism 3021 several times (2-5 times) to obtain a mixture of amplification reaction product and hybridization solution; Open the sixth stop valve 606, push the fourth liquid drive mechanism 3021 to push the mixture into the observation chamber 401, let it stand for 5 minutes, then pull the fourth liquid drive mechanism 3021 to draw the mixture back into the amplification reaction chamber 301 and the hybridization solution chamber 302, and close the sixth stop valve 606; Open the seventh stop valve 607, push the fifth liquid drive mechanism 4021 to push the avidin-chromogenic enzyme solution into the observation chamber 401, and let it stand for 3 minutes. Then, pull the fifth liquid drive mechanism 4021 to draw the avidin-chromogenic enzyme solution back into the avidin-chromogenic enzyme solution chamber 402, and close the seventh stop valve 607; open the eighth stop valve 608, push the sixth liquid drive mechanism 4031 to push the rinsing solution into the observation chamber 401, then pull the sixth liquid drive mechanism 4031 to draw the rinsing solution back into the rinsing solution chamber 403, repeat twice, and close the eighth stop valve 608; open the ninth stop valve 609, push the seventh liquid drive mechanism 4041 to push the chromogenic solution into the observation chamber 401, let it stand for 2 minutes, then pull the seventh liquid drive mechanism 4041 to draw the chromogenic solution back into the chromogenic solution chamber 404, and close the ninth stop valve 609; observe the color development of the chromogenic spots 4013 at different positions in the observation chamber 401. A blue chromogenic spot 4013 indicates a positive result, while a colorless chromogenic spot 4013 indicates a negative result. The test is complete.

[0065] Representative sample test results are as follows Figure 9 As shown, in this embodiment, the hybridization sites are arranged from top to bottom as follows: HPV16, HPV18, UU, CT, NG, and internal standard. Among them, Figure 9 A indicates a negative result; internal standard was detected, but other spots were not detected. Figure 9 B indicates HPV16 positive, internal standard detected, HPV16 detected, other spots not detected; Figure 9 C indicates HPV18 positive, internal standard detected, HPV18 detected, other spots not detected; Figure 9 D indicates positive for Ureaplasma urealyticum (UU), with internal standard detected, UU detected, and no other spots detected; Figure 9 E indicates positive for Chlamydia trachomatis (CT), with internal standard detected and CT detected, but no other spots detected; Figure 9 F indicates positive for Neisseria gonorrhoeae (NG), internal standard detected, NG detected, and no other spots detected; Figure 9G indicates HPV16 and NG positive, internal standard detected, HPV16 and NG detected, other spots not detected. Other possible situations can be deduced from the above judgment criteria.

[0066] Example 3 Nucleic Acid Detection Device like Figure 3 The diagram illustrates another specific implementation of a nucleic acid detection device. The main difference from Example 2 is the absence of the nucleic acid chamber 202 and its corresponding fourth conduit 704 and third shut-off valve 603. Simultaneously, the amplification reaction chamber 301 and the nucleic acid release agent chamber 201 are connected via a fifth conduit 705, on which the fourth shut-off valve 604 is installed. In this embodiment, the sample pool 101 is used instead of the nucleic acid chamber 202 for nucleic acid extraction, achieving similar results to the technical solution of Example 1, while saving the nucleic acid chamber 202 and its corresponding components, thus reducing costs. Figure 7 In the example, the interface between the nucleic acid release chamber 201 and the enrichment section 102 is located on the opposite side of the sample pool 101 interface. In this case, nucleic acids can pass through the enrichment section 102. If nucleic acids cannot pass through the enrichment section 102, the interface between the nucleic acid release chamber 201 and the enrichment section 102 can also be located on the same side of the sample pool 101 interface.

[0067] Example 4 Nucleic Acid Detection Device like Figure 4 The diagram shows another specific implementation of a nucleic acid testing device, the main difference from Example 3 being the absence of a waste liquid tank 106. In this design, waste liquid can be directly discharged into the internal cavity of the housing 5 through the waste liquid outlet 105. This design further simplifies the structure and saves costs.

[0068] Example 5 Nucleic Acid Detection Device like Figure 5 The diagram illustrates another specific implementation of a nucleic acid detection device. The main difference between this embodiment and Embodiment 2 is that the enrichment section 102 is located at the bottom of the sample pool 101. In this design, when the nucleic acid sample can pass through the enrichment membrane, the positions where the nucleic acid release chamber 201 and the nucleic acid chamber 202 communicate with the sample pool 101 can be located either at the bottom of the sample pool 101 or on the side of the sample pool 101, close to the bottom. When the nucleic acid sample cannot pass through the enrichment membrane, the positions where the nucleic acid release chamber 201 and the nucleic acid chamber 202 communicate with the sample pool 101 are located on the side of the sample pool 101, close to the bottom.

[0069] Example 6 Nucleic Acid Detection Device like Figure 6The diagram illustrates another specific implementation of a nucleic acid detection device. Its main difference from Example 5 is that it does not include the nucleic acid chamber 202 and the corresponding fourth pipeline 704 and third shut-off valve 603. Simultaneously, the amplification reaction chamber 301 and the nucleic acid release agent chamber 201 are connected via a fifth pipeline 705, on which a fourth shut-off valve 604 is installed.

[0070] Example 7 Nucleic Acid Detection Device like Figure 7 The diagram shows another specific implementation of a nucleic acid testing device, the main difference from Example 6 being the absence of a waste liquid tank 106. In this design, waste liquid can be directly discharged into the internal cavity of the housing 5 through the waste liquid outlet 105. This design further simplifies the structure and saves costs.

[0071] Example 8 Nucleic Acid Detection Device like Figure 8 The diagram illustrates another specific implementation of a nucleic acid detection device. The main difference from Embodiment 7 is that the enrichment section 102 is located in the middle of the sample pool 101. Thus, the sample pool 101 is divided into a sample chamber 103 and a waste liquid chamber 104 by a partition 1041. The partition 1041 is equipped with a waste liquid outlet 105 and a first shut-off valve 601, ensuring that the sample to be tested can only flow from the sample chamber 103 to the waste liquid chamber 104. Specifically, the waste liquid outlet 105 can be a second conduit 702 extending from the partition 1041 into the sample chamber 103. The first shut-off valve 601 is used to open or close the waste liquid outlet 105. In this design, the enrichment section 102 is configured to prevent nucleic acid samples from passing through. Correspondingly, the third conduit 703 is positioned on the side of the sample chamber 103, adjacent to the partition 1041.

[0072] Test case 1. Nucleic acid extraction efficiency test From a theoretical perspective, achieving rapid nucleic acid extraction requires meeting three requirements: First, it needs to have the ability to disrupt cells and release nucleic acids; second, it needs to inhibit the activity of DNase and RNase to prevent the degradation of nucleic acids after release; and third, it needs to provide a buffer environment suitable for preserving RNA and DNA. Addressing the weaknesses in existing technologies at the theoretical implementation level, this invention designs solutions for all three requirements and, through formulation optimization, achieves rapid nucleic acid extraction with minimal components and low cost. Specifically, Triton X-100 disrupts cells and releases nucleic acids, EDTA chelates metal ions to control nuclease activity, and Tris buffer provides the microenvironment for nucleic acid preservation. The specific concentrations are 1% (V / V) Triton X-100, 0.5M Tris-HCl, pH 8.0, and 20mM EDTA.

[0073] The urine nucleic acid extraction method of this invention was compared with the extraction effects of a commercially available brand of magnetic bead extraction reagent and a brand of nucleic acid release agent. The differences in Ct values ​​were detected by qPCR after extraction. A quantitative pathogen culture was added to the urine, and then the operation was performed according to the steps of each method. The initial urine volume and the final nucleic acid elution volume were kept consistent. The experiment was repeated three times, and the average value of the qPCR results was used as the evaluation result. The experimental results are shown in the table below: Table 1 Comparison of Nucleic Acid Extraction Methods

[0074] As shown in the table above, the Ct value of nucleic acid extracted by the method of this invention differs from that of the magnetic bead extraction method by less than 2, and from that of commercially available nucleic acid release agents by less than 1. Considering operational deviations, the extraction capability of the method of this invention can be considered to be roughly at the same level as that of commercially available nucleic acid release agents. Looking at the operational steps of each method, the magnetic bead method requires specialized equipment and involves more steps. Although it offers the best performance, it requires a laboratory environment with sophisticated equipment and should be operated by professional personnel. While commercially available nucleic acid release agents have fewer operational steps than the magnetic bead method, they still require centrifugation, heating, and boiling to enhance extraction capability, thus also only suitable for laboratory operation by professional personnel. In contrast, although the extraction capability of the method of this invention is slightly weaker, it does not require centrifugation, boiling, or other steps, and does not require a laboratory environment with sophisticated equipment such as centrifuges. It only requires a few manual steps with the test kit of this invention, making it convenient and more suitable for home self-testing scenarios where there is no laboratory equipment or professional personnel.

[0075] 2. Single-chain product preparation capability test The preparation of single-stranded products often involves heating and denaturing double-stranded products. Asymmetric amplification is commonly used in PCR systems and rarely in isothermal amplification systems. When isothermal amplification is applied to rapid nucleic acid visualization detection, it is often achieved using CRISPR systems; however, the introduction of CRISPR systems also increases product costs. This invention, based on the goal of detection in a home environment, uses the ERA isothermal amplification method, which has low temperature requirements, and applies the asymmetric concept to the isothermal system to obtain a large number of single-stranded products, reducing the need for thermal denaturation required for obtaining single-stranded products from conventional double-stranded products. Simultaneously, with the aid of hybridization solutions, single-stranded products suitable for subsequent hybridization detection can be obtained, thus eliminating dependence on equipment.

[0076] Using nucleic acids of the same copy number as detection templates, the procedures of this invention were compared with conventional ERA reactions and thermal denaturation methods to examine the differences in hybridization performance. The experimental results are shown in the table below: Table 2 Hybridization results of single-stranded products prepared by different methods

[0077] As shown in the table above, the template is 10. 3 At template concentrations of 100 copies / reaction and above, both the method of this invention and conventional methods can detect pathogens normally. When the template concentration is 100 copies / reaction, two pathogens can be detected by the conventional method, while one pathogen can be detected by the method of this invention. From a data comparison perspective, the overall detection performance of the method of this invention, after using a simplified method to prepare single strands, is not significantly reduced and remains at the same level as the conventional method. However, the ease of operation of this method provides a technical basis for eliminating dependence on equipment operation.

[0078] 3. Sensitivity and Specificity Tests After evaluating the nucleic acid extraction and single-strand hybridization capabilities stepwise, the product's end-to-end detection capability was assessed. Using remaining clinical samples as the testing targets, the consistency rate of sensitivity and specificity between this invention and conventional methods was evaluated. Fifty clinical urine samples were tested, of which 30 were confirmed positive by qPCR and 20 were negative. Positive samples included mixed infections with multiple pathogens, while negative samples included infections with other genital tract pathogens, including Candida albicans, herpes simplex virus infection, Escherichia coli infection, and Mycoplasma genitalium infection. Specific test results are shown in Table 3.

[0079] Table 3 Sensitivity and Specificity Test Results

[0080] Note: In qPCR results, "NoCt" indicates a negative result for the pathogen; numbers indicate a positive result. In chromatography and this finding results, "+" indicates a positive result, and "-" indicates a negative result.

[0081] The results showed that the present invention detected 27 positive cases (sensitivity 90%, specificity 100%), while commercial chromatographic strips detected 21 positive cases (sensitivity 70%). Analysis of the test results revealed that among the 9 positive samples where the chromatographic strips failed to detect the pathogens, the Ct values ​​of the qPCR results were relatively high, indicating weakly positive samples. No strongly positive samples (Ct values ​​below 30) were undetected, indicating that the specificity of the chromatographic reagent meets the requirements, and the relatively low sensitivity is a normal phenomenon due to methodological differences. The 3 samples where the present invention failed to detect the pathogens had Ct values ​​of 35-36, which are borderline positive samples; the failure to detect positive results is due to differences in sensitivity. Comparison of the test results of the three methods shows that the detection sensitivity of the present invention is significantly better than that of the chromatographic method, approaching the level of laboratory qPCR.

[0082] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A method for detecting a nucleic acid, characterized by, The method comprises the following steps: S1: nucleic acid extraction step: flowing a liquid sample through an enrichment membrane so that pathogens in the liquid sample are enriched on the surface of the enrichment membrane, and then contacting a nucleic acid releasing agent with the pathogens enriched on the surface of the enrichment membrane so that nucleic acids of the pathogens are released into the nucleic acid releasing agent to obtain a nucleic acid extraction solution; S2: nucleic acid amplification step: mixing the nucleic acid extraction solution with an ERA base reagent and a primer mixture to form a nucleic acid amplification system, and keeping the microenvironment temperature of the nucleic acid amplification system at 38-42℃, and standing to react to obtain a nucleic acid amplification product, wherein the primer mixture comprises a limiting primer and a non-limiting primer, the molar concentration ratio of the limiting primer to the non-limiting primer is 1:20-30, and the non-limiting primer is labeled with biotin; S3: hybridization and detection result visualization step: mixing the nucleic acid amplification product with a hybridization solution to obtain a nucleic acid hybridization solution, hybridizing the nucleic acid hybridization solution with a nucleic acid probe fixed on a hybridization membrane, removing the nucleic acid hybridization solution after hybridization is completed, then contacting avidin-horseradish peroxidase solution with the hybridization membrane so that avidin binds with biotin, removing unreacted avidin-horseradish peroxidase, contacting a color developing substrate with the hybridization membrane, and developing the color developing substrate by the horseradish peroxidase so that the position of the nucleic acid probe of the hybridized target pathogen nucleic acid is colored.

2. The nucleic acid detection method according to claim 1, wherein, The avidin-horseradish peroxidase is streptavidin-labeled horseradish peroxidase, and the color developing substrate is TMB; or the avidin-horseradish peroxidase is streptavidin-labeled AP enzyme, and the color developing substrate is NBT / BCIP. And / or, the hybridization and detection result visualization step further comprises: after removing the unreacted avidin-horseradish peroxidase, rinsing the hybridization membrane with a rinsing solution.

3. The nucleic acid detection method according to claim 1, wherein, The nucleic acid releasing agent is composed of Triton X-100, Tris-HCl and EDTA; Preferably, the concentration of Tris-HCl in the nucleic acid releasing agent is 0.5M, the concentration of EDTA is 20mM, and the volume percentage of Triton X-100 is 1%.

4. The nucleic acid detection method according to claim 1, wherein The primer combination in the primer mixture consists of 5 groups of primer pairs, which are primer pairs for human papilloma virus high-risk type 16 / 18 subtypes, primer pairs for ureaplasma urealyticum, primer pairs for chlamydia trachomatis, primer pairs for gonococcus and internal standard primer pairs; wherein the primer pairs for human papilloma virus high-risk type 16 / 18 subtypes include forward primer TTCAAAGCRCAGGGHCACAATAATGGTATT (SEQ ID NO. 1) and reverse primer CACAATTGAAAWATAAACTGTAAWTCATATTCCTC (SEQ ID NO. 2), the primer pairs for ureaplasma urealyticum include forward primer TAATGGTATGTCACCACTTAAATCCTAAGGTTC (SEQ ID NO. 3) and reverse primer ATCTGATGACATAATTGARATTGCACCCATATC (SEQ ID NO. 4), the primer pairs for chlamydia trachomatis include forward primer ATCGCCCAGACAATGCTCCAAGGAGGTAAAC (SEQ ID NO. 5) and reverse primer GTTACGAAGACAAAACCTCTTCGTTGACCGATGT (SEQ ID NO. 6), the primer pairs for gonococcus include forward primer GGAGTATCTTGCGGATTTCGTGGATTTAGAC (SEQ ID NO. 7) and reverse primer CCTTGCACCGTGTAGCCCTGCTGTTTGAAC (SEQ ID NO. 8), and the internal standard primer pairs include forward primer TGATAGGCACTGACTCTCTCTGCCTATTGGTC (SEQ ID NO. 9) and reverse primer AAAGGTGCCCTTGAGGTTGTCCAGGTGAGC (SEQ ID NO. 10); Preferably, the molar concentration ratio of the restriction primer to the non-restriction primer is 1:25, the forward primer is a restriction primer, the reverse primer is a non-restriction primer, and the 5' end of the reverse primer is labeled with biotin.

5. The nucleic acid detection method according to claim 1, wherein The probes fixed on the hybridization membrane are labeled with amino groups, and the probes include six kinds, which are probes for human papilloma virus high-risk type 16 subtypes, probes for human papilloma virus high-risk type 18 subtypes, probes for ureaplasma urealyticum, probes for chlamydia trachomatis, probes for gonococcus and internal standard probes; Preferably, the nucleotide sequence of the probe against human papillomavirus high-risk type 16 subtype is GTGCTGCCATATCTACTTCAGAAAC (SEQ ID NO. 11), the nucleotide sequence of the probe against human papillomavirus high-risk type 18 subtype is AGTCTCCTGTACCTGGGCAA (SEQ ID NO. 12), the nucleotide sequence of the probe against ureaplasma urealyticum is TAGCCAAACAATTGCAGCTGAA (SEQ ID NO. 13), the nucleotide sequence of the probe against chlamydia trachomatis is TCCTCTGAAGTCTTAAGCTTGGA (SEQ ID NO. 14), the nucleotide sequence of the probe against gonococcus is TAACGTGGAAGCGGTCGGATTAA (SEQ ID NO. 15), and the nucleotide sequence of the internal standard probe is ATGGCAAGAAAGTGCTCGGT (SEQ ID NO. 16).

6. The nucleic acid detection method according to claim 1, wherein The hybridization solution contains 10% (v / v) formamide, 2X saline sodium citrate buffer, and 0.2% (w / v) sodium dodecyl sulfate buffer.

7. A nucleic acid detection device, characterized by, It comprises: a nucleic acid extraction unit comprising a sample pool, an enrichment part, and a nucleic acid releasing agent chamber; the sample pool is provided with a liquid inlet and is configured to contain a liquid sample; the enrichment part is internally provided with an enrichment membrane, the pore size of the enrichment membrane is smaller than the diameter of the target pathogen; the nucleic acid releasing agent chamber is internally pre-installed with a nucleic acid releasing agent; the nucleic acid extraction unit is configured to control the flow of the liquid sample and the nucleic acid releasing agent, so that the liquid sample flows through the enrichment part, so that the pathogens in the liquid sample are enriched on the surface of the enrichment membrane, and then the nucleic acid releasing agent pre-installed in the nucleic acid releasing agent chamber is contacted with the enriched pathogens, so that the nucleic acid of the pathogens is released into the nucleic acid releasing agent, and a nucleic acid extraction solution is obtained; a nucleic acid amplification unit comprising an amplification reaction chamber, the amplification reaction chamber is internally pre-installed with an amplification agent, the nucleic acid amplification unit is in communication with the nucleic acid extraction unit through a pipeline, and the nucleic acid amplification unit is configured to mix the nucleic acid extraction solution and the amplification agent in the amplification reaction chamber to form a nucleic acid amplification system, wherein the amplification agent is in a freeze-dried form and is composed of an ERA basic reagent and a primer mixture, the primer mixture comprises a limiting primer and a non-limiting primer, the molar concentration ratio of the limiting primer to the non-limiting primer is 1:20-30, and the non-limiting primer is labeled with biotin; and The hybridization and detection result visualization unit comprises a hybridization solution chamber, an observation chamber, an avidin-color enzyme solution chamber and a color developing solution chamber; the hybridization solution chamber is pre-provisioned with a hybridization solution; the observation chamber is provided with a hybridization membrane, and the hybridization membrane is fixed with nucleic acid probes; the avidin-color enzyme solution chamber is pre-provisioned with an avidin-color enzyme solution; the color developing solution chamber is pre-provisioned with a color developing solution; the hybridization and detection result visualization unit is in communication with the nucleic acid amplification unit through pipelines, and is configured to control the liquid flow between the hybridization solution chamber, the avidin-color enzyme solution chamber and the color developing solution chamber and the observation chamber, so as to realize the following steps: (a) mixing the nucleic acid amplification product with the hybridization solution in the hybridization solution chamber to obtain a nucleic acid hybridization solution; (b) flowing the nucleic acid hybridization solution into the observation chamber to hybridize with the nucleic acid probes fixed on the hybridization membrane, and removing the nucleic acid hybridization solution after hybridization; (c) then flowing the avidin-color enzyme solution into the observation chamber to contact with the hybridization membrane, so as to bind avidin with biotin, and remove the unreacted avidin-color enzyme; (d) flowing the color developing solution into the observation chamber to contact with the hybridization membrane, and developing the color developing substrate by the color enzyme to develop the nucleic acid probe position of the hybridization target pathogen nucleic acid.

8. The nucleic acid detection device of claim 7, wherein, The nucleic acid detection device further comprises a shell; the nucleic acid extraction unit, the nucleic acid amplification unit and the hybridization and detection result visualization unit are arranged in the shell and connected by pipelines in sequence; The pipelines are made of flexible material; at least one of the pipelines is provided with a stop valve; the stop valve comprises an operation part configured to close and open the pipeline; The operation part extends from the inside of the shell to the outside of the shell.

9. The nucleic acid detection device of claim 8, wherein, The inside of the sample pool, the nucleic acid release agent chamber, the hybridization solution chamber, the avidin-color enzyme solution chamber and the color developing solution chamber is provided with a liquid driving mechanism capable of outputting and / or recycling the liquid in the chamber.

10. The nucleic acid detection device of claim 7, wherein, The nucleic acid extraction unit further comprises a nucleic acid chamber configured to contain a nucleic acid extraction solution; and / or, The hybridization and detection result visualization unit further comprises a rinsing solution chamber pre-provisioned with a rinsing solution.

Images