Molecular marker for detecting characteristics of ear length and ear density of barley and application of molecular marker

Abstract

The invention belongs to the field of molecular breeding, and particularly provides a molecular marker capable of being used for assisting in detecting different ear length and ear density characters of barley and application of the molecular marker, SNP of the molecular marker is located on the 301500502 site of a 7H chromosome of a six-rowed barley Morex.v2 genome and is closely linked with a major QTL site QSc / Sl.cib-7H of the ear length and the ear density, the polymorphism is G / A, the basic group in a long-ear and low-ear-density barley material is G, and the molecular marker can be used for detecting different ear length and ear density characters of barley. The basic group in the barley material with short ear and high ear density is A; the KASP7H301500502 marker provided by the invention can be used for carrying out early generation detection on ear length and ear density characters in barley breeding, so that the workload is greatly reduced, the breeding period is greatly shortened, the economic cost is saved, the breeding efficiency is improved, and the marker has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of barley genetics and breeding technology, and relates to a marker for assisting in the detection of different spike length and spike density traits in barley and its application. Background Technology

[0002] Cultivated barley is one of the world's fourth largest food crops and a major source of feed and brewing ingredients. Kernel number per spike (KNS), thousand-kernel weight (TKW), and spike number per unit area (SNPUA) are considered the three key factors for barley yield. Among these, kernel number per spike and thousand-kernel weight are significantly influenced by spike morphology. Spike length and spike density are crucial factors determining barley spike morphology and have a significant impact on kernel number per spike and thousand-kernel weight. Studies have shown a significant positive correlation between spike length and aboveground biomass, harvest index, and grain yield. Therefore, improving spike length and spike density traits is of great importance for breeding high-yielding barley. However, barley spike length and spike density are quantitative traits controlled by multiple genes and are greatly affected by environmental conditions. Using traditional breeding methods for selection is inefficient, labor-intensive, and costly.

[0003] Therefore, identifying QTLs closely associated with barley spike length and spike density phenotypes and developing molecular markers closely linked to them will play an important role in the genetic improvement of barley. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for detecting barley ear length and ear density traits and its application.

[0005] To achieve the aforementioned objectives, the technical solution adopted in this invention is: the application of an SNP molecular marker in detecting barley traits, wherein the SNP molecular marker is located at position 301500502 on chromosome 7H of the Morex.v2 genome of six-row barley, and its base type is G / A; the barley traits include: spike length and spike density. The genotype of the SNP molecular marker is any one of GG, GA, or AA.

[0006] Accordingly, a kit, test strip, or detection reagent for detecting barley traits includes specific primer pairs for amplifying the SNP molecular marker.

[0007] Accordingly, a set of primer pairs includes: 301500502-allele1, as shown in SEQ ID NO: 2; 301500502-allele2, as shown in SEQ ID NO: 3; and 301500502-com, as shown in SEQ ID NO: 4.

[0008] Preferably, the application of the kit, test strip, or detection reagent or the primer pair in detecting barley traits, including spike length and spike density, includes the following steps:

[0009] (1) Extract genomic DNA from the barley to be tested;

[0010] (2) Genomic DNA was amplified by PCR using primer pairs to obtain PCR amplification products; the PCR amplification reaction system included: genomic DNA of the barley to be tested, Master Mix and the primer pairs. The PCR amplification reaction program included: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61-55℃ for 60 sec, for a total of 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for a total of 26 cycles;

[0011] (3) Analyze the PCR amplification products to determine the genotype of the SNP molecular marker in the barley to be tested.

[0012] If the SNP molecular marker site is detected as GG, the barley is identified as long-spike, low-spike-density barley; if the SNP site is detected as AA, the barley is identified as short-spike, high-spike-density barley.

[0013] This invention has the following beneficial effects: This invention provides a SNP_301500502 most closely linked to QSc / Sl.cib-7H, located within a physical region of approximately 57 Mb between 244362750 and 301815730 on chromosome 7H. Figure 1 The specific location is on chromosome 7H of the Morex.v2 barley genome at position 301500502. Based on this, the inventors further transformed it into a KASP marker, KASP_7H_301500502, based on fluorescence signal recognition. Experiments based on thousands of individual plants showed that its genotyping results co-segregated with spike length and spike density phenotypes (100% association). Therefore, this marker has significant application potential in marker-assisted selection.

[0014] QSc / Sl.cib-7H is the core QTL utilized in this invention. Its physical location exhibits extremely strong recombination inhibition, making chromosome exchange very difficult. The inventors' research group previously used 4800 individual plants, but still struggled to narrow down the localization interval by screening recombinant individuals. Therefore, for a long time, the inventors' research group could only locate QSc / Sl.cib-7H within a physical interval of approximately 144MB between chromosomes 244362750 and 388094169 on barley 7H. This large interval limited its application.

[0015] Through long-term, continuous experimentation, the inventors further expanded the localization population and accidentally obtained a crucial recombination exchange single plant. Using this plant, they further narrowed the localization interval of QSc / Sl.cib-7H to a physical interval of approximately 57 MB between 244362750 and 301815730, a reduction of nearly 90 MB compared to the previous 144 MB, achieving a significant success in localization. This process was largely due to luck; it would have been difficult to replicate using conventional localization methods and simple experiments.

[0016] Therefore, this invention greatly improves the accuracy of QSc / Sl.cib-7H localization. The SNPs provided are more closely linked to QSc / Sl.cib-7H, and their physical locations are closer to the target gene. The genotyping results are more accurate, and the application value in breeding is higher. This greatly increases the research and application value of this QTL.

[0017] Compared with existing conventional detection technologies, the KASP detection system provided by this invention has the following advantages:

[0018] (1) High efficiency and accuracy in detection: Only the total DNA of barley material needs to be extracted, and the data can be analyzed through the CFX Connect real-time system after PCR amplification. The operation process is simple, the detection cycle is short, and the genotype determination accuracy is high.

[0019] (2) Significantly reduced costs: No enzyme digestion and electrophoresis detection steps are required throughout the experiment, which greatly reduces reagent consumption and reduces time and labor costs in the detection process.

[0020] (3) High value for breeding applications: Ear length and ear density are key agronomic traits that affect barley yield. The KASP detection system developed based on SNP markers in this invention can be used for early-generation screening of ear length and ear density traits during the breeding process, effectively reducing the workload of breeding, significantly improving the efficiency of breeding selection, and has broad application prospects. Attached Figure Description

[0021] Figure 1A schematic diagram showing the location of QSc / Sl.cib-7H and the screening of its most closely linked SNP marker SNP_301500502;

[0022] Figure 2 This diagram illustrates the genotyping results of molecular marker KASP_7H_301500502 on XQ669 (short spike, high spike density parent), CDB25 (long spike, low spike density parent), heterozygous genomic DNA (a mixture of equal amounts of XQ669 and CDB25 DNA), and some individuals in the RIL population; where base A represents short spike, high density material; and base G represents long spike, low density material.

[0023] Figure 3 This is a schematic diagram illustrating the statistical analysis of genotypes and corresponding spikelet length, spikelet density, and spikelet number phenotypic data of 138 families in the RIL population after genotyping based on the KASP_7H_301500502 marker. Detailed Implementation

[0024] This invention provides a SNP marker associated with barley spike length and spike density traits. The SNP is located at nucleotide 301500502 on chromosome 7H of the Morex.v2 barley genome, and its flanking sequence is shown in SEQ ID NO: 1. This SNP is SNP_301500502, which is highly closely linked to QSc / Sl.cib-7H.

[0025] SEQ ID NO.1:

[0026] TTTGGAGATGGGTTGCTTCAAATAGGGAAGAAATTTGCAATCGATATGTGTATTATCTGGC

[0027] CGGCCAATGTAACCCCGGATACAGCCGATTCAATCCATGTGGGAGCCTGGCGATGGACAAA

[0028] ATGTCGTCGAGGATGGGCTGCTCGACCTGTTAATGCCAGGATGGTGCAGCGTTGCCTCAGG

[0029] GTTGCATCCATGGAGAGGACTAGGGAGCAGCAGTACGCTCGGCGGCGTGGATCGCAGGAGGAAGAGTGAGAAGGAAGCTGGTCGGGGTGGTGAAGGTGCGAGGCAGATGGGTTCGCG[G / A]TGAGGTCGCGTGGCGAGGCGGGCATAGTTGACCGGTGGAATCTTGATGAGAAGCGACGGAACATACCATAGGCATAGGTGATGAGGGGGC GCCGGAGCAGGATGGGTTGGAGGTCAGGCCTCTCGCAAAATCTGGCAATCTCGACCTAGGACGAGTTGCCAAGCAGGCCGGGATCTCTTCCATGGTTATGTTGCGTCCTCCAGTAGCCACCAGGCCGAGCGTCGTGTAGATGGACAACGACAAGCAGCGGGGTGTGAAGGGGATCTGGGAGAGGTGGAGCAGATTGGCCGGTGATGGCTAC.

[0030] The base type of the SNP marker is G / A. In long-spike, low-spike-density barley materials, the base at this site is G; in short-spike, high-spike-density barley materials, the base at this site is A. Therefore, if the SNP site is detected as GG, the barley is identified as long-spike, low-spike-density barley; if the SNP site is detected as AA, the barley is identified as short-spike, high-spike-density barley; if the SNP site is detected as GA, it indicates that the site is heterozygous, and the tested line will exhibit the dominant trait, i.e., long spikes, low spike density, but the offspring of self-pollination will show segregation of spike length and spike density.

[0031] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the data obtained are all average values ​​obtained after at least three repetitions, and each repetition yields valid data.

[0032] Example

[0033] 1. Barley genomic DNA was extracted using the CTAB method. The extraction steps included:

[0034] Take an appropriate amount of fresh, young leaves, flash-freeze them in liquid nitrogen, and grind them into a fine powder. Immediately add 800 μL of 2×CTAB extraction solution preheated to 65℃ and mix thoroughly. Incubate in a 65℃ water bath for 1 hour, shaking every 10 minutes to ensure thorough mixing of the leaf powder and CTAB extraction solution. After the water bath, add an equal volume of chloroform, mix for 10 minutes, centrifuge for 10 minutes at 12000 rpm, and carefully transfer 500 μL of the supernatant to a new 2 mL centrifuge tube, being careful not to aspirate any impurities. Repeat this step once.

[0035] Add 500 μL of pre-chilled isopropanol (pre-cooled to -20°C) to the aspirated supernatant, gently shake the centrifuge tube to precipitate DNA, and incubate at -20°C for two hours. After incubation, centrifuge at 4°C for 15 minutes and discard the supernatant. Do not discard the white DNA precipitate at the bottom of the tube. Add 200 μL of 75% ethanol to the DNA precipitate and wash twice, then wash once with anhydrous ethanol. After washing, open the cap and allow to stand, or place in a fume hood to dry any residual ethanol. Then add 50-80 μL of sterile water to completely dissolve the DNA precipitate. Test the DNA concentration and purity, and store at 4°C or -20°C. Avoid repeated freeze-thaw cycles during use.

[0036] 2. PCR amplification

[0037] KASP marker primers were designed using the SNP markers provided in this invention, and the KASP marker primers were used to amplify DNA by PCR. The KASP detection system consists of two core components: Primer Mix and Master Mix. Primer Mix contains three specific primers: two forward primers with different detection primer sequences at their 5' ends and 3' terminal bases corresponding to different alleles of the target SNP, and a universal reverse primer. Master Mix integrates two specific fluorescent primers that can specifically bind to the above detection primer sequences and emit different fluorescent signals. The nucleotide sequences of the KASP marker primers are shown in SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, and the PCR amplification reaction system is shown in Table 1.

[0038] SEQ ID NO: 2: 301500502-allele1

[0039] 5'-GAAGGTGACCAAGTTCATGCTAGGCAGATGGGTTCGCGG-3';

[0040] SEQ ID NO:3:301500502-allele2

[0041] 5'-GAAGGTCGGAGTCAACGGATTAGGCAGATGGGTTCGCGA-3';

[0042] SEQ ID NO: 4: 301500502-com

[0043] 5'-GGTATGTTCCCGTCGCTTCTCA-3'.

[0044] Table 1 PCR amplification reaction system

[0045] Element Input DNA 100-150ng Master Mix 5μL KASP primer combination Total 0.6μL <![CDATA[ddH2O]]> Add to a final volume of 10 μL

[0046] The KASP primer combination consists of: primer allele-1 0.15 μL (10 μmol), primer allele-2 0.15 μL (10 μmol), and primer com 0.3 μL (10 μmol).

[0047] PCR reactions were performed in an Eppendorf Mastercycler PCR instrument (Eppendorf, Germany). Reaction conditions: activation at 94℃ for 15 min; denaturation at 94℃ for 20 sec, annealing at 61–55℃ for 60 sec (decreasing by 0.6℃ per cycle), for a total of 10 cycles; denaturation at 94℃ for 20 sec, annealing at 55℃ for 60 sec, for a total of 26 cycles.

[0048] The results data were read using the CFX Connect real-time system, and the results are as follows: Figure 2 As shown in this embodiment, 138 families in the RIL population constructed from the XQ669 (short spike, high spike density) × CDB25 (long spike, low spike density) cross were genotyped using the KASP marker. Based on the genotype analysis results, the materials were divided into a short spike, high spike density group and a long spike, low spike density group. The results showed that there were 60 lines in the short spike, high spike density group (KASP_7H_301500502 genotype result: base A, recessive allele), and 78 lines in the long spike, low spike density group (KASP_7H_301500502 genotype result: base G, dominant allele).

[0049] 3. Phenotypic Statistics and Analysis

[0050] Five individual plants were randomly selected from each family, and the main ear of each plant was selected for phenotypic evaluation of ear length, number of spikelets, and ear density. Ear length and number of spikelets were measured manually; ear density = number of spikelets ÷ ear length. The mean of the phenotypic values ​​of the five individual ears in each family was used as the phenotypic value of that family.

[0051] The results are as follows Figure 3As shown in the figure. Statistical analysis and comparison of spikelet length, spikelet number, and spikelet density traits of the two groups of tested materials revealed that there was no significant statistical difference in spikelet number between the two families; however, the spikelet length of the families with high spikelet density was significantly shorter than that of the families with low spikelet density, showing a negative correlation between spikelet length and spikelet density.

[0052] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Any modifications, alterations, substitutions, or variations made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.

Claims

1. Use of a SNP molecular marker in the detection of a barley trait, characterized in that: The SNP molecular marker is located at position 301500502 of 7H chromosome of Morex.v2 genome of barley, and the base type is G / A; the barley traits include ear length and ear density.

2. Use according to claim 1, characterized in that: The genotype of the SNP molecular marker is any one of GG, GA or AA.

3. A kit, test strip or test reagent for barley trait detection, characterized in that: The kit or detection test paper or detection reagent comprises a specific primer pair for amplifying the SNP molecular marker according to claim 1 or 2.

4. A set of primer pairs, characterized in that: The primer pair comprises: 301500502-allele1 as shown in SEQ ID NO: 2; 301500502-allele2 as shown in SEQ ID NO: 3; and 301500502-com as shown in SEQ ID NO:

4.

5. The use of the kit, test strip or test reagent of claim 3, or the primer pair of claim 4 for detecting a trait in barley, characterized in that: The barley traits include ear length and ear density.

6. Use according to claim 5, characterized in that: The application comprises the following steps: (1) extracting the genomic DNA of the barley to be tested; (2) performing PCR amplification on the genomic DNA by using the primer pair to obtain a PCR amplification product; (3) analyzing the PCR amplification product to determine the genotype of the SNP molecular marker of the barley to be tested, wherein the SNP molecular marker is located at position 301500502 of 7H chromosome of Morex.v2 genome of barley, and the base type is G / A.

7. Use according to claim 6, characterized in that: The reaction system of the PCR amplification comprises the genomic DNA of the barley to be tested, Master Mix and the primer pair.

8. Use according to claim 6, characterized in that: The reaction procedure of the PCR amplification comprises 15 min of activation at 94℃, 10 cycles of denaturation at 94℃ for 20 sec, annealing at 61-55℃ for 60 sec, 26 cycles of denaturation at 94℃ for 20 sec and annealing at 55℃ for 60 sec.

9. Use according to claim 6, characterized in that: If the SNP molecular marker is detected to be GG, the barley is identified as a long-ear, low-ear-density barley; if the SNP marker is detected to be AA, the barley is identified as a short-ear, high-ear-density barley.

Images