Rhodococcus etherivorans and application thereof
The isolated and identified Rhodococcus aetherivorans Nit-X solves the problem of insufficient degradation capacity of existing nitrile hydrolase strains for methoxybenzonitrile, achieving highly efficient hydrolysis of methoxybenzonitrile and catalysis of various nitrile compounds, with the characteristics of high efficiency and environmental friendliness.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-09
- Publication Date
- 2026-03-27
AI Technical Summary
Existing nitrile hydrolase strains have insufficient ability to degrade aromatic nitriles containing substituents such as methoxy groups, have a narrow substrate spectrum, and low catalytic efficiency. This results in harsh conditions, high energy consumption, and significant environmental pollution when preparing p-methoxybenzoic acid by chemical hydrolysis of p-methoxybenzonitrile.
A strain of Rhodococcus aetherivorans Nit-X was isolated and identified. This strain can efficiently hydrolyze p-methoxybenzonitrile to p-methoxybenzoic acid under mild conditions and exhibits broad hydrolytic activity in nitrile compounds. Its whole cells or lysate were used as catalysts.
It achieves high-conversion hydrolysis of p-methoxybenzonitrile, exhibits catalytic activity for a variety of nitrile compounds, especially showing preference for aromatic nitrile substrates, and is highly efficient and environmentally friendly.
Smart Images

Figure CN121736982A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and biocatalysis, specifically relating to a type of Rhodococcus ethereinus and its applications. Background Technology
[0002] Nitrilases (EC 3.5.5.1) are widely found in microorganisms, plants, and some animals, belonging to the carbon-nitrogen hydrolase superfamily. Their main function is to directly catalyze the hydrolysis of nitrile compounds (RC≡N) to produce the corresponding carboxylic acids (R-COOH) and ammonia (NH3). This catalytic process exhibits high chemoselectivity, regioselectivity, and stereoselectivity, and the hydrolysis reaction does not produce amide intermediates. It can efficiently convert nitrile compounds to carboxylic acids in one step, thus demonstrating unique advantages and application potential in the field of biocatalysis. Nitrilases operate under mild conditions (room temperature, atmospheric pressure, near-neutral pH), are environmentally friendly (avoiding the use of strong acids / bases and high temperatures and pressures), produce few byproducts, and possess excellent chiral selectivity, making them valuable in chemical synthesis, especially in the synthesis of chiral compounds. Nitrile hydrolases have become key enzymes in green chemistry and biomanufacturing for the synthesis of high-value-added chiral carboxylic acids (such as pharmaceutical intermediates, agrochemicals, fine chemicals, and functional material monomers) and for the bioremediation of nitrile pollutants in the environment (such as nitrile herbicides and nitrile compounds in industrial wastewater). Research and development of novel nitrile hydrolases will not only help elucidate their catalytic mechanisms and structure-function relationships but will also promote their efficient application in industrial biotechnology.
[0003] p-Methoxybenzonitrile is an important chemical intermediate, but it has certain biological toxicity and can cause pollution when it enters the environment. p-Methoxybenzoic acid, on the other hand, is a high-value fine chemical widely used in the pharmaceutical, fragrance, and cosmetic industries. Currently, the chemical hydrolysis of p-methoxybenzonitrile to prepare p-methoxybenzoic acid usually suffers from problems such as harsh reaction conditions, high energy consumption, the need for strong acids and bases, and significant environmental pollution.
[0004] Biocatalysis, particularly the use of microbial nitrile hydrolases, can specifically hydrolyze nitrile compounds into their corresponding carboxylic acids under mild conditions, offering advantages such as mild conditions, high selectivity, and environmental friendliness. However, existing strains generally suffer from narrow substrate spectra and low catalytic efficiency, especially insufficient degradation capacity for aromatic nitrile compounds containing methoxy or other substituents. Therefore, isolating and screening a new strain with a broad substrate spectrum that can efficiently degrade p-methoxybenzonitrile and produce high yields of p-methoxybenzoic acid has significant industrial application and environmental remediation value. Summary of the Invention
[0005] The present invention aims to provide a strain of *Rhodococcus ethereans* isolated from the natural environment and applied to the hydrolysis of nitrile compounds. This strain can efficiently degrade p-methoxybenzonitrile to p-methoxybenzoic acid and also exhibits a broad substrate spectrum of p-nitrile compounds.
[0006] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution: A species of Rhodococcus ethereans, with accession number CGMCC No. 35878, is deposited at the China General Microbiological Culture Collection Center.
[0007] This invention provides a novel strain—Rhodococcus ethereans ( Rhodococcus aetherivorans Nit-X was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35878. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.
[0008] The present invention also provides a characteristic M13-PCR fingerprint of the aforementioned Rhodococcus ethereicus.
[0009] Preferably, the 16S rDNA gene sequence of the *Rhodococcus ethere* is shown in SEQ ID NO.1.
[0010] Preferably, the *Rhodococcus ethere* rpoB The gene sequence is shown in SEQ ID NO.2.
[0011] The application of Rhodococcus ether-eating as described above in the catalytic degradation of nitrile compounds.
[0012] Preferably, the method of application is as follows: By culturing Rhodococcus ethereans and using its wet cells or cell lysate as a catalyst, a nitrile compound is used as a substrate to carry out a catalytic reaction to obtain a carboxylic acid compound.
[0013] Preferably, the nitrile compound is any one or a combination of p-methoxybenzonitrile, benzonitrile, phenylacetonitrile, acrylonitrile, 3-cyanopyridine, adiponitrile, and butyronitrile.
[0014] As a further preferred embodiment, the nitrile compound is a combination of p-methoxybenzonitrile and benzonitrile.
[0015] Preferably, the amount of the nitrile compound added is 1~10 g / L.
[0016] As a further preferred embodiment, the amount of the nitrile compound added is 1 g / L.
[0017] Preferably, the cell density OD in the catalytic reaction system 600 The value is 10~20.
[0018] As a further preferred embodiment, the cell density OD in the catalytic reaction system 600 The value is 15.
[0019] Preferably, the pH of the catalytic reaction system is 6-8; and the temperature of the catalytic reaction is 20-40 °C.
[0020] As a further preferred embodiment, the pH of the catalytic reaction system is 7.5; and the temperature of the catalytic reaction is 30 °C.
[0021] Therefore, the present invention has the following beneficial effects: (1) The Rhodococcus ethereing strain of the present invention can effectively degrade p-methoxybenzonitrile to produce p-methoxybenzoic acid, with a high hydrolysis conversion rate; (2) The Rhodococcus etherein strain of the present invention also exhibits hydrolytic activity against other nitrile compounds, demonstrating unique hydrolytic activity against nitrile compounds. Attached Figure Description
[0022] Figure 1 The image shows the TLC analysis results of the screening culture medium for strain Nit-X.
[0023] Figure 2 For strain Nit-X rpoB Image showing the PCR amplification results of the gene.
[0024] Figure 3 for rpoB The results of BLAST analysis of the gene sequence.
[0025] Figure 4 The M13-PCR amplification fingerprint of Rhodococcus ethereans.
[0026] Figure 5 A graph showing the hydrolysis of p-methoxybenzonitrile by Rhodococcus etheris at different feed amounts.
[0027] Figure 6 This is the HPLC chromatogram of the catalytic reaction solution.
[0028] Figure 7 A comparative graph showing the hydrolytic activity of Rhodococcus etheris on other nitrile compounds. Detailed Implementation
[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0030] The reagents used in the following examples are as follows: Physiological saline: NaCl 9.0 g / L.
[0031] LB liquid medium: yeast extract 5.0 g / L, peptone 10.0 g / L, NaCl 10.0 g / L.
[0032] Selective screening medium: glucose 5 g / L, KH2PO4 1 g / L, MgSO4 0.1 g / L, FeSO4 0.03 g / L, CaCl2 0.02 g / L, NaCl 1 g / L, p-methoxybenzonitrile 1 g / L, pH 7.5.
[0033] Fermentation medium: glucose 10 g / L, peptone 5 g / L, yeast extract 5 g / L, KH2PO4 2 g / L, MgSO4 0.1 g / L, FeSO4 0.03 g / L, NaCl 1 g / L.
[0034] 100 mmol / L Phosphate Buffer (pH 7.5): Accurately weigh 7.16 g of disodium hydrogen phosphate dodecahydrate (Na2HPO4·12H2O) and 3.12 g of sodium dihydrogen phosphate dihydrate (NaH2PO4·2H2O) solids, and dissolve them separately in 100 mL of ultrapure water to prepare stock solutions. Measure 72 mL of the disodium hydrogen phosphate dodecahydrate (Na2HPO4·12H2O) stock solution and 28 mL of the sodium dihydrogen phosphate dihydrate (NaH2PO4·2H2O) stock solution, mix them thoroughly, and then add an equal volume of ultrapure water.
[0035] Standard 1 g / L p-methoxybenzonitrile solution: 1 g / L p-methoxybenzonitrile, 5% (v / v) methanol.
[0036] Standard 1 g / L p-methoxybenzoic acid solution: 1 g / L p-methoxybenzoic acid, 5% (v / v) methanol.
[0037] Example 1: Screening for methoxybenzonitrile-degrading bacteria Soil sampling and pretreatment. Soil samples were collected from farmland in Wuhu City, Anhui Province. 1 g of soil sample was added to 10 mL of sterile 0.9% NaCl solution containing a small amount of glass beads and thoroughly mixed by shaking at 120 rpm for 30 min to obtain a soil suspension.
[0038] Enrichment culture and bacterial isolation. 200 μL of the above soil sample suspension was added to a selective selection medium containing 1 g / L p-methoxybenzonitrile for enrichment culture, and cultured on a shaker at 30 ℃ and 120 rpm for 3 days. 1 mL of the enriched culture was inoculated into a selective selection medium with a p-methoxybenzonitrile concentration increased to 2 g / L, and enrichment culture was continued for 48 hours. The further enriched bacterial culture was serially diluted with sterile physiological saline, and 100 μL of each dilution was plated on LB agar plates and incubated at 30 ℃ for 24 h. Single colonies from plates with 50-100 colonies were streaked onto LB agar plates and incubated at 30 ℃ for 24 h.
[0039] Colony analysis and activity verification. Single colonies isolated by streaking were inoculated into liquid selective screening medium containing 1 g / L p-methoxybenzonitrile. After incubation at 30 °C on a shaker for 3 days, the supernatant was collected by centrifugation and used for thin-layer chromatography (TLC) analysis. The volume ratio of the components of the developing solvent for TLC was chloroform:acetone:isopropanol:methanol:ammonia = 3:3:1.5:1.5:1. The supernatant sample was aspirated by capillary tube and spotted onto a silica gel plate, placed in a developing tank, removed after 20 minutes, air-dried, and observed under a 254 nm UV lamp. For culture media that detected p-methoxybenzoic acid spots, such as... Figure 1 As shown, it was used for further HPLC analysis. Figure 1 The image shows the TLC analysis results of the screening culture medium for strain Nit-X.
[0040] The culture supernatant sample in which p-methoxybenzoic acid was detected was mixed with methanol at a volume ratio of 1:1, filtered through a 0.22 μm microporous membrane, and then used for HPLC analysis.
[0041] HPLC Analysis Conditions. High-performance liquid chromatography (HPLC) was used to detect nitrile substrates and their corresponding carboxylic acid products. Column type: C18 column (5 μm, 250 mm × 4.6 mm). Injection volume: 10 μL. Total flow rate: 1 mL / min. Mobile phase: water (0.1% trifluoroacetic acid) and acetonitrile. Gradient elution program: 0 min, 10% B; 5 min, 10% B; 15 min, 90% B; 20 min, 90% B; 21 min, 10% B; 25 min, 10% B. Flow rate: 1 mL / min. Column temperature: 30 °C. Detection wavelength: 254 nm.
[0042] Based on the results of thin-layer chromatography and liquid phase analysis, a strain with high catalytic activity, Nit-X, was isolated.
[0043] Example 2: Identification of strain Nit-X Genomic DNA was extracted from strain Nit-X. In Example 1, strain Nit-X, selected through screening, was inoculated into LB liquid medium and cultured overnight at 30 °C using a shaker. The bacterial culture was then used for genomic DNA extraction. DNA extraction was performed using a bacterial genomic DNA extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.).
[0044] 16S rDNA gene amplification and sequencing. Using Nit-X genomic DNA as a template, PCR amplification was performed using the following primers: 27F: 5'-AGAGTTTGATCCTGGCTCAG-3'; 1541R: 5'-AAGGAGGTGATCCAGCCGCA-3'.
[0045] PCR amplification was performed using the Phanta Max Super-Fidelity DNA Polymerase kit from Nanjing Novizan Biotechnology Co., Ltd., to obtain the 16S rDNA gene fragment. Sequencing was then performed by Beijing Qingke Biotechnology Co., Ltd. The 16S rDNA gene sequence is shown in SEQ ID NO.1, with a length of 1550 bp. BLAST alignment analysis of this sequence on the NCBI website showed that the 16S rDNA gene sequence of Nit-X had over 99.8% identity with the 16S rDNA gene sequences of the following bacterial species, including Rhodococcus faecalis (…). Rhodococcus ruber ) and Rhodococcus ethere Rhodococcus aetherivorans ).
[0046] rpoB Gene amplification and sequencing. Targeting rpoB Gene amplification, using rpoB -F / rpoB -R( rpoB -F: GAGGGTGGCGGTTCT, rpoB Using primers (-R: TCGGCTCCCTGTCGGTGTACG), PCR amplification was performed. The Phanta Max Super-Fidelity DNA Polymerase kit from Nanjing Novizan Biotechnology Co., Ltd. was used for PCR amplification to obtain... rpoB PCR fragments of genes, such as Figure 2 As shown. Figure 2 For strain Nit-X rpoB The image shows the PCR amplification results of the gene. Among them, Figure 2 The 1 in the image represents the PCR amplification band. Figure 2 The number 2 in the diagram represents the DNA marker. The PCR product was then sequenced by Beijing Qingke Biotechnology Co., Ltd. rpoB The gene sequencing results are shown in SEQ ID NO.2. The sequence was then aligned using BLAST on the NCBI website, and the results are as follows: Figure 3 As shown. Figure 3 for rpoB A graph showing the results of BLAST analysis of the gene sequence. Based on... rpoB Based on the gene sequence alignment results, strain Nit-X was identified as *Rhodococcus ethereans*. Rhodococcus aetherivorans ).
[0047] The strain was deposited on September 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35878, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.
[0048] Example 3: M13-PCR fingerprint amplification of Rhodococcus ethereans Amplification of the M13-PCR fingerprint of Rhodococcus etherealis. PCR amplification was performed using the M13 (GAGGGTGGCGGTTCT) primers. The reaction system consisted of: Mg... 2+The concentrations of the reagents were 3.5 mmol / L, primers 2.0 μmol / L, DNA template 2.0 ng / μL, dNTPs 200 μmol / L, and Taq DNA polymerase 2.5 U / 25 μL. The PCR reaction program was as follows: 94℃ for 3 min, 42℃ for 2 min, 72℃ for 3 min to start one cycle, followed by the following cycle program: 94℃ denaturation for 40 s, 42℃ for 20 s, 72℃ extension for 2 min, 35 cycles; 72℃ extension for 10 min. 15 μL of the PCR product was separated by 1.8% agarose gel electrophoresis (15 cm × 15 cm) at a constant voltage of 6.5 V / cm for 4 h. The M13-PCR fingerprint was obtained by staining with GoldView DNA dye and imaging under UV light. Figure 4 As shown. Figure 4 This is the M13-PCR amplification fingerprint of Rhodococcus etherealis. Among them, Figure 4 The 1 in the text represents a DNA marker. Figure 4 The number 2 in the M13-PCR amplification fingerprint is the fingerprint of the M13-PCR amplification.
[0049] Example 4: Application of Rhodococcus ethereans in the hydrolysis of p-methoxybenzonitrile Fermentation culture of *Rhodococcus etherealis*. *Rhodococcus etherealis* was inoculated onto LB solid medium and incubated overnight at 30 °C. Single colonies were picked and transferred to a shake flask containing 50 mL of LB liquid medium and incubated at 30 °C for 24 h on a shaker. At an inoculation rate of 2% (v / v), the culture was added to 50 mL of fermentation medium and incubated at 30 °C for 8–12 h on a shaker until OD (dose retardation). 600 When the concentration reaches approximately 0.4, add 1 g / L of p-methoxybenzonitrile solution to induce enzyme production. Induce fermentation in a shaker at 30 °C for 12-16 h, and then collect the fermentation broth.
[0050] Obtaining whole-cell suspension and crude enzyme solution of *Rhodococcus etherealis*. The collected fermentation broth was centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. The cells were washed twice with 100 mmol / L phosphate buffer (pH 7.5). The washed cells were resuspended in phosphate buffer to the desired cell density, which was the whole-cell suspension of *Rhodococcus etherealis*. Cell disruption was performed using high-pressure homogenization. The disrupted cell suspension was centrifuged at 5000 rpm for 10 min, and the resulting supernatant was the crude enzyme solution.
[0051] Catalytic reaction with a feed concentration of 1 g / L p-methoxybenzonitrile. Using the above-mentioned Rhodococcus etherealis fermentation broth, cell density OD was prepared. 600A whole-cell suspension or cell lysate of 15 g / L was added to p-methoxybenzonitrile, and the enzymatic reaction was carried out at 30 °C and pH 7.5. The pH of the reaction solution was controlled at 7.5 using an automatic pH titration device with 2 mol / L NaOH solution. After reacting in a water bath for 24 h, a 450 μL sample was taken, and 50 μL of 2 mol / L hydrochloric acid was added to terminate the reaction. Then, 500 μL of methanol was added, and the mixture was thoroughly mixed. After centrifugation at 12000 rpm for 3 min, the supernatant was collected and filtered through a 0.22 μm microporous membrane for HPLC analysis. The residual concentration of the substrate p-methoxybenzonitrile and the concentration of the product p-methoxybenzoic acid were detected, and the conversion rate was calculated. The conversion rates of the crude enzyme solution and the whole-cell suspension were 100% and 71%, respectively. Figure 5 As shown. Figure 5 A graph showing the hydrolysis of p-methoxybenzonitrile by Rhodococcus etheris at different feed amounts.
[0052] The catalytic reaction was carried out with a feed concentration of 5 g / L p-methoxybenzonitrile. Using the above-mentioned Rhodococcus etherealis fermentation broth, the cell density OD was prepared. 600 A 15g whole-cell suspension or cell lysate was added to a final concentration of 5g / L p-methoxybenzonitrile, and the enzymatic reaction was carried out at 30℃ and pH 7.5. The pH of the reaction solution was controlled at 7.5 using an automatic pH titration device with 2mol / L NaOH solution. After reacting in a water bath for 24 h, a 450 μL sample was taken, and the reaction was terminated by adding 50 μL of 2mol / L hydrochloric acid. Then, 500 μL of methanol was added, and the mixture was thoroughly mixed. The mixture was centrifuged at 12000 rpm for 3 min, and the supernatant was collected and filtered through a 0.22 μm microporous membrane for HPLC analysis. The analytical chromatogram is shown below. Figure 6 As shown, Figure 6 This is the HPLC chromatogram of the catalytic reaction solution. The residual concentration of the substrate p-methoxybenzonitrile and the concentration of the product p-methoxybenzoic acid were determined, and the conversion rate was calculated. The conversion rates of the crude enzyme solution and the whole cell suspension were 85% and 46%, respectively. Figure 5 As shown.
[0053] Catalytic reaction with a feed concentration of 10 g / L p-methoxybenzonitrile. Cell density OD was prepared using the above-mentioned Rhodococcus etherealis fermentation broth. 600A whole-cell suspension or cell lysate of 15 g / L was added to p-methoxybenzonitrile, and the enzymatic reaction was carried out at 30 °C and pH 7.5. The pH of the reaction solution was controlled at 7.5 using an automatic pH titration device with 2 mol / L NaOH solution. After reacting in a water bath for 24 h, a 450 μL sample was taken, and 50 μL of 2 mol / L hydrochloric acid was added to terminate the reaction. Then, 500 μL of methanol was added, and the mixture was thoroughly mixed. After centrifugation at 12000 rpm for 3 min, the supernatant was collected and filtered through a 0.22 μm microporous membrane for HPLC analysis. The residual concentration of the substrate p-methoxybenzonitrile and the concentration of the product p-methoxybenzoic acid were detected, and the conversion rate was calculated. The conversion rates of the crude enzyme solution and the whole-cell suspension were 32% and 13%, respectively. Figure 5 As shown.
[0054] Example 5: Application of Rhodococcus ethereans in the hydrolysis of other nitrile compounds The reaction was catalyzed by a feed concentration of 1 g / L benzonitrile, phenylacetonitrile, butyronitrile, adiponitrile, 3-cyanopyridine, and acrylonitrile. The fermentation culture method for *Rhodococcus etherealis* and the methods for obtaining the crude enzyme solution and whole cell broth were the same as in Example 4. The fermentation broth of *Rhodococcus etherealis* was collected, and the cell density OD was prepared. 600 Cell lysate at concentration 15 was used for the catalytic reaction of different nitrile compounds. Benzonitrile, phenylacetonitrile, acrylonitrile, 3-cyanopyridine, adiponitrile, and butyronitrile were added to each reaction system to a final concentration of 1 g / L, and the enzymatic reaction was carried out at 30 °C and pH 7.5. For each reaction solution, the pH was controlled to 7.5 using a 2 mol / L NaOH solution via an automatic pH titrator. After reacting in a water bath for 24 h, a 450 μL sample was taken, and the reaction was terminated by adding 50 μL of 2 mol / L hydrochloric acid. Then, 500 μL of methanol was added, and the mixture was thoroughly mixed. The mixture was centrifuged at 12000 rpm for 3 min, and the supernatant was collected and filtered through a 0.22 μm microporous membrane for HPLC analysis. The residual concentrations of each nitrile compound substrate and the concentration of carboxylic acid products were detected, and the conversion rates were calculated. The conversion rates of benzonitrile, phenylacetonitrile, butyronitrile, adiponitrile, 3-cyanopyridine, and acrylonitrile by *Rhodococcus etheris* at 1 g / L were 100%, 20%, 53%, 21%, 41%, and 61%, respectively. Figure 7 As shown. Figure 7 A comparative graph showing the hydrolytic activity of Rhodococcus ethereans to other nitrile compounds. It exhibits a preference for aromatic nitrile substrates, particularly benzonitrile derivatives.
[0055] HPLC Analysis Conditions. High-performance liquid chromatography (HPLC) was used to detect nitrile substrates and their corresponding carboxylic acid products. Column type: C18 column (5 μm, 250 mm × 4.6 mm). Injection volume: 10 μL. Total flow rate: 1 mL / min. Mobile phase: water (0.1% trifluoroacetic acid) and acetonitrile. Gradient elution program: 0 min, 10% B; 5 min, 10% B; 15 min, 90% B; 20 min, 90% B; 21 min, 10% B; 25 min, 10% B. Flow rate: 1 mL / min. Column temperature: 30 °C. Detection wavelength: 254 nm.
[0056] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention.
Claims
1. A type of Rhodococcus ethereicus, characterized in that, Its accession number is CGMCC No. 35878, and it is deposited at the China General Microbiological Culture Collection Center.
2. The *Rhodococcus ethereans* according to claim 1, characterized in that, Its 16S rDNA gene sequence is shown in SEQ ID NO.
1.
3. The *Rhodococcus ethereans* according to claim 1, characterized in that, Its rpoB gene sequence is shown in SEQ ID NO.
2.
4. The application of Rhodococcus ether-eating as described in any one of claims 1 to 3 in the catalytic degradation of nitrile compounds.
5. The application according to claim 4, characterized in that, The method of application is as follows: By culturing Rhodococcus ethereans and using its wet cells or cell lysate as a catalyst, a nitrile compound is used as a substrate to carry out a catalytic reaction to obtain a carboxylic acid compound.
6. The application according to claim 5, characterized in that, The nitrile compound is any one or a combination of p-methoxybenzonitrile, benzonitrile, phenylacetonitrile, acrylonitrile, 3-cyanopyridine, adiponitrile, and butyronitrile.
7. The application according to claim 5 or 6, characterized in that, The amount of the nitrile compound added is 1~10 g / L.
8. The application according to claim 5, characterized in that, Cell density OD in the catalytic reaction system 600 The value is 10~20.
9. The application according to claim 5, characterized in that, The pH of the catalytic reaction system is 6-8; the temperature of the catalytic reaction is 20-40 °C.