Alpha-L-rhamnosidase mutant capable of efficiently converting hesperidin and application of alpha-L-rhamnosidase mutant

Abstract

The invention discloses an alpha-L-rhamnosidase mutant capable of efficiently converting hesperidin and application of the alpha-L-rhamnosidase mutant, and belongs to the technical field of gene engineering and enzyme engineering. The amino acid sequence of the alpha-L-rhamnosidase mutant is shown as SEQ ID NO.11. Compared with a wild type, the alpha-L-rhamnosidase mutant has the advantages that the hesperidin catalytic efficiency is improved by 195%, and the catalytic constant Kcat value is improved by 58.2%. In practical application, the conversion rate of the mutant D190F to hesperidin reaches 36.44%, the generation rate of the product hesperetin monoglucoside is 20.34% and is 1.22 times and 1.98 times that of a wild type, and the technical bottlenecks that natural enzyme is low in catalytic efficiency and long in conversion period are effectively solved. The mutant shows excellent stability within the pH range of 4.0-6.0, the relative enzyme activity is kept at 85% or above, the mutant can adapt to environmental fluctuation of industrial production, and the stability of a reaction system is ensured.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and enzyme engineering, and in particular to an α-L-rhamnosidase mutant that efficiently converts hesperidin and its applications. Background Technology

[0002] α-L-rhamnosidase (EC 3.2.1.40) is a glycoside hydrolase that specifically hydrolyzes terminal α-L-rhamnosidic bonds, and has wide applications in the food, pharmaceutical, and feed industries. Particularly in the conversion of citrus flavonoids, this enzyme can efficiently hydrolyze hesperetin, removing its terminal rhamnosyl group to generate hesperetin-7-O-glucoside (HMG), which has significantly improved bioavailability. Compared with the problems of low product purity and poor safety associated with traditional chemical synthesis methods and extremely low yields from natural extraction methods, enzymatic conversion has become the mainstream technology for the industrial production of HMG due to its advantages of mild conditions, high specificity, and environmental friendliness.

[0003] However, in practical industrial applications, α-L-rhamnosidases from natural sources or those already reported still face significant performance bottlenecks. The core issue lies in the generally low catalytic activity (enzyme activity) of the substrate hesperidin, leading to low bioconversion efficiency, long production cycles, and high costs, making it difficult to meet the stringent economic and efficiency requirements of large-scale industrial production. The underlying reason for this problem is that the catalytic sites of natural enzymes and their interaction modes with substrates may not be optimized for the specific substrate hesperidin; their substrate binding capacity, catalytic efficiency, and stability in the reaction system all need improvement.

[0004] Although protein engineering offers the possibility of improving enzyme performance, there are currently few reports on molecular modification studies targeting α-L-rhamnosidase, particularly its efficient conversion of hesperidin. Therefore, obtaining an α-L-rhamnosidase mutant with higher catalytic activity and better stability for hesperidin through molecular modification has become a core technical problem urgently needing to be solved to overcome the bottleneck of large-scale HMG production. Providing such a mutant is of vital importance for improving biotransformation efficiency, reducing production costs, and promoting the green manufacturing process of functional foods and pharmaceutical raw materials. Summary of the Invention

[0005] The purpose of this invention is to provide an α-L-rhamnosidase mutant for the efficient conversion of hesperidin and its applications, thereby addressing the problems existing in the prior art. The α-L-rhamnosidase mutant D190F provided by this invention exhibits significantly improved catalytic efficiency while maintaining good pH stability, effectively overcoming the technical bottleneck of low catalytic efficiency of natural enzymes and providing a highly efficient biocatalyst for the large-scale production of hesperidin monoglucoside.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides an α-L-rhamnosidase mutant, the amino acid sequence of which is shown in SEQ ID NO.11.

[0008] The present invention also provides a gene encoding the α-L-rhamnosidase mutant.

[0009] The present invention also provides a recombinant vector containing the said gene.

[0010] The present invention also provides an engineered bacterium comprising the recombinant vector.

[0011] Optionally, the engineered bacteria is Pichia pastoris.

[0012] The present invention also provides the application of the α-L-rhamnosidase mutant, the gene, the recombinant vector, or the recombinant bacteria in improving the catalytic efficiency of α-L-rhamnosidase.

[0013] Optionally, improving the catalytic efficiency of the α-L-rhamnosidase means improving the efficiency of the α-L-rhamnosidase in catalyzing the formation of hesperidin monoglucoside from hesperidin.

[0014] The present invention also provides the application of the α-L-rhamnosidase mutant, the gene, the recombinant vector, or the recombinant bacteria in improving the production efficiency of hesperidin monoglucoside.

[0015] The present invention also provides a method for improving the production efficiency of hesperidin monoglucoside, comprising using the α-L-rhamnosidase mutant to catalyze the production of hesperidin monoglucoside from hesperidin.

[0016] Optionally, the catalytic reaction temperature is 60°C and the pH value is 5.

[0017] The present invention discloses the following technical effects:

[0018] The α-L-rhamnosidase mutant D190F provided by this invention exhibits significantly improved catalytic performance compared to the wild-type enzyme. Experimental data show that the catalytic efficiency (Kcat / Km) of this mutant for hesperidin reaches 659.51 mM⁻¹·s⁻¹.-1 Compared to the wild type, the efficiency was increased by 195%, and the catalytic constant Kcat value was increased by 58.2%. In practical applications, the mutant D190F achieved a conversion rate of 36.44% for hesperidin and a production rate of 20.34% for hesperidin monoglucoside, which are 1.22 times and 1.98 times that of the wild type, respectively, effectively solving the technical bottlenecks of low catalytic efficiency and long conversion cycle of natural enzymes.

[0019] This mutant exhibits excellent stability within a pH range of 4.0-6.0 while maintaining its optimal pH of 5.0, with relative enzyme activity remaining above 85%. This characteristic allows it to adapt to environmental fluctuations in industrial production, ensuring the stability of the reaction system. This invention achieves a significant improvement in enzyme catalytic performance through single-point mutation, providing a highly efficient and stable biocatalyst for the large-scale production of hesperidin monoglucoside, which is of great significance for promoting the green manufacturing of functional foods and pharmaceutical raw materials. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The diagram shows the relative enzyme activity of α-L-rhamnosidase between wild-type and mutant.

[0022] Figure 2 Figure showing the optimal temperature determination of wild-type and mutant D190F enzymes;

[0023] Figure 3 Figure showing the effect of different temperatures on the activity and stability of wild-type and mutant D190F enzymes;

[0024] Figure 4 Graph showing the optimal pH for wild-type and mutant D190F enzymes;

[0025] Figure 5 Figure showing the effect of different pH values ​​on the enzyme activity stability of wild-type and mutant D190F;

[0026] Figure 6 This is the HPLC chromatogram of hesperidin standard;

[0027] Figure 7 This is the HPLC chromatogram of hesperidin monoglucoside standard;

[0028] Figure 8 The HPLC chromatogram shows the catalytic results of the wild-type enzyme solution.

[0029] Figure 9 The image shows the HPLC chromatogram of the enzyme solution catalyzed by the mutant D190F.

[0030] Figure 10 This is a comparison of the product generation rates of wild-type and mutant α-L-rhamnosidase. Detailed Implementation

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0036] The culture media and solutions involved in the embodiments of this invention are as follows:

[0037] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;

[0038] YPD medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L;

[0039] Solid culture medium is prepared by adding 1.5% agar powder to the original formula.

[0040] BMGY: Yeast extract 10g / L, peptone 20g / L, glycerin 20g / L.

[0041] BMMY yeast extract 10g / L, peptone 20g / L.

[0042] Phosphate buffer: Adjust the pH to 3.0–9.0 by mixing 50 mM Na2HPO4 and 50 mM citric acid, and store at 4°C for later use.

[0043] The HPLC determination methods for hesperidin and hesperidin monoglucoside in this invention are as follows:

[0044] HPLC was performed using a C18 reversed-phase bonded silica column (4.6 mm × 250 mm, 5 μm), with a mobile phase of 0.1% formic acid aqueous solution.

[0045] Liquid (A) and methanol (B), gradient elution program (percentages are volume fractions, 0-5 min, 20% B; 5-20 min, 20%-70% B; 20-25 min, 70%-50% B; 25-26 min, 50%-20% B; 26-30 min, 20% B); UV detection wavelength: 283 nm; flow rate: 0.8 mL / min; column temperature: 30 ℃; injection volume: 20 μL.

[0046] Example

[0047] 1. Construction of mutants

[0048] 1.1 Gene Design and Plasmid Construction

[0049] Using the wild-type α-L-rhamnosidase gene (GenBank: KC750908.1) sequence as a template, the full-length gene (SEQ ID NO.1) was synthesized after codon optimization and cloned into the pPIC9K vector to obtain the recombinant plasmid pPIC9K-WT, whose encoded amino acid sequence is shown in SEQ ID NO.2.

[0050] SEQ ID NO.1:

[0051]

[0052] SEQ ID NO.2:

[0053] MWSSWLLSALLATEALA (The underlined part is the signal peptide).

[0054] 1.2 Site-directed mutagenesis primer design

[0055] Using bioinformatics analysis and homology modeling comparison, the following mutation sites were designed by altering some amino acids in the α-L-rhamnosidase molecule:

[0056] (1)D190F: The amino acid corresponding to site 207 on SEQ ID NO.2 is mutated from aspartic acid (D) to phenylalanine (F);

[0057] (2)T199V: The amino acid corresponding to site 216 on SEQ ID NO.2 is mutated from threonine (T) to valine (V);

[0058] (3)S200M: The amino acid corresponding to site 217 on SEQ ID NO.2 is mutated from serine (S) to methionine (M);

[0059] (4) H524F: The amino acid corresponding to site 541 on SEQ ID NO.2 is mutated from histidine (H) to phenylalanine (F).

[0060] Single-point mutation primers were designed for each mutation site (sequences are shown in Table 1), and site-directed mutagenesis was performed using reverse PCR.

[0061] Table 1. Primer sequences for site-directed mutagenesis

[0062] Primer name Sequence (5'-3') SEQ ID NO. D190F-F ATTGACCCAACCACTGGTTTTGCTTTTGGTTGGTTTGGGTG 3 D190F-R CAAACCAACCAAAGCAAAACCAGTGGTTGGGTCAATAGAAC 4 T199V-F TTTGCTTTGGTTGGTTTGGGT 5 T199V-R CAAACCAACCAAAGCAAAACCAGTGGTTGGGTCAATAGAAC 6 S200M-F GGTTTGGGTGCTATTACTATGTCTGAAACTATTACCTTGCCACAGA 7 S200M-R GGTAATAGTTTCAGACATAGTAATAGCACCCAAACCAACCA 8 H524F-F AACAGACCAAGAGTTTCTTTTGCTCATGGTTGGTCTACTGG 9 H524F-R AGACCAACCATGAGCAAAAGAAACTCTTGGTCTGTTAGTGTATGGAG 10

[0063] 1.3 Construction of mutant plasmids

[0064] Using the recombinant plasmid pPIC9K-WT as a template, PCR amplification was performed using the primers listed in Table 1 to mutate the mutation sites. For example, the site-directed mutagenesis at site 190 was performed using primers D190F-F and D190F-R. PCR amplification was then performed using the recombinant plasmid pPIC9K-Rha as a template to obtain linear DNA fragments of the full plasmid length.

[0065] After PCR amplification, add 1 μL of Dpn I to 5-10 μL of PCR amplification product, mix gently, and react at 37°C for 1 hour to specifically degrade the methylated original template plasmid.

[0066] After purification of the digestion product, an in vitro self-ligation reaction was performed to circularize it into a complete plasmid, resulting in recombinant plasmids pPIC9K-D190F, pPIC9K-T199V, pPIC9K-S200M, and pPIC9K-H524F carrying the mutant gene.

[0067] The ligation product was transformed into *E. coli* JM109 to obtain the corresponding recombinant *E. coli*, which was plated on LB agar plates containing 100 μg / mL ampicillin and incubated overnight at 37°C. Randomly selected clones were identified by colony PCR and sequenced for verification. The results showed that the recombinant expression vector containing the α-L-rhamnosidase mutant gene was successfully transformed into the expression host *E. coli* JM109. The sequenced and verified mutant bacterial culture was added to glycerol and stored at -80°C.

[0068] 2. Construction of yeast expression strains

[0069] High-purity, high-concentration mutant plasmids were extracted from validated strains and linearized. The linearized DNA was then transformed into Pichia pastoris GS115 competent cells using electroporation. The transformed cells were plated on selection plates and incubated at 30°C for 2-4 days until single colonies appeared. Colony PCR was used to confirm successful integration of the target gene into the Pichia pastoris genome, resulting in the selection of positive recombinant yeast strains GS115 / pPIC9K-D190F, GS115 / pPIC9K-T199V, GS115 / pPIC9K-S200M, and GS115 / pPIC9K-H524F.

[0070] 3. Enzyme expression and purification

[0071] Recombinant strains of Pichia pastoris containing wild-type α-L-rhamnosidase and mutant strains were fermented at high density under optimal conditions. The target gene (wild-type or mutant α-L-rhamnosidase gene) was efficiently expressed by using methanol to strongly induce the promoter AOX1. After expression, the supernatant was collected by centrifugation to obtain crude enzyme solutions of wild-type α-L-rhamnosidase and its mutant strains, respectively.

[0072] The crude enzyme was filtered through a 0.45 μm filter membrane and purified by passing it through a nickel column. It was then eluted with a buffer solution containing 200 mM imidazole to obtain pure enzymes of wild-type α-L-rhamnosidase and mutant, respectively.

[0073] 4. Enzyme activity assay

[0074] Take 10 μL of enzyme solution and add 40 μL of 5 mM pNPR solution (prepared with 50 mM sodium phosphate buffer, pH 5). React at 60 °C for 5 min, then stop the reaction by adding 200 μL of 1 M sodium carbonate solution. Measure the absorbance at 405 nm. Enzyme activity is defined as: 1 μmol of p-nitrophenol released per minute through hydrolysis of pNPR equals 1 enzyme activity unit (U).

[0075] Using hesperidin as a substrate: a 10 g / L hesperidin solution was prepared using 500 μL of sodium phosphate buffer (50 mM, pH 5.0), and 500 μL of purified enzyme solution was added. The reaction was carried out at 60 °C and 150 rpm for 60 min, followed by inactivation by boiling in a water bath at 100 °C for 5 min. The rhamnose content was determined using DNS reagent. Under optimal reaction conditions, the amount of enzyme required to produce 1 μmol of rhamnose per minute is defined as one enzyme activity unit (U).

[0076] The relative enzyme activities of wild-type α-L-rhamnosidase and α-L-rhamnosidase mutants were measured as follows: Figure 1As shown in the figure, the relative enzyme activity assay results indicate that the α-L-rhamnosidase mutants D190F, T199V, S200M, and H524F, compared to the wild type, exhibit enzyme activities that are 1.42 times, 1.3 times, 1.07 times, and 1.03 times higher, respectively, representing a significant increase in relative enzyme activity. Among these, mutant D190F shows the most significant increase in relative enzyme activity. Therefore, the α-L-rhamnosidase mutant D190F can efficiently convert hesperidin to hesperidin monoglucoside.

[0077] The amino acid sequence of the α-L-rhamnosidase mutant D190F is shown in SEQ ID NO.11:

[0078] MWSSWLLSALLATEALA (SEQ ID NO.11).

[0079] 5. Enzymatic property analysis

[0080] 5.1 Optimal Temperature and Thermal Stability

[0081] Wild-type and mutant D190F enzyme solutions were placed in different temperature environments (50℃, 55℃, 60℃, 65℃, 70℃), and their optimal temperatures were determined according to enzyme activity assay methods. Simultaneously, enzyme activity was measured after 3 hours under different temperature conditions. Relative activity was calculated with the activity of the two enzymes before temperature incubation as 100%, thus determining the enzyme's thermostability. Results are as follows: Figure 2 and 3 As shown.

[0082] Depend on Figure 2 It is known that the optimal temperature for both the wild type and the mutant D190F is 60℃. Figure 3 It can be seen that after being placed in a 60℃ water bath for 3 hours, the relative enzyme activity of mutant D190F is about 1.8 times that of wild type, and its stability is better than that of wild type under this temperature condition.

[0083] 5.2 Optimal pH and pH stability

[0084] Wild-type and mutant D190F enzyme solutions were placed in buffer solutions with different pH values ​​(pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0), and their optimal pH was determined according to the enzyme activity assay method. Simultaneously, after incubation at 25°C for 20 hours, enzyme activity was measured. Relative activity was calculated with the enzyme activity at 0 hours under different pH conditions as 100% to determine enzyme stability. Results are as follows: Figure 4 and 5 As shown.

[0085] Depend on Figure 4 It is known that the optimal pH for both the wild-type and the mutant D190F is 5.0. Figure 5 It can be seen that after being placed in a pH 3.0-9.0 buffer at 25°C for 20 hours, the mutant D190F maintained a relative enzyme activity of >85% in the pH 4.0-6.0 range, and its stability was better than that of the wild type.

[0086] 5.2 Determination of kinetic parameters

[0087] The kinetic properties of wild-type and mutant D190F enzymes were studied under optimal conditions (pH 5.0, 60℃) using 15 mM hesperidin as a substrate. The Michaelis constant (Km) was calculated and compared using the GraphPad Prism 5 program. m ), maximum reaction rate (V) max The results are shown in Table 2.

[0088] Table 2 Comparison of kinetic parameters between wild-type and mutant D190F

[0089] enzymes V max (U·mg -1 )]]> K m (mM) K cat (s -1 )]]> <![CDATA[K cat / K m (mM -1 ·s -1 )]]> WT 0.2443 1.42 316.87 233.15 D190F 0.3852 0.76 501.23 659.51

[0090] As shown in Table 2, the kinetic parameters of the mutant D190F enzyme differ significantly from those of the wild-type enzyme. The Ki of the mutant D190F... cat The value is 501.23S -1 Compared to the wild type 316.87S -1 It increased by 58.2%; therefore, the catalytic efficiency (K) of the mutant D190F was increased. cat / K m The value is 659.51mM. -1 ·S -1 Compared to the wild type's 223.15mM -1 ·S -1 It increased by 195%.

[0091] 6. Application of hesperidin conversion

[0092] The crude enzyme solutions of α-L-rhamnosidase mutant and wild-type enzyme were used to catalyze the reaction of hesperidin. The hesperidin concentration was 20 g / L, and the enzyme dosage of mutant D190F was 2.5 U / mL. This enzyme exhibited better catalytic activity at pH 5 and a reaction temperature of 60℃, thus facilitating the reaction of flavonoids. Under higher temperature conditions, the solubility of flavonoids was higher, and the reaction was faster. After 48 h of reaction, 1 mL of the reaction solution was taken into a centrifuge tube, and 3 volumes of DMSO were added to terminate the catalytic reaction. The reaction solution was then centrifuged at 12000 rpm for 2 min, the supernatant was collected, diluted with DMSO, filtered through a 0.22 μm organic filter membrane, and analyzed by HPLC. Figure 6 The HPLC chromatogram of hesperidin standard is shown below. Figure 7 This is the HPLC chromatogram of hesperidin monoglucoside standard; Figure 8 The HPLC chromatogram shows the catalytic results of the wild-type enzyme solution. Figure 9 This is an HPLC chromatogram of the enzyme solution catalysis results of the mutant D190F.

[0093] The comparison of the product generation rates of wild-type and mutant α-L-rhamnosidase is shown in the figure below. Figure 10 As shown, the wild-type enzyme produced 10.29% of hesperidin monoglucoside, while the mutant D190F produced 20.34%, which is 1.98 times that of the wild-type. The wild-type α-L-rhamnosidase converted 29.99% of hesperidin, while the α-L-rhamnosidase mutant D190F converted 36.44%, which is 1.22 times that of the wild-type.

[0094] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An α-L-rhamnosidase mutant, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

11.

2. A gene encoding the α-L-rhamnosidase mutant of claim 1.

3. A recombinant vector comprising the gene of claim 2.

4. An engineered bacterium comprising the recombinant vector of claim 3.

5. The engineered bacteria according to claim 4, characterized in that, The engineered strain is Pichia pastoris.

6. The use of the α-L-rhamnosidase mutant of claim 1, the gene of claim 2, the recombinant vector of claim 3, or the recombinant bacteria of claim 4 or 5 in improving the catalytic efficiency of α-L-rhamnosidase.

7. The application according to claim 6, characterized in that, Improving the catalytic efficiency of the α-L-rhamnosidase is to increase the efficiency of the α-L-rhamnosidase in catalyzing the conversion of hesperidin to hesperidin monoglucoside.

8. The application of the α-L-rhamnosidase mutant of claim 1, the gene of claim 2, the recombinant vector of claim 3, or the recombinant bacteria of claim 4 or 5 in improving the production efficiency of hesperidin monoglucoside.

9. A method for improving the production efficiency of hesperidin monoglucoside, characterized in that, The process includes using the α-L-rhamnosidase mutant of claim 1 to catalyze the production of hesperidin monoglucoside from hesperidin.

10. The method according to claim 9, characterized in that, The catalytic reaction was carried out at a temperature of 60°C and a pH of 5.

Images