Mycobacterium tuberculosis mutant detection crRNA and application thereof

Abstract

The invention discloses a mycobacterium tuberculosis mutant detection crRNA and application of the mycobacterium tuberculosis mutant detection crRNA. One, two or more mismatched basic groups are arranged at the 5'end of crRNA, a section of basic group which can not be completely matched with a target section is arranged at the 3 'end of crRNA, and a loop-shaped bubble structure is formed, so that the effect of distinguishing specific mutant type and wild type mycobacterium tuberculosis is achieved, and meanwhile, the mutation point of a drug-resistant gene can be determined; the method has the advantages of low detection cost, short detection period, high sensitivity and good specificity.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a method for detecting crRNA in Mycobacterium tuberculosis mutants and its application. Background Technology

[0002] Tuberculosis is caused by Mycobacterium tuberculosis (Mycobacterium tuberculosis) Mycobacterium tuberculosis Tuberculosis (TB) is a highly contagious chronic disease caused by infection and is a significant global public health problem. It has high mortality and disability rates, ranking second among infectious diseases worldwide, after AIDS. In 2015, an estimated 10.4 million new cases of TB were diagnosed globally, including 480,000 new cases of multidrug-resistant tuberculosis (MDR-TB), but less than 20% of these patients were registered for treatment. Although TB ​​is curable, in 2016, the treatment success rate for drug-sensitive TB was only 82%, and for MDR-TB, it was only 55%.

[0003] Rifampicin (RIF) is currently the most important anti-MTB drug. rpoB Mutations in the gene (encoding the β subunit of RNA polymerase) are closely related to rifampicin-resistant tuberculosis. rpoB The gene encodes 1178 amino acids, with an open reading frame of 3534 bp. Studies have shown that approximately 95% of rifampicin resistance is caused by… rpoB Mutations in the 81bp rifampicin resistance determing region (RRDR) of the gene (encoding codons 507-533) include point mutations or short insertions and deletions, which alter the activity of DNA-dependent RNA polymerase β subunits. As a result, rifampicin cannot bind to the bacterial RNA polymerase β subunits, leading to resistance. rpoB Gene mutations are generally single-base mutations or combined mutations of several bases. About 80%-86% of base mutations occur at three amino acid sites, namely, serine at position 531 is converted to leucine, histidine at position 526 is converted to tyrosine, and aspartic acid at position 516 is converted to valine, tyrosine, and glycine.

[0004] Studies show that the katG S315T gene mutation is one of the most common mutations in Mycobacterium tuberculosis and is associated with high levels of isoniazid (INH) resistance, while the inhA promoter mutation, -15 (C→T), is the most common mutation and is often associated with low levels of isoniazid (INH) resistance.

[0005] Early diagnosis and treatment of MTR-TB is currently one of the hot topics and challenges in tuberculosis control. Traditional tuberculosis diagnostic methods include microscopy and culture, while the "gold standard" for diagnosing drug resistance is based on solid culture medium drug susceptibility testing. This involves inoculating the strain onto a solid culture medium containing the drug being tested and observing its growth to determine drug resistance. However, this method is limited by technology, personnel, and infrastructure, and is time-consuming, making it unable to meet the urgent need for early detection and treatment of drug-resistant tuberculosis. In addition, the reproducibility of drug susceptibility testing (DST) for many drugs is poor, and some second-line drugs lack standardized DSTs.

[0006] In recent years, precise and sensitive nucleic acid detection technologies have been continuously developed. Currently available molecular biology detection methods include the Xpert MTB / RIF system for rapid diagnosis of tuberculosis and rifampicin resistance detection, as well as PCR-single strand conformation polymorphism analysis (PCR-SSCP), restriction fragment length polymorphism analysis (PCR-RFLP), and gene sequencing for detecting MTB resistance genes, providing options for clinical applications. However, these methods involve cumbersome post-PCR processing steps, require highly skilled technicians, and are susceptible to cross-contamination, hindering widespread adoption.

[0007] (1) Xpert MTB / RIF rapid detection of rifampicin resistance: This system designs primers and probes targeting the 81bp rifampicin resistance core region of MTB and performs amplification detection. It detects whether the sample contains MTB and whether it is resistant to rifampicin based on whether gene mutation has occurred. It can automatically extract, purify and concentrate nucleic acids from the sample, and produce results within 2 hours. However, the Gene-xpertMRT / RIF method has a high possibility of false negatives, which may lead to patients being misdiagnosed with multidrug-resistant tuberculosis, thus prolonging the treatment course and increasing adverse reactions. Therefore, it has its limitations, and the final result still needs to be confirmed by the tuberculosis drug susceptibility test.

[0008] (2) Polymerase Chain Reaction-Single-Strand Conformation Polymorphism (PCR-SSCP): In most cases, the substitution of a single base in a bacterial DNA gene fragment is sufficient to cause a change in the spatial conformation of the single-stranded DNA. This change can lead to a corresponding change in the electrophoretic mobility of the single-stranded DNA. SSCP technology uses this principle to distinguish mutated DNA fragments from normal DNA fragments through electrophoresis. The main drawback is the potential for false negative results.

[0009] (3) Direct DNA sequencing: Direct sequencing (DS) of bacterial genome DNA uses PCR to amplify the gene to be tested, the product is purified or cloned, and its DNA fragment is directly sequenced. The base sequence is compared with the same DNA fragment of the standard sensitive strain to find the location and distribution of base mutations. The disadvantages of direct DNA sequencing are that it is time-consuming, expensive, and prone to cross-contamination.

[0010] Therefore, there is an urgent need to develop a detection technology for drug-resistant mutations in Mycobacterium tuberculosis that is low in cost, short in cycle, highly sensitive, and specific, in order to meet clinical needs. Summary of the Invention

[0011] To overcome the technical problems of low specificity and accuracy, long processing time, and high cost in existing single nucleotide polymorphism detection methods, the present invention aims to provide a method for detecting Mycobacterium tuberculosis mutant crRNA and its application. This method can detect point mutations in drug resistance genes of Mycobacterium tuberculosis, enabling rapid, convenient, highly sensitive, and highly specific differentiation between mutant and wild-type Mycobacterium tuberculosis. Furthermore, it can identify drug resistance gene mutations and provide targeted guidance on medication. It has the advantages of low detection cost, short detection cycle, high sensitivity, and good specificity.

[0012] The objective of this invention is achieved by at least one of the following technical solutions.

[0013] A first aspect of the present invention provides a crRNA for detecting Mycobacterium tuberculosis mutants, wherein the crRNA comprises, from the 5' end to the 3' end, an anchoring sequence, a target segment, and a partially complementary segment; the anchoring sequence is used to bind to the Cas13 protein; the target segment has one, two, or more mismatched bases with the target gene; the target RNA is transcribed from the target gene and / or the target gene amplification product; and the partially complementary segment forms a stem-loop structure with the target segment.

[0014] Furthermore, the anchoring sequence is shown in SEQ ID NO: 22.

[0015] Furthermore, the target gene is selected from pathogenic genes in Mycobacterium tuberculosis or drug resistance genes associated with Mycobacterium tuberculosis.

[0016] Furthermore, the target genes include the rpoB gene with one or more of the following mutations: S450L, H445Y / D / R, D435V, L430P, and V170F; the katG gene with one or more of the following mutations: S315T, W341R, and L398P; the inhA gene with the C-15T mutation; the rpsL gene with the K43R or K88R mutation; and / or the gyrA gene with the D94G mutation.

[0017] More preferably, the target gene is the rpoB gene with the S450L mutation.

[0018] Furthermore, the Mycobacterium tuberculosis mutant includes a rifampicin resistance gene. rpoB S450L mutation.

[0019] Furthermore, the base length of the target segment is 16-35 nt.

[0020] Furthermore, the base length of the target segment is 22-35 nt.

[0021] More preferably, the base length of the target segment is 24 nt.

[0022] Furthermore, the target segment and the target RNA have two mismatched bases.

[0023] Furthermore, the target segment has a mismatch between bases 1-3 at its 5' end and the target RNA, and the target segment has a mismatch between base 5 at its 5' end and the target RNA.

[0024] More preferably, the target segment has a mismatched base at the 3rd base of its 5' end with the target RNA, and the target segment has a mismatched base at the 5' end with the target RNA.

[0025] Furthermore, the length of the complementary bases between the partially complementary segment and the target segment is less than or equal to 20 bp.

[0026] Furthermore, the complementary segment includes a complementary segment 1, a non-complementary segment, and a complementary segment 2. The complementary segment 1 forms a complementary secondary structure with the 3' end of the target segment; the complementary segment 2 forms a complementary secondary structure with the 5' end of the target segment.

[0027] Furthermore, the complementary segment 1 has a base length of 9 nt; the complementary segment 2 has a base length of 5 nt.

[0028] Furthermore, the base length of the non-complementary segment is 7 nt.

[0029] More preferably, the complementary segment is as shown in SEQ ID NO: 28.

[0030] Furthermore, the detection crRNA of the Mycobacterium tuberculosis mutant is as shown in any one of SEQ ID NO: 62-71.

[0031] Furthermore, the detection crRNA of the Mycobacterium tuberculosis mutant is shown in sequence SEQ ID NO: 66.

[0032] A second aspect of the present invention provides a Mycobacterium tuberculosis mutant detection kit, comprising the crRNA described in any one of the first aspects of the present invention.

[0033] Furthermore, the kit is a kit for detecting drug resistance in Mycobacterium tuberculosis.

[0034] Furthermore, the drug resistance refers to resistance to one or more of the following: rifampin, isoniazid, pyrazinamide, ethambutol, fluoroquinolones, streptomycin, capreomycin, kanamycin, amikacin, ethionamide, prothionamide, sodium para-aminosalicylate, cycloserine, clofazimine, bedaquiline, linezolid, rifapentine, rifabutin, and delamani.

[0035] Furthermore, the kit also includes a buffer, an RNA fluorescent probe, an RNase inhibitor, and a Cas13 protein.

[0036] Furthermore, the 5' end of the fluorescently labeled single-stranded RNA probe is labeled with any one of FAM, ROX, HEX, FITC, Cy5, or Cy3, and the 3' end is labeled with any one of BHQ1, BHQ2, or BHQ3. The length of the fluorescently labeled single-stranded RNA probe is 5 nt to 20 nt.

[0037] Furthermore, the Cas13 protein includes Cas13a, Cas13b, Cas13d, or Cas13X proteins.

[0038] A third aspect of the present invention provides the use of the crRNA described in any one of the first aspects of the present invention or the kit described in any one of the second aspects of the present invention in at least one of the following: A1) Detection or auxiliary detection of Mycobacterium tuberculosis or its nucleic acid; A2) Prepare products for detecting or assisting in the detection of Mycobacterium tuberculosis or its nucleic acid; A3) Screening or assisting in the screening of drugs for the prevention and treatment of Mycobacterium tuberculosis; A4) Products for preparing or assisting in the screening of drugs for the prevention and treatment of Mycobacterium tuberculosis.

[0039] Furthermore, the Mycobacterium tuberculosis is a mutant of Mycobacterium tuberculosis.

[0040] Furthermore, the Mycobacterium tuberculosis mutant comprises an rpoB gene having one or more of the following mutations: S450L, H445Y / D / R, D435V, L430P, and V170F; a katG gene having one or more of the following mutations: S315T, W341R, and L398P; an inhA gene having a C-15T mutation; an rpsL gene having a K43R or K88R mutation; and / or a gyrA gene having a D94G mutation. In one specific embodiment of the invention, the Mycobacterium tuberculosis mutant comprises an rpoB gene having an S450L mutation.

[0041] A fourth aspect of the present invention provides a method for detecting Mycobacterium tuberculosis mutants, comprising the following steps: (1) Extract the target nucleic acid from the sample; (2) Amplify the target nucleic acid; (3) The target nucleic acid is reacted with the amplified CRISPR / Cas13 reaction system, wherein the CRISPR / Cas13 reaction system contains the crRNA described in any one of the first aspects of the present invention; (4) Determine whether the sample contains Mycobacterium tuberculosis mutant by measuring and detecting the fluorescence signal.

[0042] Furthermore, in the CRISPR / Cas13 reaction system, the concentration of the Cas13 protein is 1 nM-5 nM.

[0043] Furthermore, the Cas13 protein includes Cas13a, Cas13b, Cas13d, or Cas13X proteins.

[0044] Furthermore, the CRISPR / Cas13 reaction system includes 10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl, 0.4μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA and 5nM Cas13a ribonucleoprotein.

[0045] Furthermore, the CRISPR / Cas13 reaction system is a 25 μL reaction system.

[0046] Furthermore, the specific method for reacting the amplified target nucleic acid with the CRISPR / Cas13 reaction system is as follows: incubation is performed at 37°C using a real-time quantitative PCR instrument, with fluorescence readings measured every 10 seconds, for 90 cycles.

[0047] Furthermore, the detection method is not for diagnostic or therapeutic purposes.

[0048] Compared with the prior art, the present invention has the following advantages and beneficial effects: This invention achieves the detection of single-base mutation targets by setting one, two, or more mismatched bases at the 5' end of crRNA and a base segment at the 3' end that does not perfectly match the target segment, forming a circular "bubble" structure (stem-loop structure). This satisfies the length requirement for "activating the catalytic site in the HEPN domain of the Cas13 enzyme." The Cas13a protein and crRNA form a complex. When complementary base pairing occurs between the crRNA and the target, the HEPN domain of the Cas13a protein is activated, cleaving the reporter RNA and releasing a fluorescent signal. When detecting mutant target genes, the "bubble" structure of crRNA matches the target mutant, promoting the opening of the crRNA loop structure. This allows the target segment and the target sequence to form a complementary RNA chain, activating the Cas13a protein to cleave the reporter RNA and release a fluorescent signal. For RNA transcribed from wild-type target genes or RNA transcribed from mutant genes that do not have the target mutant gene, the "bubble" structure of crRNA cannot open the loop structure and cannot perform base pairing. Therefore, the Cas13a protein cannot cleave the reporter RNA and release a fluorescent signal, thus achieving the effect of distinguishing between mutant and wild-type Mycobacterium tuberculosis and identifying drug resistance gene mutation points.

[0049] This invention allows for the design of different crRNAs targeting various single-base mutations, enabling direct recognition and adaptation to single-base mutations at any mutation site. It can rapidly, conveniently, with high sensitivity and specificity, distinguish between mutant and wild-type Mycobacterium tuberculosis and identify drug-resistant gene mutations. Compared to PCR melting curve analysis and DNA sequencing for determining drug resistance mutations, it offers advantages such as simple design, easy operation, and real-time monitoring. Attached Figure Description

[0050] Figure 1 crRNA targeting a single SNP mismatch site designed for Example 1 against Mycobacterium tuberculosis rpoB A bar chart showing the fluorescence intensity of the wild-type plasmid template being sheared.

[0051] Figure 2 crRNA with double mismatch sites designed for Example 2 against Mycobacterium tuberculosis rpoB Wild-type plasmid template and rifampicin resistance gene rpoB A bar chart of fluorescence intensity during template shearing of the S450L mutant plasmid.

[0052] Figure 3 crRNA with three mismatch sites designed for Example 3 against Mycobacterium tuberculosis rpoB Wild-type plasmid template and rifampicin resistance gene rpoBA bar chart of fluorescence intensity during template shearing of the S450L mutant plasmid.

[0053] Figure 4 The rifampicin resistance gene was designed using double mismatch crRNAs of different base lengths for Example 4. rpoB Fluorescence intensity line graph of S450L mutant plasmid template at different signal acquisition points.

[0054] Figure 5 This is a schematic diagram of a crRNA structure containing a partially complementary segment.

[0055] Figure 6 crRNA containing partially complementary segments is effective against Mycobacterium tuberculosis. rpoB Wild-type plasmid template and rifampicin resistance gene rpoB A bar chart of fluorescence intensity during template shearing of the S450L mutant plasmid.

[0056] Figure 7 A bar graph showing the fluorescence intensity of the strain cut by the national reference material used in the crRNA-hs-5 detection reagent for detecting the rifampicin resistance gene of Mycobacterium tuberculosis designed in Example 5. Detailed Implementation

[0057] The specific implementation of the present invention will be further described below with reference to the accompanying drawings and examples, but the implementation and protection of the present invention are not limited thereto. It should be noted that any processes not specifically described in detail below are those that can be implemented or understood by those skilled in the art by referring to the prior art. Reagents or instruments whose manufacturers are not specified are considered to be conventional products that can be purchased commercially. In describing the present invention, detailed descriptions of related known technologies will be omitted if it is believed that such detailed descriptions may obscure the core content of the present invention. Throughout this specification, unless the context clearly indicates otherwise, the singular forms “an,” “a,” and “the” should be understood to include plural referents; and it should be understood that terms such as “comprising” or “having” used in this specification are intended to indicate the presence of the stated features, quantities, steps, operations, components, parts, or combinations thereof, but do not preclude the possibility of the presence or addition of one or more other features, quantities, steps, operations, components, parts, or combinations thereof. Furthermore, when performing a method or preparation method, each process constituting the method may occur in a different order than the specified order, unless the specific order is clearly described in the context. That is, each process may occur in the specified order, or substantially simultaneously, or in reverse order.

[0058] While any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention, preferred methods and materials are exemplified herein.

[0059] In this invention, the S450L mutation (531TTG mutation) refers to the presence of a rifampicin resistance gene in a Mycobacterium tuberculosis mutant compared to the standard strain H37Rv. rpoB The 450 codon was mutated from TCG to TTG. The 531TTG mutation was named based on the previously used E. coli genome numbering system, while the S450L name was based on the now-used Mycobacterium tuberculosis H37Rv genome numbering system.

[0060] SNV refers to single nucleotide variants; SNP refers to single nucleotide polymorphisms. SNPs are generally dimorphic, while SNVs have no restrictions on the type of mutation site. In the embodiments of the present invention, SNP specifically refers to an SNP mutation (generally dimorphic) of crRNA relative to the target RNA at a specific site, resulting in an SNP mismatch. In the embodiments of the present invention, SNV specifically refers to an artificial mutation of crRNA relative to the target RNA at a specific site, resulting in an SNV mismatch.

[0061] In this specification, the word "and / or" includes any combination or any one of the listed items. In this specification, "A or B" may include "A", "B", or "both".

[0062] This invention provides a method for rapid in vitro qualitative and quantitative detection of drug resistance gene determinant mutation sites in sputum and other culture samples from tuberculosis patients, based on a real-time fluorescence PCR platform, including crRNA and a kit containing the crRNA.

[0063] A first aspect of the present invention provides a crRNA for detecting Mycobacterium tuberculosis mutants, wherein the crRNA comprises an anchoring sequence, a target segment, and a partially complementary segment from the 5' end to the 3' end; the anchoring sequence is used to bind to the Cas13 protein; the target segment and the target RNA have one, two, or more mismatched bases, and the target RNA is transcribed from a target gene and / or amplified product of the target gene; the partially complementary segment forms a stem-loop structure with the target segment.

[0064] In some embodiments of the present invention, the anchoring sequence is as shown in SEQ ID NO: 22.

[0065] In some embodiments of the present invention, the target gene is selected from pathogenic genes in Mycobacterium tuberculosis or drug-resistant genes associated with Mycobacterium tuberculosis. The drug-resistant gene refers to a nucleotide sequence (DNA fragment) encoding a drug-resistant trait, which enables pathogens to develop resistance to certain antibiotics, thereby reducing or eliminating the efficacy of these drugs. In some preferred embodiments of the present invention, the target gene includes one or more of the following mutations: S450L, H445Y / D / R, D435V, L430P, and V170F. rpoB Genes containing one or more of the following mutations: S315T, W341R, and L398P. kat G gene, with C-15T mutation inhA Genes, those with K43R or K88R mutations rpsL Genes and / or those with D94G mutations gyrA Gene. In one specific embodiment of the present invention, the target gene is a gene with the S450L mutation. rpoB Gene.

[0066] In some embodiments of the present invention, the target segment has a base length of 16-35 nt. In some preferred embodiments of the present invention, the target segment has a base length of 22-35 nt. In one specific embodiment of the present invention, the target segment has a base length of 24 nt.

[0067] In some embodiments of the present invention, the target segment and the target RNA have two mismatched bases. In some preferred embodiments of the present invention, the 1st to 3rd bases at the 5' end of the target segment have one SNP mismatch with the target RNA, and the 5th base at the 5' end of the target segment has one SNV mismatch with the target RNA. In a specific embodiment of the present invention, the 3rd base at the 5' end of the target segment has one mismatched base with the target RNA, and the 5th base at the 5' end of the target segment has another mismatched base with the target RNA.

[0068] In some embodiments of the present invention, the length of the bases complementary to the target segment is less than or equal to 20 bp.

[0069] In some embodiments of the present invention, the partially complementary segment includes a complementary segment 1, a non-complementary segment, and a complementary segment 2. The complementary segment 1 forms a complementary secondary structure with the 3' end of the target segment; the complementary segment 2 forms a complementary secondary structure with the 5' end of the target segment. In some preferred embodiments of the present invention, the base length of the complementary segment 1 is 9 nt; the base length of the complementary segment 2 is 5 nt. In some preferred embodiments of the present invention, the base length of the non-complementary segment is 7 nt. In a specific embodiment of the present invention, the partially complementary segment is as shown in SEQ ID NO: 28.

[0070] In some embodiments of the present invention, the target gene is a gene with the S450L mutation. rpoB The target gene, specifically the *Mycobacterium tuberculosis* mutant crRNA, is shown in any one of SEQ ID NO: 62-71. In one specific embodiment of the invention, the target gene is a gene with the S450L mutation. rpoB The gene, the Mycobacterium tuberculosis mutant, was detected with crRNA as shown in sequence SEQ ID NO: 66.

[0071] A second aspect of the present invention provides a Mycobacterium tuberculosis mutant detection kit, comprising crRNA as described in any of the first aspects of the present invention.

[0072] In some embodiments of the present invention, the kit is a kit for detecting drug resistance in Mycobacterium tuberculosis. In some preferred embodiments of the present invention, the drug resistance is resistance to one or more of the following: rifampin, isoniazid, pyrazinamide, ethambutol, fluoroquinolones, streptomycin, capreomycin, kanamycin, amikacin, ethionamide, prothionamide, sodium para-aminosalicylate, cycloserine, clofazimine, bedaquiline, linezolid, rifapentine, rifabutin, and delamani.

[0073] In some embodiments of the present invention, the kit further includes a buffer, an RNA fluorescent probe, an RNase inhibitor, and a Cas13 protein. In some preferred embodiments of the present invention, the 5' end of the fluorescently labeled single-stranded RNA probe is labeled with any one of FAM, ROX, HEX, FITC, Cy5, or Cy3, and the 3' end is labeled with any one of BHQ1, BHQ2, or BHQ3. The length of the fluorescently labeled single-stranded RNA probe is 5 nt to 20 nt. In some preferred embodiments of the present invention, the Cas13 protein includes Cas13a, Cas13b, Cas13d, or Cas13X protein.

[0074] The above-mentioned kit, based on a PCR platform, can rapidly identify and quantify drug resistance mutations. Applicable samples include Mycobacterium tuberculosis sputum cultures from tuberculosis patients and environmental samples, providing effective technical guidance for the auxiliary diagnosis of tuberculosis.

[0075] A third aspect of the present invention provides the use of the crRNA described in any one of the first aspects of the present invention or the kit described in any one of the second aspects of the present invention in at least one of the following: A1) Detection or auxiliary detection of Mycobacterium tuberculosis or its nucleic acid; A2) Prepare products for detecting or assisting in the detection of Mycobacterium tuberculosis or its nucleic acid; A3) Screening or assisting in the screening of drugs for the prevention and treatment of Mycobacterium tuberculosis; A4) Products for preparing or assisting in the screening of drugs for the prevention and treatment of Mycobacterium tuberculosis.

[0076] In some embodiments of the present invention, the Mycobacterium tuberculosis is a mutant of Mycobacterium tuberculosis. In some preferred embodiments of the present invention, the Mycobacterium tuberculosis mutant comprises one or more of the following mutations: S450L, H445Y / D / R, D435V, L430P, and V170F. rpoB Genes containing one or more of the following mutations: S315T, W341R, and L398P. kat G gene, with C-15T mutation inhA Genes, those with K43R or K88R mutations rpsL Genes and / or those with D94G mutations gyrA Gene. In one specific embodiment of the invention, the Mycobacterium tuberculosis mutant comprises a gene having the S450L mutation. rpoB Gene.

[0077] A fourth aspect of the present invention provides a method for detecting Mycobacterium tuberculosis mutants, comprising the following steps: (1) Extract the target nucleic acid from the sample; (2) Amplify the target nucleic acid; (3) The target nucleic acid is reacted with the amplified CRISPR / Cas13 reaction system, wherein the CRISPR / Cas13 reaction system contains the crRNA described in any one of the first aspects of the present invention; (4) Determine whether the sample contains Mycobacterium tuberculosis mutant by measuring and detecting the fluorescence signal.

[0078] In some embodiments of the present invention, the concentration of the Cas13 protein in the CRISPR / Cas13 reaction system is 1 nM-5 nM. In some preferred embodiments of the present invention, the Cas13 protein includes Cas13a, Cas13b, Cas13d, or Cas13X protein.

[0079] In some embodiments of the present invention, the CRISPR / Cas13 reaction system comprises 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl, 0.4 μM RNA fluorescent probe, 1 U / L enzyme inhibitor, 40 nM crRNA, and 5 nM Cas13a ribonucleoprotein. In some preferred embodiments of the present invention, the CRISPR / Cas13 reaction system is a 25 μL reaction system.

[0080] In some embodiments of the present invention, the detection method is for non-diagnostic or non-therapeutic purposes.

[0081] A positive result indicates the presence of the corresponding mutant of Mycobacterium tuberculosis in the sample. For example, if the crRNA in the reaction system is any one of the sequences shown in SEQ ID NO: 62-71, a positive result indicates the presence of the rifampicin resistance gene in the sample. rpoB The S450L mutant of Mycobacterium tuberculosis. When the sample to be tested does not contain the carrier... rpoB In rifampicin-resistant strains with the S450L mutation, the "bubble" structure of the crRNA cannot open its loop and cannot perform base pairing, thus preventing the Cas13a protein from cleaving the reporter RNA. However, when the sample contains a Mycobacterium tuberculosis mutant with the rifampicin resistance gene rpoB S450L mutation, the "bubble" structure of the crRNA matches the target mutation, promoting the opening of the crRNA loop. This allows the target segment and the target sequence to form a complementary RNA chain, activating the Cas13a protein to cleave the reporter RNA and release a fluorescent signal.

[0082] Example 1: crRNA from a single SNP mismatch site rifampicin resistance gene rpoB S450L, or 531TTG mutation, is used as the target mutation point for detection. First, a crRNA target segment of 28 bases in length is designed. The SNP mismatch base site is placed at bases 1 to 15 of the 5' end of the crRNA target segment. The mismatch bases are marked with an emphasis mark ".", such as "A". Unless otherwise specified, all mismatch bases are marked with an emphasis mark ".". The crRNA target segment sequence of 28 bases in length containing a single mismatch site is shown in Table 1.

[0083] During crRNA sequence synthesis, a Cas13a anchoring sequence must be added to the 5' end of the crRNA target segment presented in Table 2. The Cas13a anchoring sequence is: 5'-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3' (SEQ ID NO: 22).

[0084] Table 1. crRNA target sequences of single SNP mismatch sites

[0085] Based on the NCBI reference strain sequence of Mycobacterium tuberculosis M.tb H37Rv (GenBank ID: NC_000962.3), the sequence was externally sent for synthesis. rpoB Wild-type plasmid, rpoB The wild-type gene is shown in SEQ ID NO: 72.

[0086] SEQ ID NO: 72: GGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTG After the wild-type plasmid template is pre-amplified by PCR, RAA or RPA, the crRNA of the single SNP mismatch site designed in Example 1 is cleaved by CRISPR / Cas13 reaction and the signal is read. The fluorescence signal value of each crRNA is obtained by subtracting the fluorescence signal value of the first cycle from the fluorescence signal value of the last cycle. By comparing the ΔF values ​​of each crRNA cleavage, the mutant crRNA with the best specificity is identified.

[0087] The CRISPR / Cas13 reaction used a 25 μL reaction system, and the final concentrations of each reagent in the reaction system are as follows: 1× buffer (10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl), 0.4μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA, 5nM Cas13a ribonucleoprotein.

[0088] After mixing all the reaction mixtures, incubate them in a real-time quantitative PCR instrument at 37°C. Measure the fluorescence readings every 10 seconds and perform 90 cycles, approximately 40 minutes.

[0089] crRNA from a single SNP mismatch site in Mycobacterium tuberculosis rpoB The fluorescence intensity of the wild-type plasmid template shearing is as follows: Figure 1 As shown. When the mismatch site is at bases 1, 2, and 3 at the 5' end of the crRNA target segment, Mycobacterium tuberculosis is cleaved. rpoB The wild-type plasmid template showed a low signal value, with the third mismatch being associated with Mycobacterium tuberculosis. rpoB Wild-type plasmids bind minimally to the template, but some signal is still present. Therefore, a single-base mutation in crRNA is insufficient to guarantee protection against Mycobacterium tuberculosis. rpoB The wild-type plasmid template for the gene is completely specific, therefore other methods are needed to improve the specificity of crRNA.

[0090] Example 2: crRNA with double mismatch sites To improve the specificity of crRNA, additional mismatches were introduced into the crRNA target segment. The following sequences were designed: crRNA-mis-1~crRNA-mis-1+6, crRNA-mis-2~crRNA-mis-2+6, and crRNA-mis-3`crRNA-mis-3+6. These sequences contain mutated SNPs located at bases 1 to 3 at the 5' end of the crRNA target segment. At the same time, an artificial mutation was performed on bases at other positions in the target segment. The crRNA target segment sequences with double mismatch sites are shown in Table 1.

[0091] When synthesizing crRNA sequences, a Cas13a anchoring sequence must be added to the 5' end of the crRNA target segment presented in Table 2. The Cas13a anchoring sequence is: 5'-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3'.

[0092] Table 2. crRNA target segments at double mismatch sites

[0093] Based on the NCBI reference strain sequence of Mycobacterium tuberculosis M.tb H37Rv (GenBank ID: NC_000962.3) and related literature reports, rifampicin resistance genes were synthesized externally. rpoB S450L mutant plasmid template, containing the S450L mutation rpoB The gene sequence is shown in SEQ ID NO: 73.

[0094] SEQ ID NO: 73 (Underlined and bolded bases are mutated bases): GGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGT T GGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTG After the plasmid template is pre-amplified by PCR, RAA or RPA, the crRNA with double mismatch sites designed in Example 2 is cleaved by CRISPR / Cas13 reaction and the signal is read. The fluorescence signal value of each crRNA is obtained by subtracting the fluorescence signal value of the first cycle from the fluorescence signal value of the last cycle. By comparing the ΔF values ​​of each crRNA cleavage, the mutant crRNA with the best specificity is identified.

[0095] The CRISPR / Cas13 reaction used a 25 μL reaction system, and the final concentrations of each reagent in the reaction system are as follows: 1× buffer (10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl), 1μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA, 5nM Cas13a ribonucleoprotein.

[0096] After mixing all the reaction mixtures, incubate them in a real-time quantitative PCR instrument at 37°C. Measure the fluorescence readings every 10 seconds and perform 90 cycles, approximately 40 minutes.

[0097] crRNA with double mismatch sites against Mycobacterium tuberculosis rpoB Wild-type plasmid template and rifampicin resistance gene rpoB The fluorescence intensity of the S450L mutant plasmid template shearing is as follows: Figure 2 As shown.

[0098] When the SNP mismatch site is at the 3rd base of the 5' end of the crRNA target segment, the signal value of cleaving the wild-type template is relatively small. When an additional mismatch is introduced at the 5th position, the signal difference between cleaving the mutant template and the wild-type template is the highest.

[0099] Example 3 crRNA with three mismatch sites To further improve the specificity of crRNA, based on the mismatch between bases 3 and 5 at the 5' end of the crRNA target segment, another mismatch was introduced, and crRNA-mis-3+5+1~crRNA-mis-3+5+10 were designed. The crRNA target segment sequences with three mismatch sites are shown in Table 3.

[0100] When synthesizing crRNA sequences, a Cas13a anchoring sequence must be added to the 5' end of the crRNA target segment presented in Table 3. The Cas13a anchoring sequence is: 5'-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3'.

[0101] Table 3. crRNA target sequences at triple mismatch sites

[0102] Designed and synthesized Mycobacterium tuberculosis. rpoB Wild-type plasmid and rifampicin resistance gene rpoB The S450L mutant plasmid template was pre-amplified by PCR, RAA, or RPA. Then, using a quantitative real-time PCR platform, the crRNA with the three mismatch sites designed in Example 3 was cleaved by a CRISPR / Cas13 reaction, and the signal was read. The fluorescence signal value of the last cycle was subtracted from the fluorescence signal value of the first cycle to obtain the difference in fluorescence signal values ​​(ΔF value) of each crRNA cleavage. By comparing the ΔF values ​​of each crRNA cleavage, the mutant crRNA with the best specificity was identified.

[0103] The CRISPR / Cas13 reaction used a 25 μL reaction system, and the final concentrations of each reagent in the reaction system are as follows: 1× buffer (10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl), 1μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA, 5nM Cas13a ribonucleoprotein.

[0104] After mixing all the reaction mixtures, incubate them in a real-time quantitative PCR instrument at 37°C. Measure the fluorescence readings every 10 seconds and perform 90 cycles, approximately 40 minutes.

[0105] crRNA at three mismatch sites for Mycobacterium tuberculosis rpoB Wild-type plasmid template and rifampicin resistance gene rpoB The fluorescence intensity of the S450L mutant plasmid template shearing is as follows: Figure 3 As shown. When crRNA contains 3 mismatches, the overall shearing sensitivity decreases, particularly against Mycobacterium tuberculosis. rpoBWild-type plasmid template and rifampicin resistance gene rpoB While the S450L mutant plasmid template exhibits increased specificity, its sensitivity decreases. The further the mismatch site is from the 5' end of the crRNA target segment, the more difficult it becomes to distinguish between the mutant and wild-type plasmid templates. Therefore, increasing the number of mismatches does not meet the requirement of high specificity and high sensitivity of crRNA for both mutant and wild-type plasmid templates.

[0106] Example 4: Double mismatch crRNAs with different base lengths To improve the cleavage sensitivity of crRNA to mutant plasmid templates, the base length of the crRNA target segment was modified based on the presence of two mismatches in the crRNA target segment. The number of bases was between 13 and 35. The double mismatch crRNA target segment sequences with different base lengths are shown in Table 4.

[0107] When synthesizing crRNA sequences, a Cas13a anchoring sequence must be added to the 5' end of the crRNA target segment presented in Table 4. The Cas13a anchoring sequence is: 5'-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3'.

[0108] Table 4. Target fragments of double-mismatched crRNAs with different base lengths

[0109] Rifampicin resistance genes were designed and synthesized. rpoB The S450L mutant plasmid template was pre-amplified by PCR, RAA, or RPA. Then, using a real-time PCR platform, double mismatched crRNAs with different base lengths designed in Example 4 were cleaved by CRISPR / Cas13 reaction and the signals were read. The fluorescence signal values ​​were measured after 10, 30, 60, and 90 cycles to identify the mutant crRNA with the best activation effect on Cas13 protein.

[0110] The CRISPR / Cas13 reaction used a 25 μL reaction system, and the final concentrations of each reagent in the reaction system are as follows: 1× buffer (10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl), 1μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA, 5nM Cas13a ribonucleoprotein.

[0111] After mixing all the reaction mixtures, place them in a real-time quantitative PCR instrument and incubate at 37°C for 90 cycles, approximately 40 minutes.

[0112] By comparing the fluorescence intensity values ​​of crRNAs of different base lengths at multiple signal collection sites on the same plasmid template, the activation effect of crRNAs of different base lengths on Cas13 protein can be reflected, i.e., the cleavage sensitivity of crRNAs. Double mismatched crRNAs of different base lengths can be used to detect rifampicin resistance genes. rpoB The fluorescence intensity of the S450L mutant plasmid template at different signal acquisition points is as follows: Figure 4 As shown, a smaller base number significantly affects the sensitivity of crRNA. For example, when the crRNA target segment length is less than or equal to 15 nt, it has almost no activation effect on the Cas13 protein. A base length greater than or equal to 22 nt can activate the Cas13 protein more efficiently.

[0113] Example 5: crRNA containing partially complementary segments Based on the data results from Examples 1-4, a 5' sequence was inserted into the 3' end of the crRNA with a base mismatch at positions 3 and 5. AAGCGCCGA GAGAAAC CUUGG -3' (SEQ ID NO: 28), in this sequence, "5'-AAGCGCCGA-3'" and "5'-CUUGG-3'" are complementary to a segment of the crRNA target sequence, respectively, while "5'-GAGAAAC-3'" is not complementary to the crRNA target sequence. The complementary sequence can be located near the 5' end or the 3' end of the target sequence. The target sequence has 16-34 bases, and the number of complementary bases must be less than or equal to 20 bp. CreatRNA sequences containing partially complementary segments are shown in Table 5. Taking crRNA-hs-1 as an example, the structural diagram of crRNA-hs-1 is shown below. Figure 5 As shown.

[0114] The testing principle lies in the fact that the inserted complementary segment is complementary to the first 5 bases of the crRNA target segment. The hydrogen bonds of the complementary segment to the wild-type plasmid template are difficult to break, thus preventing the activation of the Cas13a protein. rpoB When the S450L mutant plasmid template is used, the first 5 complementary bases are opened, enabling base pairing of the entire target segment and activating the Cas13a protein. crRNAs designed using this principle can achieve minimal or no signal fluctuation during cleavage of high-copy-number wild-type plasmid templates while maintaining sensitivity. This allows for high specificity in distinguishing between wild-type Mycobacterium tuberculosis and mutants carrying specific site mutations.

[0115] Table 5. crRNA sequences containing partial complementary segments

[0116] Designed and synthesized Mycobacterium tuberculosis. rpoBWild-type plasmid and rifampicin resistance gene rpoB The S450L mutant plasmid template was pre-amplified by PCR, RAA, or RPA. Then, using a quantitative real-time PCR platform, the crRNA containing a partially complementary segment designed in Example 5 was cleaved by a CRISPR / Cas13 reaction, and the signal was read. The fluorescence signal value of the last cycle was subtracted from the fluorescence signal value of the first cycle to obtain the difference in fluorescence signal values ​​(ΔF value) of each crRNA cleavage. By comparing the ΔF values ​​of each crRNA cleavage, the mutant crRNA with the best specificity was identified.

[0117] The CRISPR / Cas13 reaction used a 25 μL reaction system, and the final concentrations of each reagent in the reaction system are as follows: 1× buffer (10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl), 1μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA, 5nM Cas13a ribonucleoprotein.

[0118] After mixing all the reaction mixtures, incubate them in a real-time quantitative PCR instrument at 37°C. Measure the fluorescence readings every 10 seconds and perform 90 cycles, approximately 40 minutes.

[0119] crRNA containing partially complementary segments against Mycobacterium tuberculosis rpoB Wild-type plasmid template and rifampicin resistance gene rpoB The fluorescence intensity of the S450L mutant plasmid template shearing is as follows: Figure 6 As shown. Detection of Mycobacterium tuberculosis using crRNA without partially complementary sequences as a control. rpoB The wild-type plasmid template showed the highest fluorescence signal. crRNA-hs-5 could maintain a signal value close to that of crRNA-control when detecting mutant templates, while showing no signal fluctuation when detecting wild-type templates.

[0120] Example 6: Detection of Rifampicin Resistance Gene in Mycobacterium Tuberculosis using National Reference Materials The rifampicin resistance gene detection reagent for Mycobacterium tuberculosis was tested using crRNA-hs-5 (SEQ ID NO: 66). The mutation information of the rifampicin resistance gene detection reagent for Mycobacterium tuberculosis is shown in Table 6. According to the sequencing results, R1-IR-1 and R1-IR-3 are both rifampicin resistance genes. rpoB -531 TTG (S450L) mutant strain, R2-IR-2, R2-IR-4, and R2-IR-5 are all non-531 TTG (S450L) mutant strains.

[0121] Table 6. Mutation Information of National Reference Materials Used in the Rifampicin Resistance Gene Detection Reagent for Mycobacterium Tuberculosis

[0122] Dilute the national reference bacterial strain to 10 using physiological saline. 4 Nucleic acid was extracted using the nucleic acid extraction or purification kit (Catalog No.: C02001M) from Anhui Weizhen Biomedical Technology Co., Ltd., according to conventional methods. Then, RAA amplification was performed using the RPA reaction reagent (Catalog No.: LRR2901KIT) from Shanghai Liangrun Biomedical Technology Co., Ltd. The RAA amplification reaction conditions were 42 ℃ for 20 min. After the reaction, the RAA amplification product was cleaved using a CRISPR / Cas13 reaction containing crRNA-hs-5 (SEQ ID NO: 66), and the signal was read.

[0123] The CRISPR / Cas13 reaction used a 25 μL reaction system, and the final concentrations of each reagent in the reaction system are as follows: 1× buffer (10mM Tris-HCl (pH 8.0), 50mM KCl, 1.5mM MgCl), 1μM RNA fluorescent probe, 1U / L enzyme inhibitor, 40nM crRNA, 5nM Cas13a ribonucleoprotein.

[0124] After mixing all the reaction mixtures, incubate them in a real-time quantitative PCR instrument at 37°C. Measure the fluorescence readings every 10 seconds and perform 90 cycles, approximately 40 minutes.

[0125] The fluorescence intensity of crRNA-hs-5 (SEQ ID NO: 66) against the rifampicin resistance gene of Mycobacterium tuberculosis was measured using a national reference strain. Figure 7 As shown, crRNA-hs-5 (SEQ ID NO: 66) can accurately identify rifampicin resistance genes. rpoB -531 TTG (S450L) mutant bacteria.

[0126] Based on the data results from Examples 1-6, CRISPR RNA (crRNA) with a circular "bubble" structure (stem-loop structure) targeting the double-stranded DNA (dsDNA) sequence of drug resistance mutations can meet the requirements for highly sensitive and specific detection of drug resistance mutations in Mycobacterium tuberculosis. The detection process takes only 2 hours (including the time consumed in the initial sample extraction and pre-amplification), and has low requirements for personnel operation and professional equipment, making it suitable for applications in various scenarios.

[0127] The above embodiments are merely preferred embodiments of the present invention and are only used to explain the present invention, not to limit the present invention. Any changes, substitutions, modifications, etc., made by those skilled in the art without departing from the spirit and essence of the present invention should be within the protection scope of the present invention.

Claims

1. A Mycobacterium tuberculosis mutant detecting crRNA, characterized in that, The Mycobacterium tuberculosis mutant detection crRNA comprises, from 5' end to 3' end, an anchor sequence, a target segment and a partial complementary segment; the anchor sequence is used for binding with Cas13 protein; the target segment has one, two or more than two mismatched bases with target RNA which is transcribed from target gene and / or target gene amplification product; the partial complementary segment forms a stem-loop structure with the target segment.

2. The Mycobacterium tuberculosis mutant for detecting crRNA according to claim 1, wherein, The anchor sequence is shown as SEQ ID NO:

22.

3. The Mycobacterium tuberculosis mutant for detecting crRNA according to any one of claims 1 or 2, characterized in that, The target genes include one or more of a S450L mutation, a H445Y / D / R mutation, a D435V mutation, a L430P mutation, and a V170F mutation in the rpoB gene, one or more of a S315T mutation, a W341R mutation, and a L398P mutation in the kat G gene, a C-15T mutation in the inhA gene, a K43R mutation or a K88R mutation in the rpsL gene, and / or a D94G mutation in the gyrA gene.

4. The Mycobacterium tuberculosis mutant detection crRNA according to any one of claims 1 or 2, wherein the base length of the target segment is 16-35 nt.

5. The Mycobacterium tuberculosis mutant for detecting crRNA according to claim 1, wherein, The 1st-3rd bases at 5' end of the target segment have one mismatched base with the target RNA, and the 5th base at 5' end of the target segment has one mismatched base with the target RNA; And / or, The partial complementary segment comprises a complementary segment 1, a non-complementary segment and a complementary segment 2, the complementary segment 1 forms a complementary secondary structure with the 3' end of the target segment, and the complementary segment 2 forms a complementary secondary structure with the 5' end of the target segment.

6. The M. tuberculosis mutant for detecting crRNA according to claim 1, wherein The target gene is a gene having a S450L mutation rpoB The Mycobacterium tuberculosis mutant detects a crRNA as shown in any one of sequences SEQ ID NO: 62-71.

7. The Mycobacterium tuberculosis mutant for detecting crRNA according to claim 1, wherein The Mycobacterium tuberculosis mutant detection crRNA is shown as SEQ ID NO:

66.

8. A kit for detecting a mutant of Mycobacterium tuberculosis, characterized in that, The Mycobacterium tuberculosis mutant detection crRNA according to any one of claims 1-7.

9. The Mycobacterium tuberculosis mutant detection crRNA according to any one of claims 1-7 or the Mycobacterium tuberculosis mutant detection kit according to claim 8 is applied in at least one of the following: A1) detecting or assisting in detecting Mycobacterium tuberculosis or nucleic acid thereof; A2) preparing a product for detecting or assisting in detecting Mycobacterium tuberculosis or nucleic acid thereof; A3) screening or assisting in screening Mycobacterium tuberculosis prevention and treatment drugs; A4) preparing a product for screening or assisting in screening Mycobacterium tuberculosis prevention and treatment drugs.

10. A Mycobacterium tuberculosis mutant detection method, comprising the following steps: (1) extracting target nucleic acid from a sample; (2) amplifying the target nucleic acid; (3) reacting the amplified target nucleic acid with a CRISPR / Cas13 reaction system, wherein the CRISPR / Cas13 reaction system comprises the crRNA according to any one of claims 1-7; (4) judging whether the sample contains Mycobacterium tuberculosis mutant by measuring the detection fluorescence signal.

Images