Listeria monocytogenes RAA-CRISPR / Cas12a detection method based on one-tube one-step method
By optimizing the RAA-CRISPR/Cas reaction system, a one-tube, one-step method for detecting Listeria monocytogenes has been achieved, solving the problems of long detection cycles, cumbersome operations, and instrument dependence. This method achieves rapid, sensitive, and specific detection results, making it suitable for grassroots laboratories and food production sites.
Patent Information
- Application Number
- CN202610163012.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-04
- Publication Date
- 2026-03-31
AI Technical Summary
Existing Listeria monocytogenes detection technologies suffer from problems such as long detection cycles, cumbersome operations, susceptibility to contamination, and high instrument dependence, making it difficult to meet the needs of convenient and rapid detection in grassroots settings.
By optimizing the addition ratio and components of the RAA-CRISPR/Cas reaction system, a one-step detection method is achieved, eliminating the need for physical isolators, simplifying equipment requirements, and integrating RAA amplification with CRISPR/Cas12a detection, thereby improving detection sensitivity and specificity.
It enables rapid, sensitive, and specific detection of Listeria monocytogenes, reducing the detection time to within half an hour, making it suitable for grassroots laboratories and food production sites, and reducing operational complexity and costs.
Smart Images

Figure CN121759623A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and particularly relates to the field of Listeria monocytogenes detection technology, specifically to a one-tube, one-step method for detecting Listeria monocytogenes RAA-CRISPR / Cas12a. Background Technology
[0002] Listeria monocytogenes is a common foodborne pathogen widely found in dairy products, meat products, and other foods. It poses a significant threat to people with weakened immune systems, such as pregnant women and the elderly, and can cause diseases such as sepsis and meningitis, with a mortality rate of 20%-30%. Rapid and accurate detection of this bacterium is crucial for food safety.
[0003] Current detection technologies have shortcomings: Traditional bacterial culture, as a national standard method (GB 4789.30-2022), provides reliable results, but the detection cycle is as long as 2-3 days, which cannot meet the needs of emergency testing; PCR technology, although it shortens the detection time to 1-3 hours, relies on expensive temperature cycling instruments, making it difficult to promote in grassroots settings; conventional recombinase-mediated isothermal nucleic acid amplification (RAA) technology can complete amplification in 30-60 minutes under constant temperature conditions of 37-42℃, but it is prone to false positives.
[0004] Existing technologies have combined RAA and CRISPR / Cas trans-cleavage techniques to further improve the specificity of RAA technology. There are three main existing RAA-CRISPR / Cas detection technologies: a two-tube two-step method, a one-tube two-step method, and a one-tube one-step method. The two-tube two-step method requires separating RAA amplification and CRISPR / Cas into two independent reaction tubes. The first step involves adding the RAA component and target sample to the reaction tube and reacting at approximately 39°C for 30 minutes to amplify the target nucleic acid. The second step requires manually transferring the RAA amplification product to another reaction tube (CRISPR / Cas) and reacting at 37°C for another 30 minutes. The result is then determined by fluorescence signal. This method is time-consuming, and the manual transfer of RAA amplification products can easily cause aerosol contamination. The two-step method requires multiple tubes and strict contamination control measures, increasing the complexity of the detection process. The one-tube two-step method is a partial optimization of the two-tube two-step method, integrating the RAA and CRISPR / Cas reaction systems into a single reaction tube. However, it still requires a two-stage start-up: CRISPR / Cas is added to the tube cap, and the RAA system is added to the bottom. RAA amplification is completed first (approximately 30 minutes). After RAA amplification, the reaction tube is centrifuged or gently shaken to mix, allowing the CRISPR / Cas reagent to fall into the RAA system at the bottom of the tube. Then, the CRISPR / Cas trans-shear reaction is triggered. Although it eliminates the need to transfer the RAA reaction product, it still requires two steps for detection, resulting in a longer detection time (approximately 1 hour). The one-tube two-step method requires manual mixing, and both methods place high demands on the operating environment and personnel skills, making it difficult to meet the core requirements of "convenience and speed" for on-site detection, thus limiting its application in resource-constrained scenarios. The one-tube one-step method adds both the RAA and CRISPR / Cas reaction systems simultaneously to the bottom of the tube for a one-step reaction. It eliminates the need to transfer the RAA amplification product, reducing aerosol contamination, and avoids the need for centrifugation or shaking in two separate steps. One-tube-one-step methods, with their advantages of being single-tube, single-step, and requiring no complex or expensive equipment, are compatible with portable isothermal amplification instruments, making them ideal for point-of-care testing (POCT) scenarios such as primary laboratories and field sites. However, existing one-tube-one-step methods require the addition of physical separators (such as glycerol, sucrose, agarose, etc.) to the RAA-CRISPR / Cas system. The viscosity of these physical separators can affect the diffusion of the reaction system, thereby prolonging the detection time and detection sensitivity.
[0005] Therefore, there is still a need in the field for a simple, rapid and accurate RAA-CRISPR / Cas detection method for Listeria monocytogenes. Summary of the Invention
[0006] Building upon existing technologies, this invention provides a novel method for detecting Listeria monocytogenes. This method utilizes an optimized "one-tube, one-step" RAA-CRISPR / Cas detection system. This system eliminates the need for additional physical isolating agents; instead, it reduces interference between the two reaction systems by optimizing the ratio of RAA and CRISPR / Cas. Furthermore, by optimizing the composition of the RAA-CRISPR / Cas reaction system components, including the concentrations of buffer, RAA primers, probes, and Cas12a, this method achieves rapid, one-tube, one-step detection while significantly improving detection sensitivity and specificity. This results in a rapid, efficient, and highly sensitive and specific method for detecting Listeria monocytogenes. Therefore, this invention aims to provide a one-tube, one-step RAA-CRISPR / Cas12a detection method for Listeria monocytogenes, addressing the problems of long detection cycles, cumbersome operations, susceptibility to contamination, and high instrument dependence in existing detection techniques. It achieves rapid, sensitive, and specific detection of Listeria monocytogenes, and is simple to operate, low-cost, and suitable for widespread application at the grassroots level.
[0007] Specifically, based on existing technologies, to obtain the rapid, efficient, highly sensitive, and specific Listeria monocytogenes detection method of this invention, the present invention needs to overcome the following four core problems: 1. Single-tube integrated design integrates RAA amplification with CRISPR / Cas12a detection, avoiding aerosol contamination caused by RAA amplification product transfer; 2. Removing the physical barrier agent to perform a "one-tube, one-step" reaction can reduce the detection time to within half an hour, improving the timeliness of on-site testing; 3. Simplified equipment requirements: It can be operated with only a constant temperature incubation device, making it suitable for grassroots laboratories, food production sites, and other scenarios. 4. Optimize primer and CrRNA design to improve detection sensitivity while ensuring no cross-reaction with other foodborne pathogens, meeting the needs for accurate detection of high-risk foods.
[0008] To achieve the above objectives / solve the above technical problems, the technical solutions of the present invention include, but are not limited to, the following: In one aspect, the present invention provides a RAA-CRISPR / Cas reaction system, wherein the RAA-CRISPR / Cas reaction system is composed of a RAA isothermal amplification system and a CRISPR / Cas nucleic acid cleavage system, so that the RAA isothermal amplification reaction and the CRISPR / Cas nucleic acid cleavage reaction can be carried out simultaneously in the same container. The RAA isothermal amplification system includes primer pairs for amplifying target genes and nucleic acid probes coupled with chromogenic markers; The CRISPR / Cas nucleic acid cutting system includes a Cas endonuclease and a guide RNA that binds to the target gene; The volume ratio of the RAA isothermal amplification system to the CRISPR / Cas nucleic acid cleavage system is 2:1-2.5:1, preferably 2.2:1-2.3:1, and more preferably about 2.25:1.
[0009] In one aspect, the volume ratio of the RAA isothermal amplification system to the CRISPR / Cas nucleic acid cleavage system described in this invention is approximately 2.0:1, 2.1:1, 2.2:1, 2.21:1, 2.22:1, 2.23:1, 2.24:1, 2.25:1, 2.26:1, 2.27:1, 2.28:1, 2.29:1, 2.3:1, 2.4:1, or 2.5:1.
[0010] In one aspect, the concentration of primer pairs for amplifying the target gene in the RAA-CRISPR / Cas mixed reaction system of the present invention is 0.20-0.35 μM, preferably 0.20-0.31 μM; The concentration of the nucleic acid probe coupled with the chromogenic label in the RAA-CRISPR / Cas mixed reaction system is 0.05-0.30 μM, preferably 0.10-0.28 μM, and more preferably 0.18-0.23 μM; And / or, in the RAA-CRISPR / Cas nucleic acid cleavage system, the molar ratio of buffer, guide RNA, and Cas endonuclease is 1-2 : 1-10 : 10-15; preferably, the molar ratio of guide RNA, Cas endonuclease, and crRNA is approximately 1 : 3.3 : 13.2. In this invention, RAA In a CRISPR / Cas nucleic acid cleavage system, the molar ratio of the reaction substrate refers to the ratio between the product of the molar concentration and the volume of the reaction substrate. For example, in a mixture of 0.64 μL of 10x lysis buffer, 2.12 μL of 1 µmol / L Cas protein, and 0.85 μL of 10 µmol / L crRNA, the molar ratio of 10x lysis buffer, Cas endonuclease, and crRNA is approximately 1 : 3.3 : 13.2.
[0011] In one aspect, the concentrations of primer pairs for amplifying the target gene in the RAA-CRISPR / Cas mixed reaction system of the present invention are approximately 0.20 μM, 0.21 μM, 0.22 μM, 0.23 μM, 0.24 μM, 0.25 μM, 0.26 μM, 0.27 μM, 0.28 μM, 0.29 μM, 0.30 μM, 0.31 μM, 0.32 μM, 0.33 μM, 0.34 μM, or 0.35 μM.
[0012] In one aspect, the concentration of the nucleic acid probe coupled to the chromogenic label in the RAA-CRISPR / Cas mixed reaction system of the present invention is approximately 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 μM.
[0013] In one specific aspect, the concentration of the probe coupled to the chromogenic label in the RAA-CRISPR / Cas mixed reaction system of the present invention is approximately 0.18-0.23 μM.
[0014] In one specific aspect, the concentration of the probe coupled with the chromogenic label in the RAA-CRISPR / Cas mixed reaction system of the present invention is approximately 0.18 μM.
[0015] In one specific aspect, the concentration of the probe coupled with the chromogenic label in the RAA-CRISPR / Cas mixed reaction system of the present invention is approximately 0.23 μM.
[0016] In one aspect, the molar ratio of guide RNA, Cas endonuclease, and lysis buffer in the RAA-CRISPR / Cas mixed reaction system of the present invention is approximately 1:1:10⁻¹⁵, 1:2:10⁻¹⁵, 1:3:10⁻¹⁵, 1:3.1:10⁻¹⁵, 1:3.2:10⁻¹⁵, 1:3.3:10⁻¹⁵, 1:3.4:10⁻¹⁵, 1:3.5:10⁻¹⁵, 1:3.6:10⁻¹⁵, 1:3.7:10⁻¹⁵, 1:3.8:10⁻¹⁵, 1:3.9:10⁻¹⁵, 1:4:10⁻¹⁵, 1:6:10⁻¹⁵, 1: 7:10-15, 1:8:10-15, 1:9:10-15, 1:10:10-15, 1:1-8:10, 1:1-8:11, 1:1-8:12, 1:1-8:13, 1:1-8:13.1, 1:1-8:13.2, 1:1-8:13.3, 1:1-8:13.4, 1:1-8:13.5, 1:1-8:13.6, 1:1-8:13.7, 1:1-8:13.8, 1:1-8:13.9, 1:1-8 : 14, or 1 : 1-8 : 15.
[0017] In one specific aspect, the lysis buffer of the present invention is a 10X lysis buffer containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 pg / ml bovine serum albumin, and pH 7.9.
[0018] In one aspect, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the concentration of the guide RNA is 0.10-0.32 μM; preferably 0.16-0.314 μM.
[0019] In one aspect, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the concentration of the guide RNA is approximately 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, or 0.32 μM.
[0020] In one aspect, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the volume of the lysis buffer is 0.2-1.5 μL, preferably 0.24-1.1 μL.
[0021] In one specific embodiment, the concentration of the guide RNA in the RAA-CRISPR / Cas mixed reaction system of the present invention is approximately 0.314 μM.
[0022] In one aspect, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the concentration of the Cas endonuclease is 0.04-0.10; preferably 0.04-0.078 μM.
[0023] In one aspect, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the concentration of the Cas endonuclease is approximately 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, or 0.10 μM.
[0024] In one specific embodiment, the concentration of the Cas endonuclease in the RAA-CRISPR / Cas nucleic acid cleavage system of the present invention is approximately 0.078 μM.
[0025] In one aspect, in the RAA-CRISPR / Cas nucleic acid cleavage system of the present invention, the Cas endonuclease is selected from AsCas12a, FnCas12a, Lbcas12a, Lb5cas12a, Un1Cas12f1, Spcas9, LWacas13a, Lbucas13a, etc.
[0026] In one specific implementation, in the RAA-CRISPR / Cas nucleic acid cleavage system of the present invention, the Cas endonuclease is Cas12a.
[0027] In one aspect, the nucleic acid probe coupled to the chromogenic marker according to the present invention is a nucleic acid probe coupled with a fluorescent reporter group. In a specific aspect of the present invention, when the nucleic acid to be tested is present in the sample and detected by fluorescence method, the nucleic acid probe of the present invention will cause a fluorescence curve to appear on the PCR instrument. In particular, when the nucleic acid probe coupled with the fluorescent reporter group is used, a fluorescent reporter group is coupled to the 5' end of the probe sequence and a fluorescent quencher group is coupled to the 3' end.
[0028] In one specific aspect of the invention, when the nucleic acid to be tested is present in the sample and the test is performed using a lateral flow test strip, the nucleic acid probe of the invention will cause the C line and T line on the test strip to appear simultaneously. In particular, the nucleic acid probe with coupled fluorescent reporter group is coupled with a fluorescent reporter group at the 5' end of the probe sequence and biotin at the 3' end.
[0029] In one aspect, the 5' fluorescent reporter group of the fluorescent probe of the present invention is selected from FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 or TexasRed, preferably FAM.
[0030] In one aspect, the 3' end fluorescence quenching group of the fluorescent probe of the present invention is selected from BHQ1, TAMRA, Eclipse, Dabcyl, LowaBlackTMRQ or LowaBlackTMFQ, preferably BHQ1.
[0031] In one aspect, the RAA isothermal amplification system of the present invention further comprises buffer A and buffer B. Preferably, buffer A is about 25 μL of 10% PEG by mass and buffer B is about 2.5 μL of 280 mM magnesium acetate.
[0032] In one specific embodiment, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the concentration of the primer pair for amplifying the target gene is approximately 0.23 μM, the probe concentration is 0.18-0.23 μM, the amount of buffer A (PEG) is 0.13% by mass, and the concentration of buffer B (magnesium acetate) is 9 mM.
[0033] In one specific embodiment, in the RAA-CRISPR / Cas mixed reaction system of the present invention, the concentration of Cas endonuclease is 0.078 μM and the concentration of guide RNA targeting the target gene is 0.314 μM.
[0034] In one specific embodiment, the RAA-CRISPR / Cas mixed reaction system of the present invention is prepared by the following steps: (1) Prepare the RAA isothermal amplification system: Take about 2.2 μL each of 8µM upstream and downstream primers, about 25 μL of 10% PEG, about 2.5 μL of 280mM magnesium acetate, about 1.4-1.8 μL of 10µM probe, recombinase, single-stranded DNA binding protein, dNTP and DNA polymerase, mix them, and add sterile deionized water to make up to about 50 μL; (2) Preparation of CRISPR / Cas nucleic acid cleavage system: Mix approximately 1.24 μL of 10x lysis buffer, approximately 4.12 μL of 1 µM Cas12a protein, and approximately 1.65 μL of 10 µM crRNA, and add ddH2O to approximately 15 μL; and (3) Prepare the RAA-CRISPR / Cas mixed reaction system: Mix about 18 μL of the RAA isothermal amplification system from step (1) and about 8 μL of the CRISPR nucleic acid cleavage system from step (2).
[0035] In this invention, the term "about" means that, based on a given numerical value, there is at least a range of numerical variation of "±0.2".
[0036] In one aspect, the amplification primer pairs in the RAA isothermal amplification system of the present invention are used to amplify the hly gene or a fragment thereof of Listeria monocytogenes.
[0037] In one aspect, the probes in the RAA isothermal amplification system of the present invention are used to detect amplification. hly Genes or fragments thereof.
[0038] In one aspect, the CRISPR / Cas nucleic acid cleavage system of the present invention guides RNA targeting. hly Genes or fragments thereof.
[0039] In one aspect, the sequences of the amplification primer pairs in the RAA isothermal amplification system of the present invention are selected from: SEQ ID NO:1 and SEQ ID NO:4, SEQ ID NO:1 and SEQ ID NO:5, SEQ ID NO:1 and SEQ ID NO:6, SEQ ID NO:2 and SEQ ID NO:4, SEQ ID NO:2 and SEQ ID NO:5, SEQ ID NO:2 and SEQ ID NO:6, SEQ ID NO:3 and SEQ ID NO:4, SEQ ID NO:3 and SEQ ID NO:5, or SEQ ID NO:3 and SEQ ID NO:6, preferably SEQ ID NO:2 and SEQ ID NO:4; And / or, the sequence of the probe is selected from: SEQ ID NO: 9 or 10, preferably SEQ ID NO: 10.
[0040] In one specific implementation, the sequences of the amplification primer pairs in the RAA isothermal amplification system are selected from SEQ ID NO: 2 and SEQ ID NO: 4.
[0041] In one specific implementation, the probe sequence in the RAA isothermal amplification system is selected from: SEQ ID NO: 10 (TTATT).
[0042] In one aspect, the sequence of the guide RNA in the CRISPR / Cas nucleic acid cleavage system of the present invention is selected from: SEQ ID NO: 7 or 8, preferably SEQ ID NO: 8; And / or, the Cas endonuclease is selected from Cas9 endonuclease, Cas12 endonuclease or Cas13 endonuclease, preferably Cas12 endonuclease, more preferably Cas12a endonuclease.
[0043] In one specific implementation, the Cas endonuclease in the CRISPR / Cas nucleic acid cleavage system of the present invention is the Cas12a endonuclease.
[0044] In one specific implementation, the sequence of the guide RNA in the CRISPR / Cas nucleic acid cleavage system of the present invention is selected from: SEQ ID NO: 8.
[0045] In another aspect, the present invention provides a kit for detecting Listeria monocytogenes, comprising the reaction system described herein (e.g., a RAA-CRISPR / Cas mixed reaction system, or a separate RAA isothermal amplification system and a separate CRISPR / Cas nucleic acid cleavage system). In another aspect, the present invention also provides the use of the reaction system or kit described herein in the detection of Listeria monocytogenes.
[0046] In another aspect, the present invention provides a method for detecting Listeria monocytogenes, the method comprising the following steps: (1) Extracting nucleic acid from the sample to be tested as a template; and (2) Mix the reaction system or kit described in this invention with the template; (3) Listeria monocytogenes is detected by fluorescence method or lateral flow test strip method. When the PCR instrument shows a fluorescence curve or both T line and C line appear on the lateral flow test strip, Listeria monocytogenes is present.
[0047] In one aspect, in the method / use of the present invention, Listeria monocytogenes is detected using a fluorescence method or a test strip method. Listeria monocytogenes is present when a fluorescence amplification curve appears or when both the T line and the C line appear on the test strip.
[0048] Preferably, in the method / use of the present invention, the lateral flow test strip method is used to detect Listeria monocytogenes. When both the T line and the C line appear on the lateral flow test strip, Listeria monocytogenes is present.
[0049] In one aspect, in the method / use of the present invention, before using the lateral flow test strip method to detect Listeria monocytogenes, the reaction products of the RAA-CRISPR / Cas mixed reaction system and the sample are diluted, preferably by 2-10 times, more preferably by 2-5 times, and most preferably by 2 times.
[0050] In one aspect, in the method / use of the present invention, when detecting Listeria monocytogenes by fluorescence method, the probe sequence used is selected from: SEQ ID NO: 10 (TTATT), and a fluorescent reporter group is coupled to the 5' end of the probe sequence and a fluorescent quencher group is coupled to the 3' end; And / or, when detecting Listeria monocytogenes using the lateral flow test strip method, the LFA probe sequence used is selected from: SEQ ID NO: 12 (TTTTTTTTTATTTTTATTTT), and a fluorescent reporter group is coupled to the 5' end of the probe sequence and biotin is coupled to the 3' end.
[0051] Preferably, in the method / use of the present invention, when detecting Listeria monocytogenes using the test strip method, the LFA probe sequence used is selected from: SEQ ID NO: 12 (TTTTTTTTTATTTTTATTTT), and a fluorescent reporter group is coupled to the 5' end of the probe sequence and biotin is coupled to the 3' end.
[0052] In one aspect, the technical solution adopted by this invention is based on the following principle: According to the conserved Listeria monocytogenes hly Specific RAA primers and CrRNA were designed based on the gene (hemolysin gene) sequence. The RAA nucleic acid amplification reaction and the CRISPR / Cas12a detection reaction were integrated into the same reaction tube. Amplification and detection were completed in one step under isothermal conditions, and the results were interpreted by fluorescence signal and test strip visualization.
[0053] In one aspect, the present invention provides primers for the rapid identification of Listeria monocytogenes and other foodborne pathogens, comprising: Upstream primer F: AGAAACACGCGGATGAAATCGATAAGTAT (SEQ ID NO: 2); Downstream primer R: CTGGATAKGTTAGGCTCGAAATTGCATT (SEQ ID NO: 4); CrRNA: AAUUUCUACUAAGUGUAGAUacaacuuggaugucugcauua (SEQ ID NO: 8); Probe: FAM-TTATT-BHQ1 (SEQ ID NO: 10, used for fluorescence detection) or FAM-TTTTTTTTTATTTTTATTTT-Biotin (SEQ ID NO: 12, used for lateral flow test strip detection).
[0054] In one aspect, the present invention also provides a method for rapid identification of Listeria monocytogenes, specifically comprising the following steps: (1) Extraction of template DNA: 10 g of pork sample was chopped and mixed with 90 mL of LB broth, and homogenized at medium speed for 15 min. Different concentrations of Listeria monocytogenes were added to 0.9 mL of homogenate and vortexed to mix. Then, 40 pork samples were shuffled and reordered to prepare blind samples. The spiked samples were centrifuged at 500 r / min for 30 s to remove large pork particles. 50 μL of supernatant was vortexed with 50 μL of lysis buffer for 2 min, and then centrifuged at 12000 rpm for 1 min to collect the supernatant for nucleic acid detection. (2) Preparation of a one-step RAA-CRISPR Cas12a reaction system: (i) Fluorescence detection: Mix 2.2 μL each of RAA upstream and downstream primers (8 µmol / L), 25 μL of buffer A, 2.5 μL of buffer B, 1.4 μL of probe (10 µmol / L), recombinase, single-stranded DNA binding protein, dNTPs, and DNA polymerase. Add sterile deionized water to a final volume of 50 μL. After mixing, place 18 μL at the bottom of the reaction tube. In the CRISPR system, add 1.24 μL of 10x Cleavage Buffer, 4.12 μL of Cas12a protein (1 µmol / L), and 1.65 μL of CrRNA (10 µmol / L). Add ddH2O to a final volume of 15 μL. Then, place 8 μL of the mixed CRISPR system at the bottom of the reaction tube. Mix the 18 μL of RAA with the 8 μL of CRISPR. Finally, add 2 μL of template. Incubate the reaction tube at 37°C for 20 min for detection and read the results. (ii) Detection using test strips: Mix 2.2 μL each of RAA forward and reverse primers (8 µmol / L), 25 μL of buffer A, 2.5 μL of buffer B, 1.8 μL of probe (10 µmol / L) with recombinase, single-stranded DNA binding protein, dNTPs, and DNA polymerase. Add sterile deionized water to a final volume of 50 μL. After mixing, place 18 μL at the bottom of the reaction tube. In the CRISPR system, add 10x Cleavage... The following steps are required: 1.24 μL of buffer, 4.12 μL of Cas12a protein (1 µmol / L), 1.65 μL of CrRNA (10 µmol / L), and ddH2O to bring the total volume to 15 μL. Then, take 8 μL of the well-mixed CRISPR system and place it at the bottom of the reaction tube. Mix 18 μL of RAA with 8 μL of CRISPR, and finally add 2 μL of template. Incubate the reaction tube at 37°C for 30 min and then detect the results. Finally, drop the diluted product onto the test strip and observe the results. (3) Result interpretation: The appearance of a curve in the fluorescence method indicates a positive result; the appearance of both the T line and the C line in the test strip method indicates a positive result, while the appearance of only the C line without the T line indicates a negative result.
[0055] In summary, the beneficial effects of the present invention include at least the following: (1) First, compared with the existing two-tube two-step method, the one-tube one-step RAA-CRISPR / Cas12a method of the present invention simplifies the operation process and avoids aerosol pollution caused by the transfer of RAA amplification products. (2) Secondly, compared with the two-tube two-step method or the one-tube two-step method, the one-tube one-step method of the present invention shortens the detection time, requiring only 30 minutes; (3) Secondly, it simplifies the experimental equipment, and can be used for testing without complicated and expensive instruments. It can also be used for on-site testing in limited experimental environments (e.g., grassroots laboratories, field sites). (4) Compared with other one-tube one-step methods, the present invention optimizes the reagent components in the system and reduces the use of physical isolation agents, which is beneficial to shorten the detection reaction time and improve the detection sensitivity; (5) High sensitivity: The detection limit of the fluorescent plasmid can reach 0.3125 copies / μL, and the lowest detection limit of the bacterial solution is 2.5 CFU / mL; the detection limit of the test strip plasmid is 0.019 copies / μL, and the lowest detection limit of the bacterial solution is 0.3125 CFU / mL. (6) High specificity: In comparative experiments with other 7 foodborne pathogens (Escherichia coli, Bacillus cereus, Salmonella, Staphylococcus aureus, Listeria silens, Listeria ovis, and Listeria innocense), Listeria monocytogenes showed very good specificity, with only Listeria monocytogenes showing fluorescence curves and T lines. Attached Figure Description
[0056] Figure 1 This demonstrates the principle of a one-step detection method for a RAA-CRISPR / Cas12a hybrid system.
[0057] Figure 2 This demonstrates the establishment of a one-step RAA-CRISPR / Cas12a system. The steps include: A. Screening of RAA primers; B. Screening of the RAA and CRISPR ratios; C. Screening of fluorescent probes; and D. Screening of crRNA types.
[0058] Figure 3 This demonstrates the optimization of a one-step RAA-CRISPR / Cas12a fluorescence assay. Specifically: A. Optimization of the Cas12a to crRNA ratio; B. Optimization of the amount of 10x Cleavage Buffer used; C. Optimization of the amounts of 10x Cleavage Buffer, Cas12a, and crRNA used; D. Optimization of the amount of RAA primers used; E. Optimization of the amount of fluorescent probe used.
[0059] Figure 4This demonstrates the optimization of the one-step RAA-CRISPR / Cas12a test strip method. Specifically, this includes: A. Screening of the test strip's sample dilution factor; B. Screening of the test strip probe type; and C. Screening of the amount of test strip probe used.
[0060] Figure 5 This demonstrates the performance evaluation of a one-step RAA-CRISPR / Cas12a fluorescence assay. The assays include: A. Plasmid sensitivity test; B. Bacterial culture sensitivity test; and C. Specificity test.
[0061] Figure 6 This section presents a performance evaluation of the one-step RAA-CRISPR / Cas12a test strip method. The evaluation includes: A. Plasmid sensitivity test; B. Bacterial suspension sensitivity test; and C. Specificity test.
[0062] Figure 7 This displays the actual sample test results using the one-step RAA-CRISPR / Cas12a method and the standardization method SN / T 5224-2019. Specifically: A. Fluorescence method test results for actual samples 1-20; B. Fluorescence method test results for actual samples 21-40; C. Standardization method test results for actual samples 1-20; D. Standardization method test results for actual samples 21-40; E. Test strip method test results for actual samples 1-20; F. Test strip method test results for actual samples 21-40. Detailed Implementation
[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional channels, such as ordinary biochemical reagent stores.
[0064] In this embodiment, the samples to be tested are actual pork samples that have been identified as containing Listeria monocytogenes and samples containing... hly Positive plasmids for gene sequences (synthesized by Hangzhou Youkang Biotechnology Co., Ltd.), bacterial culture, etc.
[0065] like Figure 1This paper elucidates the principle of the one-step RAA-CRISPR / Cas12a hybrid detection method in the embodiments of this application. Specifically, nucleic acid is first extracted from a sample suspected of being contaminated with Listeria monocytogenes. The prepared nucleic acid sample is then transferred to a single centrifuge tube (premixed with RAA amplification reagent and CRISPR / Cas12a trans-cleavage reagent) for simultaneous RAA-CRISPR / Cas12a reaction, incubated at 37°C for 20 minutes (fluorescence method) or 30 minutes (test strip method). More specifically, in the RAA-CRISPR / Cas12a reaction system, the RAA amplification reaction occurs first; when the amplified product reaches a certain concentration, the CRISPR / Cas12a trans-cleavage reaction is initiated. If the target nucleic acid is present in the sample, the RAA amplification reagent (recombinase, single-stranded DNA binding protein, and DNA polymerase) will work synergistically to achieve rapid amplification of the target gene under the mediation of RAA primers. The amplified double-stranded DNA product is specifically recognized by the Cas12a protein guided by crRNA. This recognition process activates the attached nuclease activity of Cas12a, leading to nonspecific cleavage of the labeled single-stranded DNA reporter probe. Finally, the nonspecific cleavage signal of the probe is presented using a dual-mode detection method combining fluorescence and lateral flow test strips. This dual-mode detection method is applicable to a wider range of detection scenarios.
[0066] The principle of fluorescence detection is as follows: The reporter probe is a single-stranded DNA oligonucleotide with a fluorescent group (FAM) labeled at its 5' end and a quencher group (BHQ1) labeled at its 3' end. If the sample is contaminated with Listeria monocytogenes, the corresponding RAA amplification product will activate the crRNA-Cas12a complex, cleaving the single-stranded DNA oligonucleotide labeled with FAM at the 5' end and BHQ1 at the 3' end. This causes the fluorescent group (FAM) and the quencher group (BHQ1) to separate, thereby generating a detectable fluorescent signal. Conversely, if the sample does not contain Listeria monocytogenes, the trans-cleavage activity of Cas12a will not be activated, and the single-stranded DNA oligonucleotide labeled with FAM at the 5' end and BHQ1 at the 3' end remains intact, therefore no obvious fluorescent signal is generated.
[0067] For lateral flow assays (LFA), the reporter probe is a single-stranded DNA oligonucleotide chain labeled with fluorescein (e.g., FAM) at its 5' end and biotin at its 3' end. The RAA-CRISPR / Cas12a reaction mixture is added to the sample pad of the lateral flow test strip, and the solution migrates along the strip driven by capillary action of the absorbent pad. The conjugate pad of the test strip is coated with an anti-fluorescein antibody conjugated with gold nanoparticles to capture the fluorescein at the 5' end of the single-stranded DNA reporter probe; the control line (C line) is coated with streptavidin to capture the biotin at the 3' end of the probe; and the test line (T line) is coated with a secondary antibody to capture the anti-fluorescein antibody conjugated with colloidal gold. When Listeria monocytogenes is absent in the sample, the single-stranded DNA reporter probe remains intact (fluorescein at the 5' end and biotin at the 3' end) and is captured by the fluorescein antibody conjugated with gold nanoparticles on the conjugate pad. Subsequently, the biotin on the intact probe 3' binds to streptavidin on the control line, resulting in a visible red band at the control line. When the sample is positive for Listeria monocytogenes, the trans-cleavage activity of the Cas12a protein is activated, causing the fluorescein on the probe to separate from the biotin. At this point, the anti-fluorescein antibody conjugated with gold nanoparticles is captured by the secondary antibody on the detection line, and a red band appears on the detection T line.
[0068] Example 1: Establishment of a one-tube, one-step RAA-CRISPR Cas12a reaction system 1. Initial one-tube, one-step RAA-CRISPR Cas12a reaction system: (1) RAA reaction system: Recombinase, single-stranded DNA binding protein, dNTP and DNA polymerase mixed dry powder (purchased from Zhejiang Lingyu Biotechnology Co., Ltd., product number: S001LY). A Buffer (10% PEG by mass) 25 μL; 2.4 μL each of 8 μM upstream and downstream primers; 1μM probe 4μL; B Buffer (280mM magnesium acetate) 2.5μL; Add sterile water to a total of 50 μL.
[0069] (2) CRISPR reaction system: 6.38 μL of 10X Cleavage Buffer (10X lysis buffer, 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 pg / ml bovine serum albumin, pH 7.9, 25℃); 2.12 μL of 1 μM Cas12a (purchased from Zhejiang Lingyu Biotechnology Co., Ltd., catalog number: DB009LY); 0.85 μL of 10 μM crRNA; Add sterile water to bring the volume up to 15 μL.
[0070] (i) Fluorescence detection: Fluorescence reaction conditions: Mix the RAA reaction system and the CRISPR reaction system in the same reaction tube, and finally add 2 μL of template (positive plasmid or bacterial culture). Incubate the reaction tube at 37℃ for 20 min, and then perform real-time PCR detection to read the results. The reaction conditions for the real-time PCR instrument are: 37℃ for 30 s for 1 cycle, and 37℃ for 20 s for 60 cycles.
[0071] Interpretation of fluorescence results: The presence of an amplification curve indicates a positive result (presence); the absence of an amplification curve indicates a negative result.
[0072] (ii) Lateral flow test strip method: Lateral flow test strip reaction conditions: Mix the RAA reaction system and the CRISPR reaction system in the same reaction tube, and finally add 2 μL of template (positive plasmid or bacterial solution). Incubate the above reaction tube at 37℃ for 30 min. After amplification, dilute the product and add it to the test strip (purchased from Suzhou Xianda Gene Technology Co., Ltd., TS104) and interpret the results.
[0073] Interpretation of test strip results: The appearance of both the T and C lines on the test strip indicates a positive result; the appearance of only the C line without the T line indicates a negative result. If the C line does not appear during the test, the result is invalid.
[0074] Example 2: Optimization of the reaction system 1. Screening of primers for the RAA reaction system Three upstream and three downstream primers were designed, resulting in a total of nine possible primer pairs. These pairs were then screened: a1F / a1R, a1F / a2R, a1F / a3R, a2F / a1R, a2F / a2R, a2F / a3R, a3F / a1R, a3F / a2R, and a3F / a3R. A negative control group was also included. After arranging the combinations, the positive plasmid was first amplified by PCR, and the amplification products were then subjected to nucleic acid electrophoresis. Finally, the best primer pair was selected from these nine pairs. Figure 2 As shown in Figure A, the nucleic acid electrophoresis image shows that the band of a2F / a1R is the brightest, so this primer pair was chosen for subsequent experiments.
[0075] 2. Optimization of the volume ratio of RAA and CRISPR reaction system The compatibility of RAA and CRISPR systems was evaluated. Five different volume ratios were tested to screen for the best reaction system; the results are shown below. Figure 2 B, the specific screening process is as follows: (1) First, the RAA and CRISPR systems were prepared. Then, 18 μL of RAA and 18 μL of CRISPR were mixed evenly in a volume ratio of 1:1. Finally, 2 μL of template was added. The fluorescence curve obtained after the reaction was very messy and there was no rising gradient, indicating that the reaction system was unsuccessful. (2) Subsequently, based on the failure of the first ratio adjustment, the content of CRISPR was increased by 8 μL, and 18 μL of RAA and 26 μL of CRISPR were selected for the reaction. However, the fluorescence curve results showed that it was still disordered and the reaction system was unsuccessful. (3) After two previous adjustments of different ratios failed, 8 μL of RAA and 8 μL of CRISPR were selected in a volume ratio of 1:1. However, the reaction system still showed no success. (4) Next, the volume of RAA was reduced to 4 μL of RAA and 8 μL of CRISPR, with a volume ratio of 1:2. The reaction system was unsuccessful. (5) Based on the above four adjustments to the volume ratio of RAA and CDRISPR, it was found that the volume of RAA was either less than that of CRISPR or the same as that of CRISPR. Considering all factors, it is possible that the amplification products generated during the RAA reaction were insufficient or that the CRISPR content was too high, causing the amplification products to be cleaved prematurely and unable to generate fluorescence signals. Therefore, further adjustments were made. This time, the amount of RAA was increased to almost twice that of CRISPR. When 18 μL of RAA and 8 μL of CRISPR were selected, with a volume ratio of approximately 2:1, the system showed some amplification curves. Therefore, the volume ratio of this reaction system was used as the basis for subsequent experiments.
[0076] 3. Screening of fluorescent probes Next, fluorescent probes were screened using an 18 μL RAA reaction system and an 8 μL CRISPR reaction system. Two probes were selected: Probe 1 (SEQ ID NO: 9) and Probe 2 (SEQ ID NO: 10) (added in 1 μM, 4 μL of the RAA reaction system). The probes were selected based on their fluorescence performance in the system; those with better fluorescence values and more aesthetically pleasing curves were used for subsequent experiments. Figure 2 As shown in C, probe 2 is more effective than probe 1. Therefore, probe 2 is selected as the probe for subsequent experiments in the one-tube one-step fluorescence method.
[0077] 4. CrRNA screening Following probe screening, crRNAs were further screened using 18 μL of RAA reaction mixture and 8 μL of CRISPR reaction mixture. The CRISPR reaction mixture contained 0.85 μL (10 µmol / L) of crRNA. Given that a classic crRNA (SEQ ID NO: 7) was previously used, a suboptimal crRNA (SEQ ID NO: 8) was also selected to compare which crRNA produced better fluorescence. Figure 2 As shown in D, the experimental results show that the fluorescence value produced by the classic crRNA is only half that of the suboptimal crRNA, indicating that the suboptimal crRNA is more suitable for one-step RAA-CRISPR / Cas12a experiments than the classic one.
[0078] Example 3: Further optimization of the CRISPR / Cas reaction system The next step is to optimize other key reaction substrates in the one-tube, one-step process system based on the aforementioned screening.
[0079] 1. The ratio of Cas protein to crRNA was optimized. The ratio of Cas protein to crRNA refers to the ratio between the products of their molar concentrations and volumes. For example, if 4.12 μL of 1 µmol / L Cas is added and 1.65 μL of 10 µmol / L crRNA is added, the ratio is 1:4. Four different ratios were selected—1:6, 1:4, 1:2, and 1:1 (Cas : crRNA). Figure 3 A). The fluorescence effect of these three components increases with the increase of the crRNA ratio, with the highest fluorescence intensity produced when the ratio of the two components is 1:6. Since the fluorescence intensity produced by 1:6 and 1:4 is similar, the final ratio of 1:4 was chosen. The 1:4 ratio was selected based on the fact that crRNA forms a ribonucleoprotein complex with Cas12a to guide the Cas protein cleavage. A higher crRNA concentration can improve targeting accuracy and complex stability, thereby improving the robustness and anti-interference ability of the system—all of which are key characteristics for achieving reliable performance in practical applications.
[0080] 2. Optimization of lysis buffer volume Subsequently, the amount of 10X lysis buffer was optimized, such as... Figure 3As shown in B, the selected volume range was 0.24 μL to 1.04 μL, increasing in increments of 0.2 μL. The fluorescence value reached its highest when the amount of 10x lysis buffer reached 0.64 μL. However, as the amount of 10x lysis buffer was gradually increased, the fluorescence value gradually decreased. In the one-tube one-step fluorescence method, 0.64 μL was selected as the optimal volume of 10x lysis buffer.
[0081] 3. Optimization of the CRISPR / Cas reaction system Based on the aforementioned optimizations, the CRISPR reaction system in Example 1 was further optimized. First, the ratio of Cleavage Buffer: Cas12a: crRNA was optimized, adjusting the ratio according to their concentrations and volumes to further improve fluorescence output. Initially, the initial ratio of Cleavage Buffer: Cas12a: CrRNA was set at 1:3.3:13.2, a ratio between the molar concentration and volume product. Specifically, 0.64 μL of 10x lysis buffer: 2.12 μL of 1 µmol / L Cas protein: 0.85 μL of 10 µmol / L crRNA = 1:3.3:13.2. Then, the amount of each component added was further optimized based on this ratio. Figure 3 As shown in Figure C, the experimental results indicate that the higher the amount of each of the three components added, the higher the fluorescence value. The highest fluorescence value was achieved when the ratio of the three components was increased to 1.24 μL of 10x lysis buffer, 1 µmol / L of 4.12 μL of Cas protein, and 10 µmol / L of 1.65 μL of crRNA. However, when the amount of each component was further increased, their fluorescence values decreased. Therefore, in the one-tube one-step fluorescence assay, 1.24 μL of 10x lysis buffer, 1 µmol / L of 4.12 μL of Cas protein, and 10 µmol / L of 1.65 μL of crRNA were selected as the required concentrations for subsequent experiments in this system. At this point, the final concentration of Cas protein was 0.078 μM, and the final concentration of crRNA was 0.314 μM.
[0082] 4. Optimization of primer concentration in the RAA reaction system After optimizing the ratio of 10x Cleavage Buffer, Cas protein, and crRNA, the primer amount in the RAA reaction system of Example 1 was optimized. The initial concentration was kept constant at 8 μM. The initial primer addition amount in the RAA system was adjusted from 2.0 μL, increasing in increments of 0.2 μL until it reached 3.0 μL. Figure 3As shown in Figure D, the primer concentrations after mixing the 18 μL RAA system and the 8 μL CRSPR system increased from 0.21 μM to 0.31 μM. Peak fluorescence was observed when the primer concentration increased from 0.21 μM to 0.23 μM (corresponding to an initial primer addition of 2.2 μL in the RAA reaction system). The fluorescence value gradually decreased after 0.23 μM, therefore, we selected 0.23 μM as the primer concentration for subsequent experiments. The final RAA primer concentration in the one-tube fluorescence assay was 0.23 μM.
[0083] 5. Optimization of probe concentration in the RAA reaction system After optimizing the amount of RAA primers, the concentration of the probe in the initial RAA reaction system in Example 1 was optimized. The initial concentration was changed to 10 μM, and the initial amount of probe added to the initial RAA system was adjusted from 0.8 μL to 1.8 μL, increasing in increments of 0.2 μL. Figure 3 As shown in Figure E, correspondingly, the fluorescence value continuously increased as the primer concentration after mixing the 18 μL RAA system and the 8 μL CRSPR system increased from 0.10 μM (corresponding to an initial probe addition of 0.8 μL in the initial RAA reaction system) to 0.23 μM (corresponding to an initial probe addition of 1.8 μL in the initial RAA reaction system), and gradually increased from the lowest 0.10 μM to 0.18 μM (corresponding to an initial probe addition of 1.4 μL in the initial RAA reaction system). The fluorescence value reached its maximum at a probe concentration of 0.18 μM, but decreased with further increases in probe concentration. Therefore, 0.18 μM probe was selected as the required amount, and the final concentration of probe 2 in the one-tube one-step fluorescence method was 0.18 μM. In summary, the optimization and adjustment of these components constitute the one-tube one-step fluorescence RAA-CRISPR / Cas12a detection system.
[0084] Therefore, the final method for preparing the one-tube, one-step fluorescence RAA-CRISPR Cas12a reaction system is as follows: Mix 2.2 μL (8 µmol / L) each of RAA forward and reverse primers, 25 μL of buffer A (10% PEG), 2.5 μL of buffer B (280 mM magnesium acetate), and 1.4 μL (10 µmol / L) of probe with recombinase, single-stranded DNA binding protein, dNTPs, and DNA polymerase. Finally, add sterile deionized water to a final volume of 50 μL, mix well, and place 18 μL at the bottom of the reaction tube. In the CRISPR system, 1.24 μL of 10x Cleavage Buffer, 4.12 μL (1 µmol / L) of Cas12a protein, and 1.65 μL (10 µmol / L) of crRNA are required. Add ddH2O to a final volume of 15 μL. Then, place 8 μL of the mixed CRISPR system at the bottom of the reaction tube, mix 18 μL of RAA with 8 μL of CRISPR, and finally add 2 μL of template.
[0085] Example 4: Optimization of the Lateral Flow Test Strip Design The optimization of the lateral flow test strip scheme mainly involves adjustments and optimizations to three aspects: sample dilution, probe selection, and probe quantity (results are shown in the figure). Figure 4 (As shown).
[0086] 1. Selection of dilution amount for the stock solution of the reaction product Because the stock solution of the RAA-CRISPR-Cas12a mixed reaction product is too viscous and contains too many components, it can inhibit color development on the test strip. Therefore, the stock solution, 2-fold dilution, 5-fold dilution, and 10-fold dilution were selected to evaluate the dilution factor of the RAA-CRISPR-Cas12a test strip for the amplification product. 18 μL of RAA, 8 μL of CRISPR, and 2 μL of template were mixed thoroughly and incubated at 37°C for 20 min. The final product was then diluted with Tris-EDTA buffer and added to the test strip (commercially available). Each condition was tested at the same three target concentrations (10 copies / μL, 5 copies / μL, and 1 copy / μL). No T line was observed in the undiluted stock solution, only a C line appeared, while the 10-fold dilution detected 10... 1 Copies / μL, the rest did not show a T line. In contrast, the 5-fold and 2-fold diluted samples could be detected in all three concentration ranges. After multiple comparative experiments, it was found that the 2-fold diluted sample solution showed better sensitivity and a clearer T line on the test strip, and therefore it was selected for subsequent screening of probe types and dosages. Figure 4 A).
[0087] 2. The impact of probe type and dosage on the test strip detection scheme Secondly, two different LFA probes (probe 1 and probe 2) were screened in the test strips. The initial RAA system contained 10 μM probes, with 1.8 μL added (the corresponding probe concentration after mixing an 18 μL LAA system and an 8 μL CRSPR system was 0.23 μM). The plasmid concentration was 10 μM. 1 Evaluations were conducted at 1 and 0.1 copy / μL. Figure 4 B). As the plasmid concentration decreased, probe 1 gradually failed to produce a positive signal (no T line, only a C line), while probe 2 maintained its detection capability at low concentrations (T lines appeared) and the T lines were all very clear. Since probe 2 showed better performance than probe 1, it was selected for subsequent experiments.
[0088] 3. Optimization of LFA probe concentration To improve the detection sensitivity and specificity of the test strips, the LFA probe concentration in the initial RAA reaction system was optimized. The initial LFA probe concentration was 10 μM, and the initial addition amount of LFA probe in the RAA system was adjusted from 1.4 μL, gradually increased in increments of 0.2 μL to 2.2 μL. The LFA probe amount was systematically tested using positive plasmids at concentrations of 1, 0.1, and 0.01 copies / μL. Figure 4 As shown in Figure C, when the initial LFA probe addition in the RAA system is 1.8 μL, that is, when the LFA probe concentration after mixing the 18 μL RAA system and the 8 μL CRSPR system is 0.23 μM, the lateral flow test strip can detect 0.01 copy / μL—this is the lowest detectable concentration. Although a higher probe dosage can still maintain detection capability, considering both performance and reagent savings, 0.23 μM was ultimately selected as the optimal dosage, and the final concentration of probe 2 in the one-tube one-step test strip method is 0.23 μM.
[0089] Therefore, the final method for preparing the one-tube, one-step test strip method RAA-CRISPR Cas12a reaction system is as follows: Mix 2.2 μL (8 µmol / L) each of the RAA forward and reverse primers, 25 μL of buffer A (10% PEG), 2.5 μL of buffer B (280 mM magnesium acetate), and 1.8 μL (10 µmol / L) of probe with recombinase, single-stranded DNA binding protein, dNTPs, and DNA polymerase. Add sterile deionized water to a final volume of 50 μL. After mixing, place 18 μL of the mixture at the bottom of the reaction tube. In the CRISPR system, add 1.24 μL of 10x Cleavage Buffer, 4.12 μL (1 µmol / L) of Cas12a protein, and 1.65 μL (10 µmol / L) of crRNA. Add ddH2O to a final volume of 15 μL. Then, place 8 μL of the mixed CRISPR system at the bottom of the reaction tube. Mix the 18 μL RAA system with the 8 μL CRISPR system. Finally, add 2 μL of template.
[0090] Example 5 Performance Evaluation of One-Tube One-Step RAA-CRISPR / Cas12a Fluorescence Chromatography After continuous optimization, the final one-step RAA-CRISPR / Cas12a reaction system was determined, and detection performance evaluation was subsequently initiated. The concentrations of the reaction substrates in the final system were as follows: Cas endonuclease 0.078 μM, crRNA 0.314 μM, primer pair 0.23 μM, probe 0.18 μM, A buffer 0.13%, and B buffer 9 mM.
[0091] 1. Plasmid detection sensitivity in the fluorescence colorimetric detection protocol First, the fluorescence plasmid sensitivity of the RAA-CRISPR / Cas12a system was detected. For example... Figure 5 As shown, by adjusting the initial concentration of template DNA (2.98 × 10⁻⁶), 10 The plasmid was serially diluted (copies / μL). Because it can detect high concentrations of plasmid, relatively lower concentrations were chosen, ranging from 10 copies / μL to 0.078 copies / μL. The lowest concentration that produced a positive result was 0.3125 copies / μL; subsequent lower concentrations did not show fluorescent amplification, indicating that the LOD of the fluorescent plasmid detection method is 0.3125 copies / μL (see [reference]). Figure 5 A).
[0092] 2. Sensitivity of bacterial suspension detection in the fluorescence colorimetric detection scheme Subsequently, the sensitivity of the bacterial culture was tested. The cultured bacterial solution was diluted to 0.3125 CFU / mL according to a concentration gradient. Figure 5The fluorescence spectrum of B shows that the lowest fluorescence curve is at a bacterial concentration of 2.5 CFU / mL. Therefore, the lowest detectable concentration of the bacterial solution is 2.5 CFU / mL (LOD is 2.5 CFU / mL).
[0093] 3. Specificity in fluorescence colorimetric detection schemes Next, a specificity experiment was conducted, comparing Listeria monocytogenes with seven other foodborne pathogens (Escherichia coli, Bacillus cereus, Salmonella, Staphylococcus aureus, Listeria silens, Listeria ovis, and Listeria innocense). Only Listeria monocytogenes showed a fluorescence curve; the other seven bacteria did not show fluorescence values, indicating that this fluorescence method has good specificity. Figure 5 C).
[0094] Example 6. Performance Evaluation of One-Step RAA-CRISPR / Cas12a Test Strip Method 1. Plasmid detection sensitivity in the test strip detection protocol Lateral flow test strip experiments were also conducted using gradient dilution. First, plasmid concentration was measured, with the detection range from 5 copies / μL to 0.0097 copies / μL. The test strip results showed that T and C lines were visible at concentrations from 5 copies / μL to 0.0195 copies / μL. Concentrations lower than 0.0195 copies / μL only showed a C line, without a T line. Therefore, the limit of detection (LOD) for plasmids using the test strip method was 0.0195 copies / μL. Figure 6 A).
[0095] 2. Sensitivity of bacterial suspension detection in the test strip detection protocol The detection range for bacterial suspension sensitivity is based on a concentration gradient dilution of 10⁻⁶. 5 The CFU / mL level decreased to 0.078 CFU / mL, and the results showed that from 10... 5 T and C lines were visible at concentrations from CFU / mL to 0.15625 CFU / mL, while no T line appeared at concentrations lower than 0.15625 CFU / mL. This indicates that the limit of detection for bacterial suspensions using the test strip method is 0.15625 CFU / mL. Figure 6 B).
[0096] 3. Specificity in the test strip detection protocol A specificity test was then performed, comparing Listeria monocytogenes with several other foodborne pathogens (e.g., Escherichia coli, Bacillus cereus, Salmonella, Staphylococcus aureus, Listeria silens, Listeria ovis, and Listeria innocense). The test strips showed that only Listeria monocytogenes produced both T and C lines; the other pathogens did not produce a T line, only a C line. This result indicates that the test strip method has good specificity. Figure 6 C).
[0097] Example 7: Validation of the RAA-CRISPR / Cas12a one-tube-one-step detection method in clinical samples. Finally, 40 pork samples contaminated with Listeria monocytogenes were artificially prepared. 10g of pork samples were chopped and homogenized with 90ml of LB liquid medium at medium speed for 15 minutes. Then, different concentrations of Listeria monocytogenes (e.g., 10g) were added to 0.9ml of the homogenate. 2 10 5 10 6 Samples containing Listeria monocytogenes contamination were centrifuged at 500 rpm for 30 seconds to remove larger pork particles. 50 μL of supernatant was mixed with 50 μL of lysis buffer, vortexed for 2 minutes, and then centrifuged at 12,000 rpm for 1 minute to obtain the supernatant (i.e., nucleic acid) for nucleic acid detection. After nucleic acid extraction, these samples were simultaneously tested using a one-step RAA-CRISPR / Cas12a fluorescence assay, a horizontal standard assay, and a lateral flow strip assay.
[0098] 1. Fluorescence detection of clinical samples In the fluorescence detection method, 18 clinical samples showed positive results, and 22 samples showed negative results. Figure 7 A and 7B).
[0099] 2. Standard method SN / T 5224-2019 for testing clinical samples The accuracy of the one-tube, one-step RAA-CRISPR / Cas12a fluorescence method was verified using the method disclosed in the Entry-Exit Inspection and Quarantine Industry Standard SN / T 5224-2019, "Test Method for Listeria Monotrophus in Exported Food—Real-time Fluorescent PCR Internal Standard Method" (hereinafter referred to as "Industry Standard Method SN / T 5224-2019"). The results showed consistency with the detection results of Industry Standard Method SN / T 5224-2019, and our method even demonstrated higher sensitivity and specificity than that of Industry Standard Method SN / T 5224-2019. Specifically, the Industry Standard Method yielded 16 positive samples and 24 negative samples. Figure 7 C and 7D).
[0100] 3. Test strip protocol for testing clinical samples In the lateral flow test strip test, out of 40 artificially prepared actual samples, 37 were positive (37 / 40), with a positive rate of 92.5%; and 3 were negative. Figure 7 E and 7F).
[0101] Therefore, it can be concluded that the one-step RAA / CRISPR-cas12a test strip method is reliable and has a high accuracy in detecting Listeria monocytogenes in actual samples.
[0102] Table 1. Primer, probe, and crRNA sequences used in the examples.
Claims
1. A RAA-CRISPR / Cas hybrid reaction system, characterized in that, The RAA-CRISPR / Cas mixed reaction system is mixed by a RAA isothermal amplification system and a CRISPR / Cas nucleic acid cleavage system, so that the RAA isothermal amplification reaction and the CRISPR / Cas nucleic acid cleavage reaction can be carried out synchronously in the same container, The RAA isothermal amplification system comprises a primer pair for amplifying a target gene and a nucleic acid probe coupled with a chromogenic marker; The CRISPR / Cas nucleic acid cleavage system comprises a Cas endonuclease and a guide RNA binding to a target gene; The volume ratio of the RAA isothermal amplification system to the CRISPR / Cas nucleic acid cleavage system is 2:1-2.5:1, preferably 2.2:1-2.3:1, and more preferably about 2.25:
1.
2. The reaction system of claim 1, wherein, The concentration of the primer pair for amplifying a target gene in the RAA-CRISPR / Cas mixed reaction system is 0.20-0.35 μM, preferably 0.20-0.31 μM; And / or, the concentration of the nucleic acid probe coupled with a chromogenic marker in the RAA-CRISPR / Cas mixed reaction system is 0.05-0.30 μM, preferably 0.10-0.28 μM, and more preferably 0.18-0.23 μM; And / or, the molar ratio of the guide RNA, the Cas endonuclease and the cleavage buffer in the RAA-CRISPR / Cas mixed reaction system is 1:1-10:10-15, preferably about 1:3.3:13.
2.
3. The reaction system of claim 1, wherein, The nucleic acid probe coupled with a chromogenic marker is a nucleic acid probe coupled with a fluorescent reporter group.
4. The reaction system of claim 1, wherein, The amplification primer pair in the RAA isothermal amplification system is used for amplifying the hly gene or fragment thereof of Listeria monocytogenes.
5. The reaction system according to claim 4, characterized in that, The sequence of the primer pair in the RAA isothermal amplification system is selected from SEQ ID NO: 1 and SEQ ID NO: 4, SEQ ID NO: 1 and SEQ ID NO: 5, SEQ ID NO: 1 and SEQ ID NO: 6, SEQ ID NO: 2 and SEQ ID NO: 4, SEQ ID NO: 2 and SEQ ID NO: 5, SEQ ID NO: 2 and SEQ ID NO: 6, SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 3 and SEQ ID NO: 5, or SEQ ID NO: 3 and SEQ ID NO: 6, preferably SEQ ID NO: 2 and SEQ ID NO:
4. And / or, the sequence of the nucleic acid probe is selected from SEQ ID NO: 9 or 10, preferably SEQ ID NO:
10.
6. The reaction system of claim 1, wherein The sequence of the guide RNA in the CRISPR / Cas nucleic acid cleavage system is selected from SEQ ID NO: 7 or 8, preferably SEQ ID NO:
8. and / or the Cas endonuclease is selected from a Cas9 endonuclease, a Cas12 endonuclease or a Cas13 endonuclease, preferably a Cas12 endonuclease, more preferably a Cas12a endonuclease.
7. The reaction system of claim 1, wherein, The RAA-CRISPR / Cas mixed reaction system is prepared by the following steps: (1) Preparation of RAA isothermal amplification system: about 2.2 μL of 8 μM upstream and downstream primers, about 25 μL of 10% PEG, about 2.5 μL of 280 mM magnesium acetate, about 1.4-1.8 μL of 10 μM probe, recombinant enzyme, single-stranded DNA binding protein, dNTP and DNA polymerase are mixed, and sterilized deionized water is added to about 50 μL; (2) Preparation of CRISPR / Cas nucleic acid cleavage system: about 1.24 μL of 10x cleavage buffer, about 4.12 μL of about 1 µM Cas12a protein, and about 1.65 μL of about 10 µM crRNA are mixed, and ddH2O is added to about 15 μL; (3) Preparation of RAA-CRISPR / Cas mixed reaction system: about 18 μL of RAA isothermal amplification system of step (1) and about 8 μL of CRISPR nucleic acid cleavage system of step (2) are mixed.
8. A kit for detecting Listeria monocytogenes, characterized by, The reaction system according to any one of claims 1-7.
9. Use of the reaction system according to any one of claims 1-7 or the kit according to claim 8 in detecting Listeria monocytogenes.
10. A method of detecting Listeria monocytogenes, characterized in that, The method comprises the following steps: (1) extracting DNA as a template from a sample to be tested; and (2) mixing the reaction system according to any one of claims 1-7 or the kit according to claim 8 with the template; (3) detecting Listeria monocytogenes using a fluorescence method or a lateral flow test strip method, when a fluorescence curve appears on a PCR instrument or both T line and C line appear on a lateral flow test strip, then Listeria monocytogenes exists.