Nucleic acid sequence for detecting rape plant DBN7009 and detection method thereof
By designing specific nucleic acid sequences and detection methods, the detection challenge of the DBN7009 transgenic rapeseed event was solved. Furthermore, multiple herbicide tolerance genes were used to achieve multiple herbicide tolerance in rapeseed, ensuring the sustainability and efficiency of agricultural production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies are insufficient to effectively detect the presence of the genetically modified rapeseed incident DBN7009, and long-term reliance on a single herbicide system has led to glyphosate-resistant weeds, increasing pesticide costs and operational complexity, and affecting the sustainability of agricultural production.
This invention provides a nucleic acid sequence and its detection method. Primers or probes are designed based on specific nucleic acid sequences to accurately identify the presence of the transgenic rapeseed event DBN7009. Furthermore, by combining expression vectors of multiple herbicide tolerance genes, tolerance to glyphosate, glufosinate, 2,4-D, and benzoxazine can be achieved.
It enables rapid and accurate detection of the presence of the genetically modified rapeseed event DBN7009, ensuring the sustainability of agricultural production and efficient weed control, while reducing the cost of herbicide use and environmental impact.
Smart Images

Figure CN121759628A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, particularly to the field of transgenic crop breeding in agricultural biotechnology research. Specifically, this invention relates to a transgenic rapeseed event DBN7009 resistant to glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D, and benzoxazine herbicides, and a nucleic acid sequence for detecting whether a biological sample contains the specific transgenic rapeseed event DBN7009, as well as a detection method thereof. Background Technology
[0002] Rapeseed (Brassica napus L.) is a major source of edible oil and feed protein in my country, ranking second only to soybeans in importance among global oilseed crops. Since the 1960s and 70s, with the promotion and planting of low-erucic acid and low-erucic acid rapeseed varieties, its cultivation area has gradually expanded, and it has now become one of the key edible oilseed crops. Rapeseed belongs to the genus Brassica in the family Brassicaceae. Its origin can be traced back to the natural hybridization of turnip and Chinese cabbage in specific geographical areas, and it has now become one of the most closely watched species in the field of transgenic research.
[0003] Weed infestation is a significant factor limiting rapeseed yield, making effective weed control crucial for rapeseed production. The successful development of herbicide-resistant rapeseed varieties has brought significant convenience to agricultural production. These genetically modified rapeseed varieties allow for direct application of appropriate herbicides during the growing season, achieving highly efficient weed control. Furthermore, herbicide-resistant rapeseed supports no-till direct seeding, helping to reduce soil erosion. Currently commercialized genetically modified rapeseed varieties include six herbicide-resistant lines from Bayer Crop Science (MS8RF3, MS1RF2, MS1RF1, Oxy-235, Topas19 / 2, and T45), and the glyphosate-resistant variety GT73 (also known as RT73) developed by Monsanto. These rapeseed varieties are mainly grown on a large scale in Canada and the United States, and have also seen some promotion in Australia. Due to its effective weed control, reduced herbicide dosage and residues, and decreased need for multiple applications and herbicide mixing, this technology has been increasingly adopted by growers.
[0004] The widespread adoption of glyphosate-tolerant farming systems and the increasing use of glyphosate have led to the prevalence of glyphosate-resistant weeds in recent years. In areas where growers face glyphosate-resistant weeds or a shift towards more difficult-to-control weed species, they may compensate for glyphosate's weaknesses by mixing it with or alternating it with other herbicides that can control elusive weeds. However, this strategy is a passive remedy that not only increases application costs and operational complexity but may also exacerbate environmental impact. This stark reality profoundly reveals the unsustainability of herbicide systems that rely on a single mechanism of action. Therefore, to break through the current predicament and ensure long-term stable and high yields in agriculture, it is imperative to actively research and promote transgenic crops with novel herbicide tolerance traits. This is not only a fundamental strategy for addressing the current challenge of resistant weeds but also a key path to promote the development of rapeseed and other crop production systems towards a more sustainable and efficient direction.
[0005] N-phosphonomethylglycine, also known as glyphosate, is a systemic, chronic, broad-spectrum, non-selective herbicide. Glyphosate is a competitive inhibitor of phosphoenolpyruvate (PEP), the substrate for the synthesis of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). It inhibits the conversion of PEP and 3-phosphate shikimate to 5-enolpyruvylshikimate-3-phosphate shikimate under EPSPS catalysis, thereby blocking the synthesis pathway of shikimate, a precursor of aromatic amino acids. This disrupts protein synthesis, leading to plant and bacterial death. Glyphosate tolerance can be achieved by expressing modified EPSPS. Modified EPSPS has a lower affinity for glyphosate, thus maintaining its catalytic activity in the presence of glyphosate, thereby acquiring glyphosate tolerance.
[0006] Glufosinate is a non-systemic, non-selective herbicide belonging to the phosphinotrichum class. It is primarily used for post-emergence control of annual or perennial broadleaf weeds. It controls weeds through the irreversible inhibition of glutamine synthase (an enzyme essential for ammonia detoxification in plants) by L-phosphinotrichum (the active ingredient in glufosinate). Unlike glyphosate, which kills roots, glufosinate first kills leaves and is translocated through the xylem via transpiration. Its speed of action falls between that of paraquat and glyphosate. Phosphinotrichum N-acetyltransferase (PAT), isolated from Streptomyces, catalyzes the conversion of L-phosphinotrichum to its inactive form via acetylation. Genes expressing plant-optimized forms of PAT have been used in soybeans to confer tolerance to glufosinate herbicides, as in soybean event A5547-127. Therefore, combining glufosinate herbicides with glufosinate tolerance traits can serve as a non-selective means of effectively managing glyphosate-resistant weeds.
[0007] 2,4-D (also known as 2,4-dichlorophenoxyacetic acid) has been used for broad-spectrum broadleaf weed control in both agricultural and non-crop conditions for over 65 years and is one of the most widely used herbicides globally. 2,4-D is a phenoxy acid herbicide used to selectively control broadleaf weeds in many monocotyledonous crops, such as maize, wheat, and rice, without severely damaging the target crop. 2,4-D is a synthetic auxin derivative that works by disrupting normal cytokine homeostasis and inhibiting balanced, controlled growth. The combination of 2,4-D and glyphosate has been used to provide stronger inactivation treatments before planting no-till soybeans and cotton. 2,4-D exhibits different levels of selectivity in some plants (e.g., dicotyledons are more sensitive than grasses). The different metabolism of 2,4-D in different plants is one explanation for these varying levels of selectivity. Plants typically metabolize 2,4-D slowly, so different activities at target sites are more likely to explain the different plant responses to 2,4-D. Plant metabolism of 2,4-D typically occurs through a two-step process, usually involving hydroxylation followed by conjugation with an amino acid or glucose. Over time, microbial populations have developed efficient alternative pathways for degrading this particular foreign substance, leading to the complete mineralization of 2,4-D. For this reason, 2,4-D is currently formulated with a relatively short soil half-life and exhibits no significant residual effects on subsequent crops, promoting its herbicide application. Studies have shown that one organism capable of degrading 2,4-D is *Ralstonia eutropha*, whose gene encoding the first enzymatic step in the mineralization pathway is tfdA (α-ketoglutarate-dependent dioxygenase). The tfdA gene catalyzes the conversion of 2,4-D acid to dichlorophenol (DCP) via an α-ketoglutarate-dependent dioxygenase reaction. DCP exhibits almost no herbicidal activity compared to 2,4-D. The tfdA gene is used in transgenic plants to introduce 2,4-D resistance into dicotyledonous plants that are normally sensitive to 2,4-D, such as cotton and tobacco.
[0008] Hydroxyphenylpyruvate dioxygenase (HPPD) is an enzyme that reacts with iron ions (Fe... 2+In the presence of oxygen, the degradation product of tyrosine, p-hydroxyphenylpyruvic acid (HPP), is catalyzed and converted into homogenates (HG), precursors of tocopherol and plastoquinone (PQ) in plants. Tocopherol acts as a membrane-associated antioxidant; PQ is not only an electron carrier between PS II and the cytochrome b6 / f complex, but also an essential cofactor for phytoene desaturase in carotenoid biosynthesis. Herbicides that exert their effects by inhibiting HPPD mainly belong to three chemical families: triketones, isoxazoles, and pyrazolones. In plants, they block the biosynthesis of PQ from tyrosine by inhibiting HPPD, leading to PQ depletion and carotenoid deficiency. The aforementioned herbicides that inhibit HPPD are mobile bleaching agents in the plant phloem, which can cause new meristems and leaves exposed to light to appear white. Carotenoids are essential for photoprotection. In the absence of carotenoids, ultraviolet radiation and reactive oxygen species can damage the synthesis and function of chlorophyll, thereby inhibiting plant growth and even causing death.
[0009] Designing expression vectors containing exogenous functional genes (cEPSPS, cPAT, c24DT21, and cHTG genes) suitable for transforming rapeseed and obtaining corresponding commercially viable transgenic rapeseed events is of great significance. Besides the functional genes (cEPSPS, cPAT, c24DT21, and cHTG genes) themselves, the selection of regulatory elements is crucial for obtaining successful transformation events, and the technical effects are unpredictable. For example, the commercial glyphosate-resistant soybean transformation events GTS 40-3-2 (US5633435) and MON89788 (CN101252831B), both transformed with the CP4-EPSPS gene (with the same amino acid sequence) and both used a single expression cassette molecular design. However, due to the selection of different regulatory elements, the EPSPS protein expression levels and yields of the two transformation events differed significantly. Therefore, when designing expression vectors, it is necessary to fully consider and analyze the combination and interaction of regulatory elements, as well as their arrangement on T-DNA. Meanwhile, successful commercial rapeseed transformation events must comprehensively consider the vector design of cEPSPS, cPAT, c24DT21, and cHTG genes in rapeseed plants, the interaction effects of the four expression cassettes, herbicide tolerance, and the impact on yield and other plant physiological indicators. This will ensure that cEPSPS, cPAT, c24DT21, and cHTG genes can be expressed in rapeseed at appropriate levels and achieve their corresponding functions without affecting rapeseed yield and other physiological indicators.
[0010] It is known that the expression of exogenous genes in plants is influenced by their chromosomal location, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. Therefore, screening a large number of events is often required to identify commercially viable events (i.e., events where the introduced target gene is optimally expressed). For example, significant differences in the expression levels of introduced genes have been observed between events in plants and other organisms; differences may also exist in spatial or temporal patterns of expression, such as the relative expression of transgenes in different plant tissues. These differences manifest as actual expression patterns that may not match the expected expression patterns based on the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds or thousands of different events and screen for a single event with the expected transgene expression levels and patterns for commercial purposes. Events with the expected transgene expression levels and patterns can be used to introduce transgenes into other genetic backgrounds through sexual crossbreeding using conventional breeding methods. Offspring produced through this crossbreeding retain the transgene expression characteristics of the original transformant. Applying this strategy can ensure reliable gene expression in many varieties that are well adapted to local growing conditions.
[0011] Being able to detect the presence of specific events to determine whether the offspring of sexual hybridization contain the target gene would be beneficial. Furthermore, methods for detecting specific events would help comply with relevant regulations, such as the requirement for formal approval and labeling of foods derived from recombinant crops before they can be placed on the market. Detecting the presence of transgenes using any well-known polynucleotide detection method is possible, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These methods typically focus on commonly used genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgene DNA (“flanking DNA”) is known, these methods cannot be used to distinguish different events, especially those produced using the same DNA construct. Therefore, currently, a pair of primers spanning the junction of the inserted transgene and the flanking DNA is commonly used to identify transgene-specific events via PCR; specifically, a first primer contained within the inserted sequence and a second primer contained within the inserted sequence. Summary of the Invention
[0012] The purpose of this invention is to provide a method for detecting the nucleic acid sequence of rapeseed event DBN7009. The transgenic rapeseed event DBN7009 has good tolerance to glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D and benzoxazine herbicides, and the detection method can accurately and rapidly identify whether biological samples contain DNA molecules of transgenic rapeseed event DBN7009.
[0013] To achieve the above objectives, the present invention provides a nucleic acid molecule having the following nucleic acid sequence, wherein the nucleic acid sequence comprises at least 11 consecutive nucleotides in positions 1-476 of SEQ ID NO:3 or its complementary sequence and at least 11 consecutive nucleotides in positions 477-1162 of SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides in positions 1-678 of SEQ ID NO:4 or its complementary sequence and at least 11 consecutive nucleotides in positions 679-1735 of SEQ ID NO:4 or its complementary sequence.
[0014] Preferably, the nucleic acid sequence comprises 22-25 consecutive nucleotides in positions 1-476 of SEQ ID NO:3 or its complementary sequence and 22-25 consecutive nucleotides in positions 477-1162 of SEQ ID NO:3 or its complementary sequence, and / or 22-25 consecutive nucleotides in positions 1-678 of SEQ ID NO:4 or its complementary sequence and 22-25 consecutive nucleotides in positions 679-1735 of SEQ ID NO:4 or its complementary sequence.
[0015] Preferably, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence.
[0016] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in the transgenic rapeseed event DBN7009. The SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the rapeseed insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of the SEQ ID NO:1 or its complementary sequence is sufficient to identify the transgenic rapeseed event DBN7009. The SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in the transgenic rapeseed event DBN7009. The SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the rapeseed insertion site. The presence of the SEQ ID NO:2 or its complementary sequence is sufficient to identify the transgenic rapeseed event DBN7009.
[0017] Preferably, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence.
[0018] In this invention, the nucleic acid sequence comprises at least 11 or more consecutive polynucleotides (first nucleic acid sequence) of any portion of the T-DNA insert sequence in SEQ ID NO:3 or its complementary sequence, and at least 11 or more consecutive polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking rapeseed genomic DNA region in SEQ ID NO:3 or its complementary sequence. The nucleic acid sequence may further be homologous to or complementary to a portion of SEQ ID NO:3 comprising the complete SEQ ID NO:1. When the first and second nucleic acid sequences are used together, these nucleic acid sequences can be used as DNA primer pairs in DNA amplification methods to generate amplification products. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:1, the presence of the transgenic rapeseed event DBN7009 or its progeny can be diagnosed. The SEQ ID NO:3 or its complementary sequence is a 1162-nucleotide sequence located near the insertion junction at the 5' end of the T-DNA insert sequence in the transgenic rapeseed event DBN7009. The SEQ ID NO:3 or its complementary sequence consists of a 476-nucleotide 5' flanking sequence of the rapeseed genome (nucleotides 1-476 of SEQ ID NO:3) and 686 nucleotides from the pDBN14011 construct DNA sequence (nucleotides 477-1162 of SEQ ID NO:3). The presence of the transgenic rapeseed event DBN7009 can be identified by the presence of the SEQ ID NO:3 or its complementary sequence.
[0019] The nucleic acid sequence comprises at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any portion of the T-DNA insert sequence in SEQ ID NO:4 or its complementary sequence, and at least 11 or more consecutive polynucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking rapeseed genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence may further be homologous to or complementary to a portion of SEQ ID NO:4 comprising the complete SEQ ID NO:2. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences can be used as DNA primer pairs in DNA amplification methods to generate amplification products. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:2, the presence of the transgenic rapeseed event DBN7009 or its progeny can be diagnosed. The SEQ ID NO:4 or its complementary sequence is a 1735-nucleotide sequence located near the T-DNA insertion junction at the 3' end of the inserted sequence in the transgenic rapeseed event DBN7009. The SEQ ID NO:4 or its complementary sequence consists of 678 nucleotides from the pDBN14011 construct DNA sequence (nucleotides 1-678 of SEQ ID NO:4) and 1057 nucleotides from the 3' flanking sequence of the rapeseed genome (nucleotides 679-1735 of SEQ ID NO:4). The presence of the transgenic rapeseed event DBN7009 can be identified by the presence of the SEQ ID NO:4 or its complementary sequence.
[0020] Furthermore, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.
[0021] The SEQ ID NO:5 or its complementary sequence is a 13375-nucleotide sequence characterizing the transgenic rapeseed event DBN7009, and its specific genomic and genetic elements are shown in Table 1. The presence of the transgenic rapeseed event DBN7009 can be identified by the presence of the SEQ ID NO:5 or its complementary sequence.
[0022] Table 1. Genome and genetic elements contained in SEQ ID NO:5
[0023] Genetic elements / genome Length (bp) The position located on SEQ ID:5 5' Genome 476 1-476 LB 211 477-687 tPse9-01 643 688-1330 cEPSPS-02 1368 1347-2714 spAtCTP2-01 228 2715-2942 prGm17gTsf1-02 1010 2945-3954 t35S-01 195 3961-4155 cPAT-01 552 4156-4707 pr35s-01 530 4708-5237 prAtUbi10-01 1322 5245-6566 c24DT21-01 879 6575-7453 tNos-01 253 7460-7712 prBnUbi11C-01 2244 7719-9962 cHTG-01 1311 9963-11273 tAtH4-01 687 11274-11960 RB 358 11961-12318 3' Genome 1057 12319-13375
[0024] As is well known to those skilled in the art, the first, second, third, and fourth nucleic acid sequences do not necessarily consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogues that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in this invention should be at least approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which may be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the probes and primers may be at least approximately 21 to approximately 50 or more consecutive nucleotides in length.
[0025] The nucleic acid sequence or its complementary sequence can be used in DNA amplification to generate amplicones, which are used to detect the presence of transgenic rapeseed event DBN7009 or its progeny in biological samples; the nucleic acid sequence or its complementary sequence can be used in nucleotide detection to detect the presence of transgenic rapeseed event DBN7009 or its progeny in biological samples.
[0026] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample, comprising:
[0027] The sample to be tested is brought into contact with at least two primers used to amplify the target amplification product during the nucleic acid amplification reaction;
[0028] Perform nucleic acid amplification reaction; and
[0029] Detect the presence of the target amplification product;
[0030] The target amplification product contains the nucleic acid sequence.
[0031] Preferably, the target amplification product comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.
[0032] Specifically, the two primers include complementary sequences of SEQ ID NO:8 and SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11, or SEQ ID NO:1 and SEQ ID NO:2.
[0033] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample, comprising:
[0034] The sample to be tested is brought into contact with the probe, the probe containing the nucleic acid sequence;
[0035] The sample to be tested and the probe are hybridized under strict hybridization conditions; and
[0036] The hybridization between the sample to be tested and the probe is detected.
[0037] The stringent conditions can be defined as hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.
[0038] Preferably, the probe comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.
[0039] Optionally, at least one of the probes is labeled with at least one fluorescent group.
[0040] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample, comprising:
[0041] The sample to be tested is brought into contact with a labeled nucleic acid molecule, wherein the labeled nucleic acid molecule includes the nucleic acid sequence;
[0042] The sample to be tested and the labeled nucleic acid molecule are hybridized under strict hybridization conditions;
[0043] The hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is used to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecule.
[0044] Preferably, the marker nucleic acid molecule includes at least one selected from: SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, and SEQ ID NO:6-11 or their complementary sequences.
[0045] To achieve the above objectives, the present invention also provides a DNA detection kit comprising at least one DNA molecule containing the nucleic acid sequence, which can serve as one of the DNA primers or probes specific to the transgenic rapeseed event DBN7009 or its progeny.
[0046] Preferably, the DNA molecule comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.
[0047] To achieve the above objectives, the present invention also provides a plant cell or portion comprising a nucleic acid sequence encoding a glyphosate-tolerant EPSPS protein, a nucleic acid sequence encoding a glufosinate-ammonium (or glufosinate-ammonium)-tolerant PAT protein, a nucleic acid sequence encoding a 2,4-D-tolerant 24DT21 protein, a nucleic acid sequence encoding a benzoxazine-tolerant HTG protein, and a nucleic acid sequence in a specific region, wherein the nucleic acid sequence in the specific region comprises the sequences shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence in the specific region comprises the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:4.
[0048] Preferably, the plant cell or part thereof sequentially comprises the nucleic acid sequence of SEQ ID NO:1, the nucleic acid sequence of SEQ ID NO:5 from position 688 to 11960, and SEQ ID NO:2, or comprises the sequence shown in SEQ ID NO:5.
[0049] Preferably, the plant cells or portions contain transgenic rapeseed event DBN7009;
[0050] To achieve the above objectives, the present invention also provides a method for protecting rapeseed plants from damage caused by herbicides or controlling weeds in rapeseed-grown fields, comprising applying an effective dose of glyphosate, glufosinate-ammonium (or glufosinate), 2,4-D and / or benzoxazole herbicide to a field planted with at least one transgenic rapeseed plant, wherein the transgenic rapeseed plant contains the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2 in its genome, and the transgenic rapeseed plant is tolerant to glyphosate, glufosinate-ammonium (or glufosinate), 2,4-D and benzoxazole herbicide.
[0051] Preferably, the transgenic rapeseed plant contains the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:4 in its genome.
[0052] Preferably, the transgenic rapeseed plant contains, in sequence, the nucleic acid sequences of positions 688-11960 of SEQ ID NO:1 and SEQ ID NO:5 and SEQ ID NO:2 in its genome, or contains the sequence shown in SEQ ID NO:5.
[0053] To achieve the above objectives, the present invention also provides a method for cultivating rapeseed plants tolerant to glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D, and benzoyl permethrin herbicides, comprising:
[0054] Plant at least one rapeseed seed, wherein the genome of the rapeseed seed contains a nucleic acid sequence encoding a glyphosate-resistant EPSPS protein and / or a nucleic acid sequence encoding a glufosinate-ammonium (or glufosinate-ammonium)-resistant PAT protein and / or a nucleic acid sequence encoding a 2,4-D-resistant 24DT21 protein and / or a nucleic acid sequence encoding a benzoxazine-resistant HTG protein, and a nucleic acid sequence of a specific region, or the genome of the rapeseed seed contains the nucleic acid sequence shown in SEQ ID NO:5;
[0055] The rapeseed seeds are then allowed to grow into rapeseed plants.
[0056] The rapeseed plants were sprayed with an effective dose of glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D and / or benzoxazine herbicide, and the plants with reduced plant damage compared to other plants without specific regions of nucleic acid sequence were harvested.
[0057] The nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4.
[0058] To achieve the above objectives, the present invention also provides a method for producing rapeseed plants resistant to glyphosate, glufosinate-ammonium (or glufosinate), 2,4-D, and / or benzoxazole herbicides. The method includes introducing a nucleic acid sequence encoding a glyphosate-resistant EPSPS protein and / or a glufosinate-ammonium (or glufosinate)-resistant PAT protein and / or a 2,4-D-resistant 24DT21 protein and / or a benzoxazole-resistant HTG protein, and a specific region of the nucleic acid sequence contained in the genome of a first rapeseed plant, or introducing the nucleic acid sequence shown in SEQ ID NO:5 contained in the genome of the first rapeseed plant into a second rapeseed plant, thereby producing a large number of progeny plants; selecting the progeny plants having the nucleic acid sequence of the specific region, and the progeny plants being resistant to glyphosate, glufosinate-ammonium (or glufosinate), 2,4-D, and / or benzoxazole herbicides; the nucleic acid sequence of the specific region is SEQ ID NO:1 and / or SEQ ID NO:5. The sequence shown in SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4;
[0059] Preferably, the method includes sexually hybridizing a first rapeseed plant containing the transgenic rapeseed event DBN7009 with a second rapeseed plant to produce a large number of progeny plants, and selecting the progeny plants that have the nucleic acid sequence of the specific region.
[0060] The progeny plants were treated with glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D and / or benzoxazine;
[0061] Select the progeny plants that are tolerant to glyphosate, glufosinate (or glufosinate), 2,4-D and / or benzoxazine herbicides.
[0062] To achieve the above objectives, the present invention also provides an agricultural product or commodity derived from a genetically modified rapeseed plant containing the DBN7009 transgenic rapeseed event, wherein the agricultural product or commodity comprises lecithin, fatty acids, glycerol, sterols, edible oil, isolated rapeseed protein, hydrolyzed plant protein, textured rapeseed protein, rapeseed protein fiber, rapeseed cake, and rapeseed flour.
[0063] In the present invention for detecting nucleic acid sequences of rapeseed plants and the detection method thereof, the following definitions and methods can better define the present invention and guide those skilled in the art to implement the present invention. Unless otherwise stated, the terms should be understood according to the conventional usage of those skilled in the art.
[0064] The term "rapeseed (Brassica napus L.)" refers to all plant species that can interbreed with rapeseed, including wild rapeseed species.
[0065] The terms “comprising,” “including,” or “containing” mean “including, but not limited to”.
[0066] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and complete plant cells in a plant or plant part, such as embryo, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, all of which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells.
[0067] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence preceding the coding sequence (5' non-coding sequence) and the regulatory sequence following the coding sequence (3' non-coding sequence). A "natural gene" is a gene that is naturally found to have its own regulatory sequence. A "chimeric gene" is any gene that is not a natural gene but contains regulatory and coding sequences not naturally found. An "endogenous gene" is a natural gene located at its natural position in an organism's genome. A "foreign gene" is a foreign gene that is currently present in an organism's genome and was not originally present; it also refers to a gene introduced into a recipient cell through a transgenic process. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgenic gene" is a gene that has been introduced into the genome through a transformation process. The site where recombinant DNA has been inserted into the plant genome can be called an "insertion site" or a "target site."
[0068] "Flanking DNA" can comprise the genome naturally present in organisms such as plants or exogenous (heterologous) DNA introduced through a transformation process, such as fragments associated with the transformation event. Therefore, flanking DNA can include a combination of natural and exogenous DNA. In this invention, "flanking DNA," also referred to as a "flanking region," "flanking sequence," "flanking genomic sequence," or "flanking genomic DNA," refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or longer, located directly upstream or downstream of the initially exogenous inserted DNA molecule and adjacent to it. When the flanking region is downstream, it can also be referred to as a "3' flanking region" or "left boundary flanking region," etc. When the flanking region is upstream, it can also be referred to as a "5' flanking region" or "right boundary flanking region," etc.
[0069] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. A "junction" is the point where two specific DNA segments join. For example, junctions exist where the insert DNA joins flanking DNA. Junction sites also exist in transformed organisms where two DNA segments are joined together in a manner modified from those found in natural organisms. A "junction region" or "junction sequence" refers to the DNA containing the junction site.
[0070] This invention provides a transgenic rapeseed event called DBN7009 and its progeny, also known as rapeseed plant DBN7009, which includes the plant and seeds of the transgenic rapeseed event DBN7009 and its plant cells or regenerable parts thereof. The plant parts of the transgenic rapeseed event DBN7009 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, leaves, pods and products from the rapeseed event DBN7009, such as rapeseed cake, powder and oil, specifically lecithin, fatty acids, glycerol, sterols, edible oil, isolated rapeseed protein, hydrolyzed plant protein, textured rapeseed protein and rapeseed protein fiber, etc.
[0071] The present invention relates to a transgenic rapeseed event DBN7009, comprising a DNA construct that, when expressed in plant cells, acquires tolerance to glyphosate, glufosinate (or styrene), 2,4-D, and benzoxazine herbicides. The DNA construct comprises four tandem expression cassettes. The first expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding a signal peptide / transporter peptide, a nucleic acid sequence encoding a hydroxyphenylpyruvate dioxygenase (HTG) protein, and a suitable polyadenylation signal sequence, wherein the HTG protein is primarily resistant to benzoxazine. The second expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding a signal peptide / transporter peptide, a nucleic acid sequence encoding an α-ketoglutarate-dependent dioxygenase (24DT21) protein of *Acidobacterium tumefaciens*, and a suitable polyadenylation signal sequence, wherein the 24DT21 protein is primarily resistant to 2,4-D herbicide. The third expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding a phosphinic acid N-acetyltransferase (PAT) protein, and a suitable polyadenylation signal sequence, said PAT protein being resistant to glyphosate (or glufosinate) herbicide. The fourth expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding a 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) protein, and a suitable polyadenylation signal sequence, said EPSPS protein being resistant to glyphosate herbicide.
[0072] Furthermore, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible, and / or tissue-specific promoters. The suitable promoters include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the Scrophularia mosaic virus (FMV) 35S promoter, the ubiquitin promoter, the actin promoter, the Agrobacterium tumefaciens carmine synthase (NOS) promoter, the octopine synthase (OCS) promoter, the Cestrum yellow leaf curl virus promoter, the potato tuber storage protein (Patatin) promoter, the ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, the glutathione S-transferase (GST) promoter, the E9 promoter, the GOS promoter, the alcA / alcR promoter, and the Agrobacterium tumefaciens promoter. The RolD promoter of rhizogenes and the Suc2 promoter of Arabidopsis thaliana.
[0073] The signal peptide / transport peptide can guide the transport of EPSPS, PAT, 24DT21, and / or HTG proteins to specific organelles or compartments within the cell. For example, it can target chloroplasts using sequences encoding chloroplast transport peptides, or target the endoplasmic reticulum using 'KDEL' preserved sequences. The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants. Such suitable polyadenylation signal sequences include, but are not limited to, polyadenylation signal sequences derived from the Agrobacterium tumefaciens carmine synthase (NOS) gene, polyadenylation signal sequences derived from the cauliflower mosaic virus (CaMV) 35S terminator, polyadenylation signal sequences derived from the protease inhibitor II (PINII) gene, and polyadenylation signal sequences derived from the α-tubulin gene.
[0074] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers. These enhancers can amplify gene expression levels and include, but are not limited to, tobacco etching virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer.
[0075] The hydroxyphenylpyruvate dioxygenase (HTG) gene can be an enzyme isolated from microorganisms such as *Stenotrophomonas maltophilia*. It catalyzes the conversion of 4-hydroxyphenylpyruvate (HPP) to hydantoin, thereby interfering with the synthesis of plastoquinones and tocopherols in plants, thus conferring tolerance to HPPD inhibitor herbicides (such as benzoxazine, mesotrione, and methylsulfuron). HPPD is a key enzyme in the tyrosine catabolism pathway; its inhibitors can block carotenoid biosynthesis, leading to plant bleaching and death. Expression of this gene in crops allows plants to metabolize herbicides without being affected.
[0076] The term "benzoxazine" refers to a hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor herbicide with the chemical name [3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methanesulfonyl)phenyl](5-hydroxy-1-methyl-1H-pyrazol-4-yl) ketone. Treatment with "benzoxazine herbicide" means treatment with any herbicide formulation containing benzoxazine. The selection of the application rate of a particular benzoxazine formulation to achieve an effective biological dosage shall not exceed the skill level of a general agronomist. Treatment of fields containing plant material derived from the DBN7009 transgenic rapeseed event with any herbicide formulation containing benzoxazine will control weed growth in the field without affecting the growth or yield of the plant material derived from the DBN7009 transgenic rapeseed event.
[0077] The α-ketoglutarate-dependent dioxygenase (24DT21) gene of the acid-loving bacteria can be an enzyme isolated from the Delftia acidovorans strain. Belonging to the α-ketoglutarate-dependent dioxygenase family, it catalyzes the degradation of aryloxyphenoxypropionate and cyclohexanedione herbicides (such as 2,4-D, clodinafop-propionate, and quizalofop-p-ethyl), inactivating the herbicides through dealkylation or hydroxylation, thereby conferring crop tolerance to these herbicides. This enzyme can also metabolize auxin-producing herbicides such as 2,4-D propionic acid, expanding the spectrum of crop weed control.
[0078] "2,4-D" is short for 2,4-dichlorophenoxyacetic acid, a synthetic auxin herbicide. Treatment with "2,4-D herbicide" refers to treatment with any herbicide formulation containing 2,4-D. The selection of the application rate of a particular 2,4-D formulation to achieve an effective biological dosage does not exceed the skill level of a typical agronomist. Treatment of fields containing plant material derived from the DBN7009 transgenic rapeseed event with any herbicide formulation containing 2,4-D will control the growth of broadleaf weeds in the fields without affecting the growth or yield of the plant material derived from the DBN7009 transgenic rapeseed event.
[0079] The phosphinothricin N-acetyltransferase (PAT) gene can be an enzyme isolated from *Streptomyces viridochromogenes* strains, which catalyzes the acetylation of L-phosphinothricin to its inactive form, thereby conferring plant tolerance to herbicides such as glufosinate (or glufosinate-ammonium). Phosphinothricin (PTC, 2-amino-4-methylphosphonobutyrate) is an inhibitor of glutamine synthetase. PTC is the structural unit of the antibiotic 2-amino-4-methylphosphono-alanyl-alanine; this tripeptide (PTT) possesses activity against Gram-positive and Gram-negative bacteria as well as against the fungus *Botrytis cinerea*. The phosphinothricin N-acetyltransferase (PAT) gene can also serve as a selective marker gene.
[0080] The "glufosinate" mentioned is L-type glufosinate, chemically named L-2-amino-4-[hydroxy(methyl)phosphono]butanoic acid ammonium, which is the active isomer of glufosinate and has higher herbicidal activity. Treatment with "glufosinate herbicide" refers to treatment using any herbicide formulation containing glufosinate. The selection of the application rate of a particular glufosinate formulation to achieve an effective biological dose does not exceed the skill level of a typical agronomist. Treatment of fields containing plant material derived from the DBN7009 transgenic rapeseed event using any herbicide formulation containing glufosinate will control weed growth in the fields without affecting the growth or yield of the plant material derived from the DBN7009 transgenic rapeseed event.
[0081] The term "glufosinate," also known as glufosinate-butanedin, refers to ammonium 2-amino-4-[hydroxy(methyl)phosphono]butyrate. Treatment with "glufosinate herbicide" means treatment with any herbicide formulation containing glufosinate. The selection of the application rate of a particular glufosinate formulation to achieve an effective biological dosage shall not exceed the skill level of a typical agronomist. Treatment of fields containing plant material derived from the DBN7009 transgenic rapeseed event using any glufosinate-containing herbicide formulation will control weed growth in the fields without affecting the growth or yield of the plant material derived from the DBN7009 transgenic rapeseed event.
[0082] The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene from Agrobacterium sp. CP4 can be described as an enzyme isolated from Agrobacterium sp. CP4. As a key enzyme in the shikimate pathway, it catalyzes the synthesis of 5-enol-pyruvylshikimate-3-phosphate (EPSP) and exhibits naturally low sensitivity to glyphosate, thus conferring plant tolerance to glyphosate herbicides. Glyphosate competitively inhibits EPSPS activity, blocking the synthesis of aromatic amino acids and leading to the death of sensitive plants. Expression of the EPSPS gene in transgenic crops can maintain normal metabolic pathways, enabling normal crop growth under glyphosate treatment. This gene is also widely used as a selective marker in plant genetic transformation.
[0083] The chemical name of "glyphosate" is N-(phosphonomethyl)glycine, an inhibitor of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Treatment with "glyphosate herbicide" refers to treatment using any herbicide formulation containing glyphosate. The selection of the application rate of a particular glyphosate formulation to achieve an effective biological dose does not exceed the skill level of a typical agronomist. Treatment of fields containing plant material derived from the DBN7009 transgenic rapeseed event using any glyphosate-containing herbicide formulation will control weed growth in the fields without affecting the growth or yield of the plant material derived from the DBN7009 transgenic rapeseed event.
[0084] The DNA construct is introduced into plants using transformation methods, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.
[0085] Agrobacterium-mediated transformation is a commonly used method for plant transformation. Exogenous DNA to be introduced into the plant is cloned into the T-DNA region between the common sequences on the left and right boundaries of a vector. The vector is then transformed into Agrobacterium cells, which are subsequently used to infect plant tissues, whereby the T-DNA region of the vector containing the exogenous DNA is inserted into the plant genome.
[0086] The gene gun transformation method refers to bombarding plant cells with a vector containing exogenous DNA (particle-mediated biological bombardment transformation).
[0087] The pollen tube pathway transformation method utilizes the natural pollen tube pathway (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac via the nucellus pathway.
[0088] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and offspring with exogenous DNA must be selected using appropriate markers.
[0089] DNA constructs are combinations of interconnected DNA molecules that provide one or more expression cassettes. Preferably, the DNA constructs are plasmids capable of self-replication within bacterial cells and containing various restriction endonuclease sites for introducing DNA molecules that provide functional genetic elements, i.e., promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. The expression cassettes contained in the DNA constructs include genetic elements necessary for the transcription of messenger RNA, and these cassettes can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed, most preferably, for expression in plant cells.
[0090] A transgenic “event” is obtained by transforming plant cells with a heterologous DNA construct, which includes at least one nucleic acid expression cassette containing the target gene, inserted into the plant genome via transgenic methods to generate a plant population, regenerate the plant population, and select specific plants with characteristics of the insertion site in the specific genome. The term “event” refers to the original transformant containing heterologous DNA and its offspring. The term “event” also refers to the offspring obtained by sexual hybridization between the original transformant and other varietal individuals containing heterologous DNA, where, even after repeated backcrossing with a backcross parent, the inserted DNA and flanking genomic DNA from the original transformant parent are present at the same chromosomal location in the hybrid offspring. The term “event” also refers to a DNA sequence from the original transformant containing the inserted DNA and flanking genomic sequences closely adjacent to the inserted DNA, which is intended to be transferred to offspring produced by sexual hybridization of a parental line containing the inserted DNA (e.g., the original transformant and its self-crossed offspring) with a parental line not containing the inserted DNA, and the offspring receiving the inserted DNA containing the target gene.
[0091] In this invention, "recombination" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced through artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separate, for example, by chemical synthesis or by manipulating isolated nucleic acid segments using genetic engineering techniques. Techniques for manipulating nucleic acids are well known.
[0092] The term "transgenic" includes any cell, cell line, callus, tissue, plant part, or plant whose genotype has been altered due to the presence of a heterologous nucleic acid. "Transgenic" includes the original transgenic organism that was so altered, as well as offspring individuals generated from the original transgenic organism through sexual hybridization or asexual reproduction. In this invention, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations achieved through conventional plant breeding methods or naturally occurring events such as random allogeneic fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
[0093] In this invention, "heterogeneous" means that the first molecule is not typically found to combine with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Therefore, such a molecule is heterologous to the host and is artificially introduced into the host cell's genome.
[0094] A method for producing transgenic rapeseed event DBN7009 resistant to glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D, and benzoxazole herbicides, comprising the following steps: firstly, sexually crossing a first parent rapeseed plant with a second parent rapeseed plant to produce diverse first-generation offspring plants, wherein the first parent rapeseed plants consist of rapeseed plants bred from transgenic rapeseed event DBN7009 and its offspring, which are produced by utilizing the glyphosate, glufosinate-ammonium, 2,4-D, and benzoxazole herbicides of the present invention. The expression cassettes tolerant to glyphosate (or glufosinate), 2,4-D, and benzoxazole herbicides were transformed to produce rapeseed plants tolerant to glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole herbicides. The second parent rapeseed plant lacked tolerance to glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole herbicides. Then, progeny plants tolerant to glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole herbicides were selected to produce rapeseed plants tolerant to glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole herbicides. These steps may further include backcrossing progeny plants tolerant to glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole herbicides with a second or third parent rapeseed plant, and then selecting progeny by application of glyphosate, glufosinate (or glufosinate), 2,4-D, and / or benzoxazole herbicides or by identification using trait-related molecular markers (such as DNA molecules containing the 5' and 3' junction sites identified in the inserted sequence in transgenic rapeseed event DBN7009), thereby producing rapeseed plants tolerant to glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole herbicides.
[0095] It should also be understood that two different transgenic plants can mate to produce offspring containing two independent, segregated foreign genes. Self-pollination of appropriate offspring can yield plants that are homozygous for both added foreign genes. Backcrossing of parental plants and heteromorphic hybridization with non-transgenic plants, as mentioned above, are also to be expected, as is asexual reproduction.
[0096] The term "probe" refers to a segment of isolated nucleic acid molecule bound with a conventionally detectable marker or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme. This probe is complementary to one strand of the target nucleic acid. In this invention, the probe is complementary to one strand of the DNA from the genome of the transgenic rapeseed event DBN7009, regardless of whether the genomic DNA originates from the transgenic rapeseed event DBN7009, its seeds, or from plants, seeds, or extracts of the transgenic rapeseed event DBN7009. The probes of this invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.
[0097] The term "primer" refers to a segment of isolated nucleic acid molecule that binds to a complementary target DNA strand through nucleic acid hybridization and annealing, forming a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of this invention relate to their application in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.
[0098] The probes and primers are typically 11 polynucleotides or longer, preferably 18 polynucleotides or longer, more preferably 24 polynucleotides or longer, and most preferably 30 polynucleotides or longer. These probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that differ from the target DNA sequence and maintain hybridization ability to the target DNA sequence can be designed using conventional methods, preferably, the probes and primers of this invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.
[0099] Primers and probes for the flanking genomic DNA and insert sequences based on the present invention can be determined using conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from the transgenic rapeseed event DBN7009 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic insert sequence and the rapeseed genomic flanking sequence, and fragments of the DNA molecule can be used as primers or probes.
[0100] The nucleic acid probes and primers of this invention hybridize with target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic rapeseed event DBN7009 in a sample. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. As used in this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is said to be a "complement" of the other nucleic acid molecule. As used in this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringent" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringent" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.
[0101] As used in this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under moderately stringent conditions, such as about 2.0 × SSC and about 65°C. More preferably, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under highly stringent conditions. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any method well known to those skilled in the art, including but not limited to fluorescent labeling, radioactive labeling, antibody labeling and chemiluminescent labeling.
[0102] Regarding amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "strict conditions" refer to conditions in which primers are allowed to hybridize only with the target nucleic acid sequence during a DNA thermal amplification reaction. Primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.
[0103] The term "specific binding (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.
[0104] As used in this invention, "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether rapeseed plants are produced by sexual hybridization from the transgenic rapeseed event DBN7009 of this invention, or whether rapeseed samples collected from fields contain the transgenic rapeseed event DBN7009, or whether rapeseed extracts, such as rapeseed cake, flour, and oil, contain the transgenic rapeseed event DBN7009, DNA extracted from rapeseed plant tissue samples or extracts can be used to generate amplifiers that are diagnostic for the presence of DNA related to the transgenic rapeseed event DBN7009 by using a nucleic acid amplification method with primer pairs. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the insertion site of the inserted exogenous DNA, and a second primer derived from the inserted exogenous DNA. The amplifier has a specific length and sequence that is also diagnostic for the transgenic rapeseed event DBN7009. The length of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably about 50 nucleotide base pairs, more preferably about 250 nucleotide base pairs, and most preferably about 450 nucleotide base pairs or more.
[0105] Optionally, primer pairs can be derived from flanking genomic sequences on either side of the inserted DNA to produce an amplicon comprising the entire inserted nucleotide sequence. One of the primer pairs derived from plant genome sequences can be located at a distance from the inserted DNA sequence, ranging from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal amplification of DNA.
[0106] Nucleic acid amplification reactions can be performed using any nucleic acid amplification method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA and up to 42 kb of phage DNA. These methods, as well as other DNA amplification methods in the art, can be used in this invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic rapeseed event DBN7009 can be used to amplify the genome of the transgenic rapeseed event DBN7009 using the provided primer sequences, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.
[0107] DNA detection kits based on DNA amplification methods contain DNA molecules used as primers that specifically hybridize to target DNA and amplify diagnostic amplicones under appropriate reaction conditions. The kits provide agarose gel-based detection methods or many other methods known in the art for detecting diagnostic amplicones. Kits containing DNA primers homologous to or complementary to any portion of the rapeseed genome of SEQ ID NO:3 or SEQ ID NO:4, and homologous to or complementary to any portion of the transgenic insertion region of SEQ ID NO:5, are provided by this invention. Primer pairs particularly useful in DNA amplification methods are SEQ ID NO:8 and SEQ ID NO:9, which amplify diagnostic amplicones homologous to a portion of the 5' transgenic / genomic region of the transgenic rapeseed event DBN7009, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.
[0108] The amplicon generated by these methods can be detected using a variety of techniques. One such method is Genetic Bit Analysis, which involves designing a DNA oligonucleotide chain that spans the insert DNA sequence and adjacent flanking genomic DNA sequences. This oligonucleotide chain is immobilized within the wells of a microplate. After PCR amplification of the target region (using one primer each in the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product hybridizes with the immobilized oligonucleotide chain and serves as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next expected base. Results can be obtained using fluorescence or ELISA-like methods. The signal indicates the presence of the insert / flanking sequence, signifying successful amplification, hybridization, and single-base extension.
[0109] Another method is pyrosequencing. This method designs an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with single-stranded PCR products of the target region (using one primer each within the insertion sequence and in adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, thioacylase, luciferase, adenosine triphosphate diphosphatase, adenosine-5'-phosphate sulfate, and luciferin. dNTPs are added separately, and the resulting light signal is measured. The light signal represents the presence of the insertion / flanking sequence, indicating that amplification, hybridization, and single- or multi-base extension reactions were successful.
[0110] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) can also be used to detect the amplicon of this invention. This method requires designing an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with a single-stranded PCR product of the target region (using one primer within the insertion sequence and one primer in adjacent flanking genomic sequences), and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single-base extension results in the insertion of the ddNTP. This insertion can be measured using a fluorometer to determine the change in polarization. The change in polarization indicates the presence of the insertion / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.
[0111] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, detailed in the manufacturer's instructions for use. Briefly, a FRET oligonucleotide probe is designed to bind across the insert DNA sequence and adjacent flanking genomic regions. This FRET probe and PCR primers (one primer within the insert sequence and one primer in adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the splitting of the fluorescent and quenched portions of the probe, and the release of the fluorescent portion. The generation of a fluorescent signal indicates the presence of the insert / flanking sequence, signifying successful amplification and hybridization.
[0112] Based on the principle of hybridization, suitable techniques for detecting plant material derived from the DBN7009 transgenic rapeseed incident can also include Southern blot, Northern blot, and in situ hybridization. Specifically, these suitable techniques include incubating the probe and sample, washing to remove unbound probes, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by X-ray exposure and development, or enzyme-labeled probes can be detected by color changes achieved through substrate transformation.
[0113] Tyangi et al. (Nature Biotech. 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe was designed that spans the insertion DNA sequence and the adjacent flanking genomic region. The unique structure of this FRET probe results in a secondary structure that allows for the retention of fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence) were cyclically reacted in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe's secondary structure, causing spatial separation of the fluorescent and quenched portions and generating a fluorescent signal. The generation of the fluorescent signal indicates the presence of the insertion / flanking sequence, signifying successful amplification and hybridization.
[0114] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of this invention.
[0115] DNA detection kits can be developed using the compositions described in this invention and methods described or known in the field of DNA detection. These kits are advantageous for identifying the presence of DNA related to the transgenic rapeseed event DBN7009 in samples and can also be used to cultivate rapeseed plants containing DNA from the transgenic rapeseed event DBN7009. The kits may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes homologous to or complementary to DNA contained in transgenic genetic elements. These DNA sequences can be used for DNA amplification reactions or as probes in DNA hybridization methods. [The text then abruptly shifts to a seemingly unrelated topic:] ...contained in the rapeseed genome and in... Figure 1 The DNA structure at the site of binding between the transgenic insertion sequence and the rapeseed genome, as described in Table 1, comprises: a portion of the insertion sequence from the right boundary region (RB) of Agrobacterium tumefaciens located at the 5' end of the transgenic insertion sequence in the flanking genome region of rapeseed DBN7009; the first expression cassette consists of a Ubi promoter (prBnUbi) from rapeseed, operably linked to the benzoxazine-resistant hydroxyphenylpyruvate dioxygenase gene (cHTG) of oats, and operably linked to the transcription terminator (tAtH4) of Arabidopsis thaliana; the second expression cassette consists of a Ubi promoter (prAtUbi10) from Arabidopsis thaliana, operably linked to the α-ketoglutarate-dependent dioxygenase gene (c24DT21) of acidophilus, and operably linked to the transcription terminator (tNos) of the cauliflower mosaic virus promoter; and the third expression cassette consists of a Ubi promoter (prAtUbi10) from Arabidopsis thaliana, operably linked to the α-ketoglutarate-dependent dioxygenase gene (c24DT21) of acidophilus, and operably linked to the transcription terminator (tNos) of the cauliflower base synthase gene; and the third expression cassette consists of a cauliflower mosaic virus promoter. (pr35S) is operatively linked to the phosphonophosphorus N-acetyltransferase gene (cPAT) of Streptomyces for glyphosate (or glufosinate) tolerance and operatively linked to the transcription terminator (t35S) of cauliflower mosaic virus; the fourth expression cassette consists of a cell elongation factor promoter (prGm17gTsf1) from soybean, operatively linked to the coding sequence of the Arabidopsis EPSPS chloroplast transport peptide (spAtCTP2), operatively linked to the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase gene (EPSPS) of Agrobacterium CP4 strain, and operatively linked to the transcription terminator (tPsE9) of pea, a portion of the insertion sequence from the left border region (LB) of Agrobacterium, and the flanking genomic region of rapeseed DBN7009 located at the 3' end of the transgenic insertion sequence (SEQ ID NO:5). In the DNA amplification method, the DNA molecule used as a primer can be any part of the transgenic insertion sequence from the transgenic rapeseed event DBN7009, or any part of the flanking DNA sequence of the rapeseed genome from the transgenic rapeseed event DBN7009.
[0116] The transgenic rapeseed event DBN7009 can be combined with other transgenic rapeseed varieties, such as herbicide-tolerant transgenic rapeseed varieties (e.g., dicamba). Various combinations of all these different transgenic events, bred together with the transgenic rapeseed event DBN7009 of this invention, can provide improved hybrid transgenic rapeseed varieties resistant to multiple herbicides. These varieties can exhibit superior characteristics compared to non-transgenic varieties and single-trait transgenic varieties.
[0117] The term "superposition" refers to combining at least two transgenic events possessing the desired trait into the same plant. Superposition of transgenic events is achieved by crossing parents with transgenic events possessing the desired trait and then identifying offspring possessing all of those desired traits. Superposition of transgenic events can be used to combine two or more different traits, including, for example, two or more different insect resistance traits, two or more herbicide resistance traits, and / or insect resistance and herbicide resistance traits.
[0118] This invention relates to the transgenic rapeseed species DBN7009, which exhibits tolerance to the phytotoxicity of agricultural herbicides containing glyphosate, glufosinate (or glufosinate), 2,4-D, or benzoxazine. This quadruple-trait rapeseed plant expresses a benzoxazine-resistant hydroxyphenylpyruvate dioxygenase (HTG) protein, conferring tolerance to benzoxazine; expresses a 2,4-D-resistant α-ketoglutarate-dependent dioxygenase (24DT21) protein from *Streptomyces*, conferring tolerance to 2,4-D; expresses a *Streptomyces*-resistant glufosinate (or glufosinate)-resistant phosphatidylin N-acetyltransferase (PAT) protein, conferring tolerance to glufosinate (or glufosinate); and expresses an *Agrobacterium* CP4 strain 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) protein, conferring tolerance to glyphosate. The seeds of the corresponding genetically modified rapeseed event DBN7009 were deposited on November 25, 2025, under the Budapest Treaty, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China). The classification is *Brassica napus*, the preservation status is viable, and the accession number is CGMCC No. 46697. The deposit will be held at the collection for 30 years.
[0119] The four-phenomenal rapeseed has the following advantages: 1) It enables the application of agricultural herbicides containing glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole for broad-spectrum weed control; 2) It breaks the long-standing reliance on single-mechanism herbicide systems for rapeseed, ensuring stable and high yields in the long term and promoting the development of a more sustainable and efficient rapeseed production system; 3) Rapeseed yield is not reduced. Furthermore, the transgenes encoding glyphosate, glufosinate (or glufosinate), 2,4-D, and benzoxazole tolerance traits are linked to the same DNA segment and exist at a single locus in the transgenic rapeseed event DBN7009 genome. This provides enhanced breeding efficiency and allows for the use of molecular markers to track transgenic insertions in breeding populations and their offspring. Meanwhile, in the detection method of the present invention, SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence can be used as DNA primers or probes to generate amplification products that are diagnosed as transgenic rapeseed event DBN7009 or its progeny, and can quickly, accurately and stably identify the presence of plant materials derived from transgenic rapeseed event DBN7009.
[0120] Sequence Summary
[0121] In SEQ ID NO:1, the transgenic rapeseed event DBN7009 contains a 22-nucleotide sequence at the 5' end of the insertion sequence near the insertion junction, wherein nucleotides 1-11 and 12-22 are located on either side of the insertion site on the rapeseed genome.
[0122] In the transgenic rapeseed event DBN7009, SEQ ID NO:2, there is a 22-nucleotide sequence at the 3' end of the insertion sequence near the insertion junction, wherein nucleotides 1-11 and 12-22 are located on both sides of the insertion site on the rapeseed genome.
[0123] In the transgenic rapeseed event DBN7009, there is a 1162-nucleotide sequence at the 5' end of the inserted sequence near the insertion junction.
[0124] In the transgenic rapeseed event DBN7009, there is a 1735-nucleotide sequence at the 3' end of the inserted sequence near the insertion junction.
[0125] SEQ ID NO:5 The entire T-DNA sequence and the flanking sequences of the rapeseed genome at the 5' and 3' ends;
[0126] SEQ ID NO:6 spans the DBN14011 construct DNA sequence and the tPsE9 transcription termination sequence;
[0127] SEQ ID NO:7 spans the tAtH4 transcription termination sequence and the DBN14011 construct DNA sequence;
[0128] SEQ ID NO:8 amplifies the first primer (primer 1) of SEQ ID NO:3;
[0129] SEQ ID NO:9 amplifies the second primer (primer 2) of SEQ ID NO:3;
[0130] SEQ ID NO:10 amplifies the first primer (primer 3) of SEQ ID NO:4;
[0131] SEQ ID NO:11 amplifies the second primer (primer 4) of SEQ ID NO:4;
[0132] Primer 5 on the 5' flanking genome sequence of SEQ ID NO:12;
[0133] Primer 6 located on T-DNA that pairs with SEQ ID NO:13 and SEQ ID NO:12; Primer 7 located on the 3' flanking genomic sequence of SEQ ID NO:14, which, when paired with SEQ ID NO:12, can detect whether the transgene is homozygous or heterozygous.
[0134] Primer 8 located on T-DNA, paired with SEQ ID NO:15 and SEQ ID NO:14;
[0135] SEQ ID NO:16 The first primer for Taqman detection of the cEPSPS gene;
[0136] SEQ ID NO:17 The second primer for Taqman detection of the cEPSPS gene;
[0137] SEQ ID NO:18 Taqman probe for detecting the cEPSPS gene;
[0138] SEQ ID NO:19 The first primer for Taqman detection of the cPAT gene;
[0139] SEQ ID NO:20 The second primer for Taqman detection of the cPAT gene;
[0140] SEQ ID NO:21 Taqman probe for detecting the cPAT gene;
[0141] SEQ ID NO:22 The first primer for Taqman detection of the c24DT21 gene;
[0142] SEQ ID NO:23 The second primer for Taqman detection of the c24DT21 gene;
[0143] SEQ ID NO:24 Taqman probe for detecting the c24DT21 gene;
[0144] SEQ ID NO:25 First primer for Taqman detection of the cHTG gene
[0145] SEQ ID NO:26 Taqman second primer for detecting the cHTG gene
[0146] SEQ ID NO:27 Taqman probe for detecting the cHTG gene
[0147] SEQ ID NO:28 First primer (primer 9) for the rapeseed endogenous gene Accg8;
[0148] SEQ ID NO:29 The second primer (primer 10) for the rapeseed endogenous gene Accg8;
[0149] SEQ ID NO:30 Probe for Southern hybridization detection of the cEPSPS gene;
[0150] SEQ ID NO:31 Probe for detecting the cPAT gene in Southern hybridization;
[0151] SEQ ID NO:32 Probe for detecting the c24DT21 gene in Southern hybridization;
[0152] SEQ ID NO:33 Probe for detecting the cHTG gene in Southern hybridization;
[0153] The primer in SEQ ID NO:34 located on the T-DNA is aligned with the direction of SEQ ID NO:13;
[0154] The primer in SEQ ID NO:35 located on the T-DNA is in the opposite direction to that in SEQ ID NO:13;
[0155] The primer in SEQ ID NO:36 located on the T-DNA is in the opposite direction to that in SEQ ID NO:13;
[0156] The primer located on the T-DNA in SEQ ID NO:37 is aligned with the orientation of SEQ ID NO:15;
[0157] The primer in SEQ ID NO:38 located on the T-DNA is in the opposite direction to that in SEQ ID NO:15;
[0158] The primer in SEQ ID NO:39 located on the T-DNA is in the opposite direction to that in SEQ ID NO:15;
[0159] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0160] Figure 1 This is a schematic diagram of the junction between the transgenic insertion sequence and the rapeseed genome in the present invention, which is used to detect the nucleic acid sequence of herbicide-tolerant rapeseed plant DBN7009 and its detection method.
[0161] Figure 2 This is a schematic diagram of the recombinant expression vector pDBN14011 used in this invention for detecting the nucleic acid sequence of herbicide-tolerant rapeseed plant DBN7009 and its detection method. Detailed Implementation
[0162] The technical solution of the present invention for detecting the nucleic acid sequence of rapeseed plant DBN7009 and its detection method is further illustrated below through specific embodiments.
[0163] First Implementation Example: Cloning and Transformation
[0164] 1.1 Vector Cloning
[0165] The recombinant expression vector pDBN14011 was constructed using standard gene cloning techniques. Figure 2(As shown). The vector pDBN14011 contains four tandem transgenic expression cassettes. The first expression cassette consists of a Ubi promoter (prBnUbi) from rapeseed, operably linked to the benzoxazine-resistant hydroxyphenylpyruvate dioxygenase gene (cHTG) from oats, and operably linked to the transcription terminator (tAtH4) from Arabidopsis thaliana. The second expression cassette consists of a Ubi promoter (prAtUbi10) from Arabidopsis thaliana, operably linked to the α-ketoglutarate-dependent dioxygenase gene (c24DT21) from acidophilus, and operably linked to the transcription terminator (tNos) of the cauliflower mosaic virus promoter. The third expression cassette consists of a Ubi promoter (prAtUbi10) from Arabidopsis thaliana, operably linked to the α-ketoglutarate-dependent dioxygenase gene (c24DT21) from acidophilus, and operably linked to the transcription terminator (tNos) of the cauliflower base synthase gene. The first expression cassette consists of (pr35S), which is operatively linked to the streptomyces glufosinate (or glufosinate)-resistant phosphatidylcholine N-acetyltransferase gene (cPAT) and operatively linked to the cauliflower mosaic virus transcription terminator (t35S); the second expression cassette consists of the soybean cell elongation factor promoter (prGm17gTsf1), which is operatively linked to the Arabidopsis EPSPS chloroplast transport peptide coding sequence (spAtCTP2), operatively linked to the glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase gene (EPSPS) of Agrobacterium CP4 strain, and operatively linked to the pea transcription terminator (tPsE9).
[0166] The vector pDBN14011 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using 4-[hydroxy(methyl)phosphono]-DL-homoalanine as a selectable marker.
[0167] 1.2 Plant Transformation
[0168] Transformation was performed using the conventional Agrobacterium infection method. Aseptically cultured rapeseed hypocotyl tissue was co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA from the constructed recombinant expression vector pDBN14011 into the rapeseed chromosome to generate transgenic rapeseed event DBN7009.
[0169] For Agrobacterium-mediated transformation of rapeseed, briefly, sterile rapeseed seeds were germinated on germination medium (1 / 2 MS 2.1g, sucrose 20g, pH adjusted to 5.6, volume brought to 1L, and Agar 8g). After inoculation, the seeds were cultured at 25℃ for 5-7 days under a photoperiod of 16 / 8h. Hypocotyls of 6-day-old germinating seedlings were explanted using sterile forceps and a scalpel, each 0.8-1.0cm in length, cutting vertically in one stroke. The explants were then placed in a dish containing a prepared Agrobacterium suspension for 15 minutes, ensuring full contact between the Agrobacterium suspension and the hypocotyl (Step 1: Infection Step). In this step, the hypocotyl tissue was preferably immersed in the Agrobacterium suspension (OD). 660=0.4-0.6, initiate infection in infection medium (1 / 2 MS 2.1g, sucrose 30g, pH adjusted to 5.4, AS 40mg, volume made up to 1L). After infection, blot the explants dry with sterile filter paper and place them on co-culture medium, with one filter paper placed in each medium. Each plate contains 40-60 explants and is incubated in a 22℃ dark incubator for 2-5 days (step 2: co-culture step). Preferably, after the infection step, the hypocotyl tissue is cultured on solid medium (1 / 2 MS 2.1g, sucrose 30g, pH adjusted to 5.3, Agar 15g, AS 40mg, volume made up to 1L). After co-culture, the hypocotyls are transferred to callus induction medium. In the callus induction step, the callus induction medium (MS 4.3g, sucrose 30g, MS vitamin 10ml, 2,4-D (1mg / L) 5mL, BAP (1mg / L) 0.03mL, pH adjusted to 5.8, Agar 8g, volume brought to 1L) contains at least one known antibiotic (cephalosporin) that inhibits the growth of Agrobacterium, without the addition of a selection agent for plant transformants (Step 3: Callus Induction Step). Preferably, the tissue regenerated from the hypocotyl is cultured on a fixed medium containing antibiotics but without a selection agent to eliminate Agrobacterium and provide a recovery period for infected cells, and is cultured for 7-21 days at 24°C with a photoperiod of 16 / 8h. After callus induction, the tissue blocks are transferred to a solid medium containing a selection agent (glyphosate) and cultured for 30 days at 24°C with a photoperiod of 16 / 8h, allowing the transformed cells to grow selectively (Step 4: Callus Screening and Differentiation Step 1). Preferably, the hypocotyl regenerated tissue blocks are cultured on a solid medium containing a selector (MS 4.3g, sucrose 30g, MS vitamin 10ml, BAP (1mg / L) 1mL, pH adjusted to 5.8, Agar 8g, glyphosate (100mM / L) 1mL, volume adjusted to 1L), allowing the transformed callus to continue growing. Then, callus blocks from differentiation culture 1 are transferred to a solid medium containing glyphosate and cultured for 30 days at 24℃ with a photoperiod of 16 / 8h. The transformed cells selectively grow to regenerate rapeseed plants (step 5: callus screening and differentiation step 2). Preferably, the callus regeneration tissue blocks are cultured on a solid medium containing a selective agent (MS 4.3g, sucrose 30g, MS vitamin 10ml, BAP (1mg / L) 1mL, pH adjusted to 5.8, Agar 8g, glyphosate (100mM / L) 1mL, adjusted to volume, trans-Zeatin (1mg / L) 1mL, IAA (1mg / L) 0.1mL, glyphosate (100mM / L) 1mL, adjusted to volume to 1L), which allows the transformed callus tissue to continue to grow and differentiate into regenerated rapeseed plants.Finally, after the regenerated plants were differentiated, the regenerated plants with good morphology and no vitrification were selected and transferred to rooting medium (MS 4.3g, sucrose 30g, pH adjusted to 5.8, Agar 8g, TMT (100mg / L) 2mL, volume adjusted to 1L). They were cultured at 24℃ under a photoperiod of 16 / 8h for 3-4 weeks until rooting and the plant height was above 3cm. The transgenic plants that met the requirements were selected and transplanted to the greenhouse for cultivation until fruiting.
[0170] 1.3 Identification and Screening of Genetically Modified Organisms
[0171] The vector pDBN14011 produced a total of 387 independent transgenic T0 plants. In order to screen for the best-performing transgenic events, the above 387 independent transgenic T0 plants were transplanted into a greenhouse for cultivation and propagation to obtain transgenic T1 plants.
[0172] via TaqMan TM Analysis (see Example 2) was performed to detect the presence of the cEPSPS, c24DT21, cHTG, and cPAT genes in the regenerated transgenic rapeseed plants, and the copy number of the four target genes was characterized. Through screening, rapeseed event DBN7009 was selected as superior because it possesses a single-copy transgenic structure and exhibits good tolerance to the four target herbicides (see Examples 6 and 7).
[0173] Second embodiment, using TaqMan TM DBN7009 test conducted on genetically modified rapeseed.
[0174] Approximately 100 mg of leaves from the DBN7009 transgenic rapeseed species was taken as a sample. Genomic DNA was extracted using a plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen) and analyzed via TaqMan. T The copy numbers of cEPSPS, c24DT21, cHTG, and cPAT genes were detected using M-probe quantitative real-time PCR. Wild-type rapeseed plants were used as a control, and the same method was applied for detection and analysis. The experiment was performed in triplicate, and the average value was used.
[0175] The specific method is as follows:
[0176] Step 6: Take 100 mg of leaves from the transgenic rapeseed event DBN7009, grind them into a homogenate in a mortar with liquid nitrogen, and take 3 replicates for each sample;
[0177] Step 7: Extract genomic DNA from the above samples using the Plant DNA Extraction Kit (DNeasy Plant Maxi Kit, Qiagen). Refer to the product instructions for specific methods.
[0178] Step 8: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);
[0179] Step 9: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;
[0180] Step 10: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type rapeseed plants were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:
[0181] The following primers and probes are used to detect the cEPSPS gene sequence:
[0182] Primer _cEPSPS-1: TTGGTGCTAACCTTACCGTTGAG is shown in SEQ ID NO:16 in the sequence listing;
[0183] Primer _cEPSPS_2: GCTTACCACGACCTTCAAGAC is shown in SEQ ID NO:17 in the sequence listing;
[0184] Probe_cEPSPS: CTGATGCTGACGGTGTGCGTACCATC is shown in SEQ ID NO:18 in the sequence listing;
[0185] The following primers and probes are used to detect the cPAT gene sequence:
[0186] Primer _cPAT-1: CAGTTGAGATTAGGCCAGCTACAG is shown in SEQ ID NO:19 in the sequence listing;
[0187] Primer cPAT-2: TTCACTGTAGACGTCTCAATGTAATGG is shown in SEQ ID NO:20 in the sequence listing;
[0188] Probe_cPAT: CAGCTGATATGGCCGCGGTTTGTG is shown in SEQ ID NO:21 in the sequence listing;
[0189] The following primers and probes are used to detect the c24DT21 gene sequence:
[0190] Primer_c24DT21-1:TGTCGGCAAAGCAGGTTCT is shown as SEQ ID NO:22 in the sequence listing;
[0191] Primer _c24DT21-2: CAAGGCGCGGTGTTCTCT is shown as SEQ ID NO:23 in the sequence listing;
[0192] Probe_c24DT21: CCTCCGACAGCTGGAACCACCTCTG is shown as SEQ ID NO:24 in the sequence listing;
[0193] The following primers and probes are used to detect the cHTG gene sequence:
[0194] Primer _cHTG-1: CTGGTACTCTTGCCCAACTTCAT is shown in SEQ ID NO:25 in the sequence listing;
[0195] Primer _cHTG-2: TGGTGATCGTCCCACTTTTTG is shown in SEQ ID NO:26 in the sequence listing;
[0196] The probe cHTG: CTTCTCCATGCATCCTATTCGCTGAATCA is shown in SEQ ID NO:27 in the sequence listing;
[0197] The PCR reaction system is as follows:
[0198]
[0199] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and is stored in amber tubes at 4°C.
[0200] The PCR reaction conditions are as follows:
[0201]
[0202] Data analysis using the Fast Real-Time PCR System software (Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3, Applied Biosystems) showed that the obtained transgenic rapeseed event DBN7009 was a single copy.
[0203] Third embodiment: Analysis of the insertion site of DBN7009 in transgenic rapeseed.
[0204] 3.1 Genomic DNA Extraction
[0205] DNA extraction was performed using the conventional CTAB (hexadecyltrimethylammonium bromide) method: 2 grams of young, tender leaves from the transgenic rapeseed event DBN7009 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB Buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM...) preheated at 65°C was added. EDTA (ethylenediaminetetraacetic acid), pH adjusted to 8.0 with NaOH, was thoroughly mixed and extracted at 65℃ for 90 min. 0.5 volumes of phenol and chloroform were added, and the mixture was inverted and mixed. The mixture was centrifuged at 12000 rpm for 10 min. The supernatant was collected, and 2 volumes of anhydrous ethanol were added. The centrifuge tube was gently shaken and incubated at 4℃ for 30 min. The mixture was then centrifuged again at 12000 rpm for 10 min. The DNA was collected at the bottom of the tube. The supernatant was discarded, and the precipitate was washed with 1 mL of 70% ethanol. The mixture was centrifuged at 12000 rpm for 5 min. The precipitate was vacuum dried or air-dried in a clean bench. The DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20℃.
[0206] 3.2 Analysis of flanking DNA sequences
[0207] The concentration of the extracted DNA samples was determined to be between 80-100 ng / μL. Genomic DNA was digested with the selected restriction endonucleases NcoI (5' end analysis) and NcoI (3' end analysis), respectively. 26.5 μL of genomic DNA, 0.5 μL of the selected restriction endonuclease, and 3 μL of digestion buffer were added to each digestion system, and digestion was carried out for 1 hour. After digestion, 70 μL of anhydrous ethanol was added to the digestion system, the mixture was incubated on ice for 30 min, centrifuged at 12000 rpm for 7 min, the supernatant was discarded, and the mixture was dried. Then, 8.5 μL of double-distilled water (dd H2O), 1 μL of 10×T4 buffer, and 0.5 μL of T4 ligase were added, and ligation was carried out overnight at 4°C. PCR amplification was performed using a series of nested primers to separate the 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for isolating 5' transgenic / genomic DNA includes SEQ ID NO:13 and SEQ ID NO:34 as the first primer, SEQ ID NO:35 and SEQ ID NO:36 as the second primer, and SEQ ID NO:13 as the sequencing primer. The primer combination for isolating 3' transgenic / genomic DNA includes SEQ ID NO:15 and SEQ ID NO:37 as the first primer, SEQ ID NO:38 and SEQ ID NO:39 as the second primer, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.
[0208] The obtained amplicon was electrophoresed on a 2.0% agarose gel to separate the PCR reaction products, and the target fragment was then isolated from the agarose matrix using the QIAquickGel Extraction Kit (catalog #28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR Sequencing Software, DNASTARInc., Madison, WI).
[0209] The 5' and 3' flanking and junction sequences were confirmed using standard PCR methods. The 5' flanking and junction sequences can be confirmed using SEQ ID NO:8 or SEQ ID NO:12, in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using SEQ ID NO:11 or SEQ ID NO:14, in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 2 and 3. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking and junction sequences.
[0210] DNA sequencing of PCR products provides DNA that can be used to design other DNA molecules, which can be used as primers and probes for the identification of rapeseed plants or seeds derived from the transgenic rapeseed event DBN7009.
[0211] Nucleotide positions 1-476 of SEQ ID NO:5 show the right flanking (5' flanking sequence) of the rapeseed genome sequence in the DBN7009 transgenic rapeseed insertion sequence, and nucleotide positions 12319-13375 of SEQ ID NO:5 show the left flanking (3' flanking sequence) of the rapeseed genome sequence in the DBN7009 transgenic rapeseed insertion sequence. The 5' conjugation sequence is listed in SEQ ID NO:1, and the 3' conjugation sequence is listed in SEQ ID NO:2.
[0212] 3.3 PCR Conjugation Assay
[0213] The conjugate sequences are relatively short polynucleotide molecules that are novel DNA sequences that are diagnostic for the DNA of the transgenic rapeseed event DBN7009 when detected in polynucleotide assays. The conjugate sequences in SEQ ID NO:1 and SEQ ID NO:2 are 11 polynucleotides on each side of the rapeseed genomic DNA, representing the insertion site of the transgenic fragment in the transgenic rapeseed event DBN7009. Longer or shorter polynucleotide conjugate sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The conjugate sequences (5' linker region SEQ ID NO:1 and 3' linker region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The conjugate sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences in the transgenic rapeseed event DBN7009 and can also be used as DNA probes or as DNA primer molecules to detect the presence of the DNA of the transgenic rapeseed event DBN7009. SEQ ID NO:6 (nucleotides 491-1115 of SEQ ID NO:3) spans the tPsE9 transcription termination sequence and the pDBN14011 construct DNA sequence, and SEQ ID NO:7 (nucleotides 33-682 of SEQ ID NO:4) spans the pDBN14011 construct DNA sequence and the tAtH4 transcription termination sequence.
[0214] In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4, which, when used in a PCR method, produces a diagnostic amplicon for the transgenic rapeseed event DBN7009.
[0215] Specifically, a PCR product was generated from the 5' end of the transgenic insert sequence. This PCR product contained a portion of genomic DNA flanking the 5' end of the T-DNA insert sequence from the genome of plant material derived from the transgenic rapeseed event DBN7009. This PCR product contains SEQ ID NO:3. For PCR amplification, primer 1 (SEQ ID NO:8) was designed to hybridize with the genomic DNA sequence flanking the 5' end of the transgenic insert sequence, and primer 2 (SEQ ID NO:9) was designed to pair with it, located at the transcription termination sequence of the transgenic tPsE9.
[0216] A PCR product was generated from the 3' end of the transgenic insertion sequence. This PCR product comprised a portion of genomic DNA flanking the 3' end of the T-DNA insertion sequence from the genome of plant material derived from the transgenic rapeseed event DBN7009. This PCR product contained SEQ ID NO:4. For PCR amplification, primer 3 (SEQ ID NO:10) located at the transgenic tAtH4 transcription termination sequence was designed, along with primer 4 (SEQ ID NO:11) paired with it to hybridize with the genomic DNA sequence flanking the 3' end of the transgenic insertion sequence.
[0217] The DNA amplification conditions described in Tables 2 and 3 can be used for the above-described PCR conjugation assays to generate diagnostic amplicones for the transgenic rapeseed event DBN7009. Detection of the amplicones can be performed using a Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler as shown in Table 3, or by methods and equipment known to those skilled in the art.
[0218] Table 2. PCR steps and reaction mixture conditions for identifying the 5' transgenic insert / genome conjugation region of transgenic rapeseed event DBN7009.
[0219]
[0220]
[0221] Table 3. Conditions for the Perkin-Elmer 9700 Thermal Cyclist
[0222]
[0223] Mix gently, and if the thermal cycler does not have an insulation cap, add 1-2 drops of mineral oil above each reaction mixture. Perform PCR using the following cycling parameters (Table 3) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, set the ramp speed to its maximum value.
[0224] Experimental results showed that primers 1 and 2 (SEQ ID NO: 8 and 9) produced an amplification product of 1162 bp fragment when used in the PCR reaction of transgenic rapeseed event DBN7009 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed rapeseed genomic DNA and rapeseed genomic DNA without event DBN7009; primer pairs 3 and 4 (SEQ ID NO: 10 and 11) produced an amplification product of 1735 bp fragment when used in the PCR reaction of transgenic rapeseed event DBN7009 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed rapeseed genomic DNA and rapeseed genomic DNA without event DBN7009.
[0225] PCR conjugation assays can also be used to identify whether materials derived from the transgenic rapeseed event DBN7009 are homozygous or heterozygous. Primers 5 (SEQ ID NO:12), 6 (SEQ ID NO:13), 7 (SEQ ID NO:14), and 8 (SEQ ID NO:15) were used in the amplification reaction to generate diagnostic amplicones for the transgenic rapeseed event DBN7009. The DNA amplification conditions described in Tables 4 and 5 can be used for the above conjugation assays to generate diagnostic amplicones for the transgenic rapeseed event DBN7009.
[0226] Table 4. Reaction solution for bonding test
[0227]
[0228] Table 5. Conditions for bonding determination using the Perkin-Elmer 9700 thermal cycler.
[0229]
[0230] Perform PCR on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the following cycling parameters (Table 5). The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, the ramp speed should be set to its maximum value.
[0231] In the amplification reaction, the biological sample containing template DNA contains DNA that diagnoses the presence of the transgenic rapeseed event DBN7009 in the sample. Alternatively, the reaction will generate two distinct DNA amplicones from a biological sample containing DNA derived from the rapeseed genome, wherein the rapeseed genome DNA is heterozygous relative to the allele corresponding to the inserted DNA present in the transgenic rapeseed event DBN7009. These two distinct amplicones will correspond to a first amplicon (SEQ ID NO:12 and SEQ ID NO:13) derived from a wild-type rapeseed genome locus and a second amplicon (SEQ ID NO:14 and SEQ ID NO:12) diagnosing the presence of the transgenic rapeseed event DBN7009 DNA. A rapeseed DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can diagnose the presence of the transgenic rapeseed event DBN7009 in the sample, and this sample is produced from rapeseed seeds that are homozygous relative to the allele corresponding to the inserted DNA present in the transgenic rapeseed plant DBN7009.
[0232] It should be noted that the primer pairs for the transgenic rapeseed event DBN7009 were used to generate diagnostic amplicones for the genomic DNA of transgenic rapeseed event DBN7009. These primer pairs include, but are not limited to, primers 1 and 2 (SEQ ID NO: 8 and 9), and primer pairs 3 and 4 (SEQ ID NO: 10 and 11), used in the DNA amplification method described above. Additionally, a control primer pair 9 and 10 (SEQ ID NO: 28 and 29) for amplifying endogenous rapeseed genes is included as an intrinsic standard for the reaction conditions. Analysis of DNA extracts from transgenic rapeseed event DBN7009 should include a positive tissue DNA extract control from transgenic rapeseed event DBN7009, a negative DNA extract control derived from non-transgenic rapeseed event DBN7009, and a negative control without template soybean DNA. In addition to these primer pairs, any primer pairs from SEQ ID NO:3 or SEQ ID NO:4, or their complementary sequences, can be used to generate, when used in a DNA amplification reaction, amplicon containing SEQ ID NO:1 or SEQ ID NO:2 that is diagnostic for tissues derived from the transgenic rapeseed plant DBN7009. The DNA amplification conditions described in Tables 2-5 can be used to generate diagnostic amplicones for the transgenic rapeseed event DBN7009 using appropriate primer pairs. Extracts of rapeseed plant or seed DNA presumed to contain the transgenic rapeseed event DBN7009, or products derived from the transgenic rapeseed event DBN7009, that produce diagnostic amplicones for the transgenic rapeseed event DBN7009 during testing in DNA amplification methods, can be used as templates for amplification to determine the presence of the transgenic rapeseed event DBN7009.
[0233] Fourth embodiment: Detection of transgenic rapeseed event DBN7009 using Southern blot hybridization.
[0234] 4.1 DNA Extraction for Southern Blot Hybridization
[0235] Using a mortar and pestle, grind approximately 5-10g of plant tissue in liquid nitrogen. Resuspend approximately 4-5g of the ground plant tissue in 20mL of CTAB lysis buffer (100mM Tris-HCl pH 8.0, 20mM EDTA pH 8.0, 1.4M NaCl, 0.2% v / v β-mercaptoethanol, 2% w / v CTAB) and incubate at 65°C for 60min. During incubation, invert the sample every 10min to mix. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1) and extract repeatedly for 20min. Centrifuge at 4000g for 20min, transfer the aqueous phase to a new tube, add an equal volume of chloroform / isoamyl alcohol (24:1) and repeat the extraction once more. After aspirating the aqueous phase again, add an equal volume of isopropanol, mix well, and incubate at -20°C for 1 hour to precipitate DNA. The DNA precipitate was obtained by centrifugation at 4000g for 5 min, and then dissolved in 1 mL TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0). To degrade any present RNA, the DNA and 40 μL of 10 mg / mL RNase A were incubated at 37°C for 30 min. Then, 0.1 volume of 3M sodium acetate (pH 5.2) and 2 volumes of anhydrous ethanol were added, and the mixture was incubated at -20°C for 1 hour to precipitate the DNA. The precipitate was collected by centrifugation at 12000g for 10 min. After discarding the supernatant, the precipitate was washed with 1 mL of 70% ethanol, dried at room temperature, and then redissolved in 1 mL TE buffer.
[0236] 4.2 Restriction enzyme digestion
[0237] The concentration of genomic DNA in the above samples was determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific).
[0238] In a 100 μL reaction system, 5 μg of genomic DNA was digested with restriction endonucleases EcoR V, Hind III, MSc I, and Nhe I, respectively. For each enzyme, the digest was incubated overnight at an appropriate temperature. After digestion, the sample was rotary evaporated using an Eppendorf Concentrator Plus to reduce the volume to 20 μL.
[0239] 4.3 Gel electrophoresis
[0240] Bromophenol blue loading dye was added to each sample derived from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide. The gel was separated by electrophoresis in TAE buffer (40 mM Tris-acetic acid, 1 mM EDTA, pH 8.0) and the gel was incubated overnight at 20 volts.
[0241] After electrophoresis, the gel was treated with 0.25M hydrochloric acid for 10 min to remove purines, and then treated with denaturing solution (1.5M NaCl, 0.5M NaOH) and neutralizing solution (1.5M NaCl, 0.5M Tris-HCl, pH 7.2) for 30 min each. 20X SSC (3M NaCl, 0.3M sodium citrate, pH 7.0) was poured into a porcelain dish, a glass plate was placed on top, and then a moistened filter paper bridge, gel, positively charged nylon membrane (Roche, Cat. No. 11417240001), three layers of filter paper, a paper tower, and a weight were placed in sequence. After overnight transfer at room temperature, the nylon membrane was rinsed twice in deionized water, and DNA was immobilized on the membrane using a UV crosslinker (UVP, UV Crosslinker CL-1000).
[0242] 4.4 Hybridization
[0243] Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probes were SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33, or partially homologous to or complementary to the sequences described above. DIG labeling, Southern hybridization, membrane washing, and hybridization signal detection of the probes were performed using the DNA Labeling and Detection Starter Kit II (Roche, Cat. No. 11585614910), following the instructions in the product manual. Finally, the hybridization signal was acquired using X-ray film (Roche, Cat. No. 11666916001).
[0244] Each Southern sample includes two control samples: (1) DNA from negative (untransformed) isolates, used to identify any rapeseed endogenous sequence that can hybridize with the element-specific probe; and (2) a Hind III-digested pDBN14011 plasmid with a probe length equivalent to one copy number, which serves as a positive control for hybridization and to illustrate the sensitivity of the experiment.
[0245] Hybridization data provide conclusive evidence supporting TaqMan. TMPCR analysis revealed that the rapeseed event DBN7009 contained single copies of the cEPSPS, c24DT21, cPAT, and cHTG genes. Using the cEPSPS probe, digestion with EcoR V and Hind III yielded single hybridization bands of approximately 4.5 kb and 8.0 kb, respectively; using the cPAT probe, digestion with MSc I and Hind III yielded single hybridization bands of approximately 9.4 kb and 8.0 kb, respectively; using the c24DT21 probe, digestion with MSc I and EcoR V yielded single hybridization bands of approximately 9.4 kb and 7.2 kb, respectively; and using the cHTG probe, digestion with Nhe I and EcoR V yielded single hybridization bands of approximately 7.5 kb and 7.2 kb, respectively. This indicates that one copy of each of the cEPSPS, c24DT21, cPAT, and cHTG genes exists in the rapeseed event DBN7009. In addition, no hybridization bands were obtained for the backbone probe, indicating that no pDBN14011 vector backbone sequence entered the rapeseed event DBN7009 during the transformation process.
[0246] Fifth Example: Detection of protein expression levels in transgenic rapeseed event DBN7009 using ELISA.
[0247] The expression levels of EPSPS, PAT, 24DT21, and HTG proteins in the transgenic rapeseed event DBN7009 were detected by ELISA.
[0248] Fresh leaves of the genetically modified rapeseed DBN7009 were freeze-dried, and 20 mg were weighed and ground in liquid nitrogen. Then, 1 mL of extraction buffer (8 g / L NaCl, 0.27 g / L KH2PO4, 1.42 g / L Na2HPO4, 0.2 g / L KCl, 5.5 mL / L Tween-20, pH 7.4) was added, mixed, and allowed to stand at 4°C for 30 minutes. After centrifugation at 12000 g for 10 minutes, the supernatant was taken and diluted with the above extraction buffer to an appropriate multiple. 80 μl of the diluted supernatant was used for ELISA detection.
[0249] ELISA (Enzyme-Linked Immunosorbent Assay) kits were used to detect the proportions of proteins (EPSPS, PAT, 24DT21, and HTG) in the leaf dry weight of the samples. The kits included EPSPS kit (Envirologix, AP010), PAT kit (Envirologix, AP014), 24DT21 kit (Youlong Biotech, AA3141), and HTG kit (Youlong Biotech, AA3241). Specific methods were described in the product instructions. Wild-type rapeseed leaves (non-GMO, NGM) were used as a control, and the same analysis was performed on each plant, with six replicates per plant.
[0250] The experimental results of protein (EPSPS, PAT, 24DT21, and HTG proteins) content in the transgenic rapeseed event DBN7009 are shown in Table 6. The average expression level of EPSPS protein in the leaves of transgenic rapeseed event DBN7009 and wild-type rapeseed plants, as well as the proportion of leaf dry weight (μg / g), were 75.19 and 0, respectively; the average expression level of PAT protein in the leaves of transgenic rapeseed event DBN7009 and wild-type rapeseed plants, as well as the proportion of leaf dry weight (μg / g), were 2.10 and 0, respectively; the average expression level of 24DT21 protein in the leaves of transgenic rapeseed event DBN7009 and wild-type rapeseed plants, as well as the proportion of leaf dry weight (μg / g), were 148.32 and 0, respectively; and the average expression level of HTG protein in the leaves of transgenic rapeseed event DBN7009 and wild-type rapeseed plants, as well as the proportion of leaf dry weight (μg / g), were 309.74 and 0, respectively.
[0251] Table 6. Average results of protein expression levels (μg / g) of the transgenic rapeseed event DBN7009.
[0252] Protein / Plant Rapeseed incident DBN7009 (μg / g) NGM comparison EPSPS protein 75.19±10.87 0 PAT protein 2.10±0.18 0 24DT21 protein 148.32±17.38 0 HTG protein 309.74±52.90 0
[0253] Sixth Example: Herbicide Tolerance Testing of Genetically Modified Rapeseed (DBN7009)
[0254] This experiment used Roundup herbicide (41% glyphosate isopropylammonium salt as active ingredient), Silvastar herbicide (10% glyphosate ammonium salt as active ingredient), Jintaihe Kuodian herbicide (72% 2,4-D dimethylamine salt as active ingredient), and Bauwei herbicide (30% benzoxazine as active ingredient) for spraying. A randomized block design with three replicates was used. The plot area was 15 m². 2(5m×3m), row spacing 50cm, plant spacing 20cm, conventional cultivation management, with a 1m wide isolation strip between plots. Genetically modified rapeseed DBN7009 was subjected to the following five treatments: 1) no spraying; 2) Roundup herbicide sprayed at the V3 leaf stage at a dose of 3600g ae / ha; 3) Sipro herbicide sprayed at the V3 leaf stage at a dose of 1200g ai / ha; 4) Kintahe Kuodian herbicide sprayed at the V3 leaf stage at a dose of 2520g ae / ha; 5) Baowei herbicide sprayed at the V3 leaf stage at a dose of 100g ai / ha.
[0255] Herbicide damage symptoms were investigated 1 week and 2 weeks after application, and rapeseed yield in each plot was measured at harvest. The symptom grading is shown in Table 7. Herbicide damage rate was used as an indicator to evaluate herbicide tolerance in the transformation event. Specifically, herbicide damage rate (%) = ∑(number of affected plants at the same level × number of levels) / (total number of plants × highest level); where the herbicide damage rate included glyphosate damage rate, glufosinate damage rate, 2,4-D damage rate, and benzoxazole damage rate. The herbicide damage rate was determined based on the herbicide damage survey results 2 weeks after treatment with glyphosate, glufosinate, 2,4-D, or benzoxazole. Rapeseed yield in each plot was the total yield (by weight) of the middle three rows of rapeseed in each plot. Yield differences between different treatments were measured as a percentage of yield, yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and rapeseed yield of the genetically modified rapeseed event DBN7009 are shown in Table 8.
[0256] Table 7. Grading Standards for Herbicide Damage to Rapeseed
[0257] Phytotoxicity level Symptom description 1 The plant is growing normally and shows no signs of damage. 2 Minor pesticide damage, less than 10% of the plant's output. 3 Moderate pesticide damage; it can recover later and will not affect yield. 4 Severe pesticide damage, difficult to recover from, resulting in reduced yield. 5 Severe pesticide damage that cannot be reversed, resulting in significant yield reduction or complete crop failure.
[0258] Table 8. Results of herbicide tolerance and rapeseed yield of the transgenic rapeseed event DBN7009.
[0259]
[0260]
[0261] The results showed that, regarding the damage rates from herbicides (glyphosate, glufosinate, 2,4-D, and benzoxazole): 1) the damage rate of the transgenic rapeseed event DBN7009 was essentially 0 under glyphosate treatment (3600 g ae / ha); 2) the damage rate of the transgenic rapeseed event DBN7009 was also essentially 0 under glufosinate treatment (1200 g ai / ha); 3) the damage rate of the transgenic rapeseed event DBN7009 was essentially 0 under 2,4-D treatment (2520 g ae / ha); 4) the damage rate of the transgenic rapeseed event DBN7009 was also essentially 0 under benzoxazole treatment (100 g ai / ha). Therefore, the transgenic rapeseed event DBN7009 exhibits good tolerance to herbicides (glyphosate, glufosinate, 2,4-D, and benzoxazole).
[0262] Regarding yield: There was essentially no difference in yield among the five treatments of the transgenic rapeseed event DBN7009: no application, application of glyphosate herbicide (3600 g ae / ha), application of glufosinate-ammonium herbicide (1200 g ai / ha), application of 2,4-D herbicide (2520 g ae / ha), and application of benzoxazole herbicide (100 g ai / ha). This further demonstrates that the transgenic rapeseed event DBN7009 exhibits good tolerance to herbicides (glyphosate, glufosinate-ammonium, 2,4-D, and benzoxazole) without affecting yield.
[0263] Seventh Implementation Example: Screening of Conversion Events
[0264] To select the best-performing transformation event, 387 independent transgenic T0 generation plants were obtained and transplanted to a greenhouse for cultivation and propagation to obtain transgenic T1 generation plants. Through self-pollination and backcrossing, homozygous materials with different backgrounds were obtained for evaluation of the transformation event. During this process, various indicators were evaluated, including positive rate detection, agronomic phenotypic identification, molecular biological testing, target herbicide tolerance testing, and genetic stability. Ultimately, the transformation event DBN7009 was selected as the best performer.
[0265] 7.1 Positive Rate Detection
[0266] False positive transformation events are common in rapeseed during the transformation process. Therefore, in the T1 generation, a herbicide application method was used to identify whether the transformation event was positive. The method was as follows: a 1:1 concentration of glufosinate solution was prepared. At the V2 stage of rapeseed, a small amount of glufosinate solution was applied to the lower leaf using a brush, covering the 1 / 3 of the leaf near the edge. After 3 days, the wilting of the leaf was observed to determine whether it was a positive transformation. This herbicide application method eliminated 94 false positive plants.
[0267] 7.2 Molecular biological detection
[0268] 7.2.1 Copy Number Detection
[0269] After obtaining a positive transformation event in the T1 generation, the copy number needs to be identified. Copy number identification is performed using the TaqMan method (see Example 2), and the transformation event with the target copy number is obtained through data analysis. The TaqMan identification criteria and transformation event screening results are shown in Table 9. Zero represents 0 copies, Medium represents medium-high copy number, and High represents high copy number.
[0270] Table 9. Conversion Event Screening - Copy Number Identification
[0271]
[0272] Based on the TaqMan data results and the identification criteria in the table above, a total of 119 conversion events were eliminated.
[0273] 7.2.2 Insertion Site Analysis
[0274] Transgenic insertion site analysis involves analyzing the flanking DNA sequences of the insertion site using sequencing methods (see Example 3 for the method). The main analysis includes the integrity of the T-DNA flanking the insertion site, whether the T-DNA has been inserted into an important gene in the rapeseed genome, and whether the insertion has caused the generation of a new open reading frame (ORF). Based on the above information, non-compliant transformation events are eliminated. The screening results of transformation events are shown in Table 10.
[0275] Table 10 Screening of Transgenic Events - Analysis of Transgenic Insertion Sites
[0276] index Number of conversion events removed T-DNA integrity 25 Inserted gene 31 New ORF 22
[0277] Based on the above evaluation indicators and analysis of transgenic insertion sites, a total of 78 transformation events were eliminated.
[0278] 7.3 Herbicide Tolerance Testing
[0279] After the T1 generation screened out molecularly qualified transformation events, the tolerance to the target herbicides was evaluated (the operation method and evaluation method are described in Example 6). The herbicides used for the evaluation and screening of transgenic rapeseed were glyphosate, glufosinate, 2,4-D and benzoxazine. The herbicide tolerance evaluation content and the screening of transformation events are shown in Table 11.
[0280] Table 11 Screening of Transformation Events - Target Herbicide Tolerance Detection
[0281]
[0282] Through the evaluation and comparison of herbicide tolerance, a total of 23 transformation events were eliminated, while the other transformation events showed good resistance.
[0283] 7.4 Identification of Agronomic Traits
[0284] Because transformation and transgenic insertion affect the agronomic traits of rapeseed plants, the focus after a transformation event enters the T2 generation is on field investigation of agronomic traits, including seedling vigor, growth period, plant height, and yield per plant. If a significant difference is found between the transformation event and the wild-type control village, it must be excluded. The screening results for transgenic rapeseed in terms of agronomic traits are shown in Table 12.
[0285] Table 12 Screening of Transformation Events - Identification of Agronomic Trait Phenotypes
[0286] Agronomic traits Number of plants with abnormal agronomic traits Seedling vigor 23 reproductive period 2 Plant height 1 Yield per plant 6
[0287] Regarding agronomic traits, a total of 32 abnormal transformation events were eliminated through investigations of transgenic oilseed plants at different times.
[0288] Through screening, the rapeseed event DBN7009 was selected as superior because it is a single-copy transgenic herbicide, has good tolerance to four target herbicides, and has not affected rapeseed yield or other physiological indicators.
[0289] The eighth embodiment involves the production of agricultural products or commodities from the genetically modified rapeseed incident DBN7009.
[0290] Genetically modified rapeseed DBN7009 can be used to produce agricultural products or commodities. If sufficient expression levels are detected in said agricultural products or commodities, they are expected to contain nucleotide sequences capable of diagnosing the presence of the genetically modified rapeseed event DBN7009 material in said agricultural products or commodities. These foods or commodities include, but are not limited to, products derived from the rapeseed plant DBN7009, such as rapeseed cake, powder, and oil, specifically lecithin, fatty acids, glycerol, sterols, edible oils, isolated rapeseed protein, hydrolyzed plant protein, textured rapeseed protein, and rapeseed protein fiber, etc. Nucleic acid detection methods and / or kits based on probe or primer pairs can be developed to detect the genetically modified rapeseed event DBN7009 nucleotide sequences, such as those shown in SEQ ID NO:1 or SEQ ID NO:2, wherein the probe or primer sequences are selected from sequences or fragments thereof shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, or complementary sequences, to diagnose the presence of the genetically modified rapeseed event DBN7009.
[0291] In summary, the transgenic rapeseed event DBN7009 of this invention exhibits good tolerance to the target herbicides glyphosate, glufosinate-ammonium (or glufosinate-ammonium), 2,4-D and / or benzoxazine, without affecting yield. Furthermore, the detection method can accurately and rapidly identify whether biological samples contain the DNA molecules of the transgenic rapeseed event DBN7009.
[0292] Seeds corresponding to the genetically modified rapeseed event DBN7009 were deposited on November 25, 2025, under the Budapest Treaty at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China). The classification is *Brassica napus*, the deposit status is viable, and the accession number is CGMCC No. 46697. The deposit will be held at the collection for 30 years.
[0293] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A nucleic acid molecule having the following nucleic acid sequence, characterized in that, The nucleic acid sequence comprises at least 11 consecutive nucleotides in positions 1-476 of SEQ ID NO:3 or its complementary sequence and at least 11 consecutive nucleotides in positions 477-1162 of SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides in positions 1-678 of SEQ ID NO:4 or its complementary sequence and at least 11 consecutive nucleotides in positions 679-1735 of SEQ ID NO:4 or its complementary sequence; Preferably, the nucleic acid sequence comprises 22-25 consecutive nucleotides in positions 1-476 of SEQ ID NO:3 or its complementary sequence and 22-25 consecutive nucleotides in positions 477-1162 of SEQ ID NO:3 or its complementary sequence, and / or 22-25 consecutive nucleotides in positions 1-678 of SEQ ID NO:4 or its complementary sequence and 22-25 consecutive nucleotides in positions 679-1735 of SEQ ID NO:4 or its complementary sequence; Preferably, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence; Preferably, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence.
2. The nucleic acid molecule according to claim 1, characterized in that, The nucleic acid sequence contains SEQ ID NO:5 or its complementary sequence.
3. A method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample, characterized in that, include: The sample to be tested is brought into contact with at least two primers used to amplify the target amplification product during the nucleic acid amplification reaction; Perform nucleic acid amplification reaction; and Detect the presence of the target amplification product; The target amplification product comprises the nucleic acid sequence of claim 1 or 2; preferably, the target amplification product comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.
4. The method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample according to claim 3, characterized in that, The two primers include complementary sequences of SEQ ID NO:8 and SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11, or SEQ ID NO:1 and SEQ ID NO:
2.
5. A method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample, characterized in that, include: The sample to be tested is brought into contact with the probe, the probe comprising the nucleic acid sequence of claim 1; preferably, the probe comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence; The sample to be tested and the probe are hybridized under strict hybridization conditions; and The hybridization between the sample to be tested and the probe is detected.
6. The method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample according to claim 5, characterized in that, At least one of the probes is labeled with at least one fluorescent group.
7. A method for detecting the presence of DNA from the transgenic rapeseed event DBN7009 in a sample, characterized in that, include: The sample to be tested is brought into contact with a labeled nucleic acid molecule, the labeled nucleic acid molecule comprising the nucleic acid sequence of claim 1; preferably, the labeled nucleic acid molecule comprises at least one selected from the following: SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, and SEQ ID NO:6-11 or its complementary sequence; The sample to be tested and the labeled nucleic acid molecule are hybridized under strict hybridization conditions; The hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is used to determine whether herbicide tolerance is genetically linked to the marker nucleic acid molecule.
8. A DNA detection kit, characterized in that, The device includes at least one DNA molecule containing the nucleic acid sequence of claim 1, which can serve as one of the DNA primers or probes specific to the transgenic rapeseed event DBN7009 or its progeny; preferably, the DNA molecule contains SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.
9. A plant cell or part thereof, characterized in that, The device comprises a nucleic acid sequence encoding a glyphosate-resistant EPSPS protein, a nucleic acid sequence encoding a glufosinate-ammonium or glufosinate-ammonium-resistant PAT protein, a nucleic acid sequence encoding a 2,4-D-resistant 24DT21 protein, a nucleic acid sequence encoding a benzoxazine-resistant HTG protein, and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region comprises the sequences shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region comprises the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:
4. Preferably, the plant cells or portions contain transgenic rapeseed event DBN7009; Optionally, the plant cells or portions may further contain at least one other transgenic rapeseed event different from the transgenic rapeseed event DBN7009.
10. A method for protecting rapeseed plants from damage caused by herbicides or controlling weeds in rapeseed-grown fields, characterized in that, This includes applying an effective dose of glyphosate, glufosinate or glufosinate, 2,4-D and / or benzoxazole herbicide to a field where at least one transgenic rapeseed plant is planted, said transgenic rapeseed plant containing the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2 in its genome, said transgenic rapeseed plant being tolerant to glyphosate, glufosinate or glufosinate, 2,4-D and benzoxazole herbicide; Preferably, the transgenic rapeseed plant contains the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:4 in its genome; Preferably, the transgenic rapeseed plant contains, in sequence, the nucleic acid sequences of positions 688-11960 of SEQ ID NO:1 and SEQ ID NO:5 and SEQ ID NO:2 in its genome, or contains the sequence shown in SEQ ID NO:
5.
11. A method for cultivating rapeseed plants tolerant to glyphosate, glufosinate or glufosinate-ammonium, 2,4-D, and benzoyl permethrin herbicides, characterized in that, include: Plant at least one rapeseed seed, wherein the genome of the rapeseed seed contains a nucleic acid sequence encoding a glyphosate-resistant EPSPS protein and / or a nucleic acid sequence encoding glufosinate-ammonium, a glufosinate-ammonium-resistant PAT protein and / or a nucleic acid sequence encoding a 2,4-D-resistant 24DT21 protein and / or a nucleic acid sequence encoding a benzoxazine-resistant HTG protein, and a nucleic acid sequence of a specific region, or the genome of the rapeseed seed contains the nucleic acid sequence shown in SEQ ID NO:5; The rapeseed seeds are then allowed to grow into rapeseed plants. The rapeseed plants were sprayed with an effective dose of glyphosate, glufosinate or glufosinate, 2,4-D and / or benzoxazine herbicide, and the plants with reduced plant damage compared to other plants without specific regions of nucleic acid sequence were harvested. The nucleic acid sequence of the specific region includes the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region includes the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:
4.
12. A method for producing rapeseed plants resistant to glyphosate, glufosinate or glufosinate, 2,4-D and / or benzoxazine herbicides, characterized in that, The method includes introducing nucleic acid sequences encoding glyphosate-tolerant EPSPS proteins and / or glufosinate-ammonium-ammonium-tolerant PAT proteins and / or 2,4-D-tolerant 24DT21 proteins and / or benzoxazole-tolerant HTG proteins from the genome of a first rapeseed plant, and nucleic acid sequences of specific regions, or introducing the nucleic acid sequence shown in SEQ ID NO:5 from the genome of the first rapeseed plant into a second rapeseed plant to produce a large number of progeny plants; selecting the progeny plants having the nucleic acid sequence of the specific region, and the progeny plants being tolerant to glyphosate, glufosinate-ammonium-ammonium-ammonium- or glufosinate-ammonium-ammonium-2,4-D and / or benzoxazole-ammonium herbicides; the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4; Preferably, the method includes sexually hybridizing a first rapeseed plant containing the transgenic rapeseed event DBN7009 with a second rapeseed plant to produce a large number of progeny plants, and selecting the progeny plants that have the nucleic acid sequence of the specific region. The progeny plants were treated with glyphosate, glufosinate or glufosinate, 2,4-D and / or benzoxazine. Select the progeny plants that are tolerant to glyphosate, glufosinate or glufosinate, 2,4-D and / or benzoxazine herbicides.
13. An agricultural product or commodity derived from rapeseed plants containing the transgenic rapeseed event DBN7009, characterized in that, The agricultural products or commodities mentioned are lecithin, fatty acids, glycerol, sterols, edible oil, isolated rapeseed protein, hydrolyzed vegetable protein, textured rapeseed protein, rapeseed protein fiber, rapeseed cake, and rapeseed powder.
14. A method for expanding the range of insect resistance and / or herbicide tolerance in rapeseed plants, characterized in that, The transgenic rapeseed event DBN7009 was expressed in plants together with at least one other transgenic rapeseed event different from DBN7009.
Citation Information
Patent Citations
Soybean incident MON89788 and methods for detecting it
CN101252831B
Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5633435A