Composition for detecting NOTCH3 gene polymorphism, kit and application
By designing specific primers and probes using the PCR-fluorescent probe melting curve method, we have achieved efficient and low-cost detection of NOTCH3 gene polymorphism, solving the problems of long detection time and complexity in existing technologies and improving the early diagnostic efficiency of CADASIL.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-05
- Publication Date
- 2026-04-03
AI Technical Summary
Existing methods for detecting NOTCH3 gene mutations suffer from problems such as long detection time, complex operation, and high cost, making it difficult to achieve early diagnosis and efficient detection of CADASIL.
The PCR-fluorescent probe melting curve method was adopted. Specific primers and probes were designed and labeled with fluorescent groups and quenching groups. Multiple detection was achieved by real-time monitoring and analysis of melting curves. The results were integrated into three reaction tubes, which simplified the operation and reduced the risk of contamination.
It enables the detection of 15 SNP sites in a short time, increasing detection throughput, reducing costs and operational complexity, reducing the risk of contamination, and improving detection efficiency and accuracy.
Smart Images
Figure CN121780685A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a composition, kit, and application for detecting NOTCH3 gene polymorphism. Technical Background
[0002] Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a relatively common inherited small vessel disease of the brain with a strong familial tendency, caused by a mutation in the Notch3 gene located on chromosome 19. Its lesions primarily affect small blood vessels in the brain, leading to a series of symptoms including white matter lesions, cerebral infarction, and cognitive impairment. Typical clinical symptoms include recurrent transient ischemic attacks (TIAs), migraines, cognitive impairment, and mood abnormalities. These symptoms not only severely impact patients' daily living abilities but also lead to gradual cognitive decline, eventually developing into dementia, causing immense suffering for patients and their families.
[0003] With the accelerating aging of the population, the incidence of CADASIL is on the rise, severely impacting patients' quality of life and placing a heavy burden on families and society. Currently, although research on CADASIL has made some progress both domestically and internationally, many challenges remain in early diagnosis, disease assessment, and treatment. Early diagnosis is crucial for CADASIL patients, as it can buy them more treatment time, slow disease progression, and improve their quality of life. However, because the clinical manifestations of CADASIL lack specificity, and some symptoms are similar to those of other cerebrovascular diseases, misdiagnosis and missed diagnosis are common.
[0004] In 1996, Joutel et al. reported the pathogenic gene NOTCH3 for CADASIL, making it the gold standard for CADASIL diagnosis. Currently, the pathogenic mutations in the vast majority of reported CADASIL patients are located on 34 EGFR sequences and involve changes in the number of cysteine residues, causing structural abnormalities in Notch3. Therefore, detecting relevant mutations in the NOTCH3 gene on chromosome 19q12 can provide rapid auxiliary diagnosis of CADASIL, greatly improving the efficiency and accuracy of CADASIL detection.
[0005] Current gene diagnostic methods mainly include first- or second-generation sequencing, RFLP, and quantitative real-time PCR. These methods generally suffer from long detection times, complex operations, and high costs. To address these issues, this invention employs a PCR-fluorescent probe melting curve method, enabling the detection of 15 common mutations in a short time and at low cost using only three reaction tubes. These mutations cover the vast majority of known mutation points. Summary of the Invention
[0006] To address the problems existing in the prior art, the present invention provides a composition, kit, and application for detecting NOTCH3 gene polymorphism.
[0007] To achieve the above objectives, the present invention proposes the following solution:
[0008] This invention provides a composition for detecting NOTCH3 gene polymorphism, comprising: Primer pairs for detecting sites p.R90C, p.C108S, and p.R110C have nucleotide sequences as shown in SEQ ID NO. 1-2; a specific probe for detecting site p.R90C has nucleotide sequences as shown in SEQ ID NO. 3; and a specific probe for detecting sites p.C108S or p.R110C has nucleotide sequences as shown in SEQ ID NO. 4. Primer pairs for detecting sites p.R587C, p.R607C, and p.C606F have nucleotide sequences as shown in SEQ ID NO.5-6; a specific probe for detecting site p.R587C has nucleotide sequences as shown in SEQ ID NO.7; and a specific probe for detecting sites p.R607C or p.C606F has nucleotide sequences as shown in SEQ ID NO.8. Primer pairs for detecting sites p.R133C, p.R141C, p.C144S, and p.R153C, with nucleotide sequences shown in SEQ ID NO. 9–10; a specific probe for detecting site p.R133C, with a nucleotide sequence shown in SEQ ID NO. 11; a specific probe for detecting sites p.R141C or p.C144S, with a nucleotide sequence shown in SEQ ID NO. 12; and a specific probe for detecting site p.R153C, with a nucleotide sequence shown in SEQ ID NO. 13. The primer pair for detecting site p.R332C has the nucleotide sequence shown in SEQ ID NO.14-15; the specific probe for detecting site p.R332C has the nucleotide sequence shown in SEQ ID NO.16. The primer pair for detecting site p.R421C has the nucleotide sequence shown in SEQ ID NO.17-18; the specific probe for detecting site p.R421C has the nucleotide sequence shown in SEQ ID NO.19. The primer pair for detecting site p.R544C has the nucleotide sequence shown in SEQ ID NO.20-21; the specific probe for detecting site p.R544C has the nucleotide sequence shown in SEQ ID NO.22. The primer pairs for detecting sites p.R169C and p.R182C have nucleotide sequences as shown in SEQ ID NO.23-24; the specific probe for detecting site p.R169C has nucleotide sequences as shown in SEQ ID NO.25; and the specific probe for detecting site p.R182C has nucleotide sequences as shown in SEQ ID NO.26.
[0009] Further, the nucleotide sequence is a fluorescent group labeled at the 5' end and a quenching group labeled at the 3' end of the specific probe shown in SEQ ID NO. 3, 4, 7, 8, 11, 12, 13, 16, 19, 22, 25 and 26.
[0010] Furthermore, the fluorescent group is selected from one of FAM, VIC, CY5 and ROX, and the quenching group is selected from one of BHQ1, BHQ2 and BHQ3 corresponding to the fluorescent group.
[0011] The present invention also provides a kit for detecting NOTCH3 gene polymorphism, comprising the above-described composition for detecting NOTCH3 gene polymorphism.
[0012] Furthermore, the kit dispenses the composition for detecting NOTCH3 gene polymorphism into three separate physical reaction tubes; The specific allocation method and dosage are as follows:
[0013] The concentration of each primer or probe is 100P.
[0014] Furthermore, it also includes positive and negative control samples, wherein the positive control sample is an equal mixture of artificially synthesized wild-type plasmids containing all detection sites and artificially synthesized homozygous mutant plasmids; the negative control sample is human serum.
[0015] This invention also provides a method for detecting NOTCH3 gene polymorphism, comprising the following steps: (1) Extract genomic DNA from the sample to be tested; (2) The genomic DNA obtained in step (1) is mixed with tubes A, B and C of claim 5 to form three independent PCR reaction systems; (3) Perform PCR amplification on the three PCR reaction systems prepared in step (2), and execute the melting curve analysis program after the amplification is completed to monitor the signal changes of each fluorescence channel in real time; (4) Based on the melting curves and corresponding melting temperature values of each reaction system obtained in step (3), determine the genotype of each target site.
[0016] Furthermore, the PCR amplification reaction procedure in step (3) is as follows:
[0017] Three detection items, A, B, and C, were set on the PCR amplification instrument, with FAM, VIC, CY5, and ROX selected for each.
[0018] The present invention also provides the above-described composition for detecting NOTCH3 gene polymorphism and the above-described kit for detecting NOTCH3 gene polymorphism in the application of detecting NOTCH3 gene polymorphism, the application being for purposes other than disease diagnosis and treatment.
[0019] The present invention discloses the following technical effects: This NOTCH3 gene diagnostic method utilizes the PCR-fluorescent probe melting curve method. Compared with traditional PCR SNP detection methods, it enables multiplex detection in a single tube. This experiment can detect 15 SNP sites in three reaction tubes in a single test, within two and a half hours, greatly improving the detection throughput. Compared with first-generation / second-generation sequencing methods and other methods, it has advantages such as simple operation, low cost, and short detection time. Furthermore, the entire operation does not require opening the tube, greatly reducing the risk of contamination. Attached Figure Description
[0020] Figure 1 This is a display of the results from the test tubes containing the mutation sites in some clinical samples.
[0021] Figure 2 This is a display of the results from the test tubes containing the mutation sites in some clinical samples. Detailed Implementation
[0022] This invention uses the PCR-fluorescent probe melting curve method to determine common SNP sites of the CADASIL pathogenicity-related gene NOTCH3 in human peripheral venous whole blood samples, for the auxiliary diagnosis of suspected patients.
[0023] The basic principle is as follows: A probe labeled with a fluorescent group and a quencher group at both ends is added to the PCR system. During PCR, a single-stranded oligonucleotide sequence complementary to the probe sequence is amplified. After amplification, a melting curve analysis process is added, and the change in fluorescence value is monitored in real time. By calculating the negative derivative of fluorescence value with temperature, the melting curve of the hybridization product of the probe and the sequence can be obtained, and the Tm value (melting point) can be derived, thus inferring the mutation information of the sequence. If the target sequence and the probe are perfectly matched, the Tm value of the hybridization between the probe and the sequence is the highest; if the probe and the sequence are not perfectly matched, for example, due to point mutation, insertion, or deletion, the Tm value of the hybridization between the probe and the sequence is lower than the Tm value of the hybridization between the probe and the perfectly matched sequence. The degree of decrease in Tm value is related to the type of point mutation, the number of inserted or deleted bases, and the location of the mutation site. When a single-base mutation exists in a region close to the probe coverage area of the tested sample, the similar changes in Tm value may make it difficult to distinguish and accurately classify the mutation. This invention cannot distinguish the specific mutation forms of p.R141C and p.C144S.
[0024] The kit described in this invention uses an UNG enzyme anti-contamination system, which can degrade previously amplified PCR products containing U that may cause laboratory contamination before amplification begins, thereby reducing the possibility of PCR laboratory contamination.
[0025] Example 1 Design of specific primers and fluorescent probes for the NOTCH3 gene SNP site Based on the principles of the PCR-fluorescent probe melting curve technique and the relevant mutation information published in the nucleic acid sequence database of the human gene and genetic phenotype database omym, multiple specific primers and specific fluorescent probes were designed for detecting polymorphic sites in the NOTCH3 gene. The specific sequence information is as follows: Primer pairs for detecting sites p.R90C and p.C108S or p.R110C, with nucleotide sequences shown in SEQ ID NO. 1–2. Specific probes for detecting site p.R90C, with nucleotide sequences shown in SEQ ID NO. 3. Specific probes for detecting sites p.C108S or p.R110C, with nucleotide sequences shown in SEQ ID NO. 4. SEQ ID NO.1: TGGAGGACCCCTGTCACTCA SEQ ID NO.2: CTCCAGACTCTTCCCCTCTCAC SEQ ID NO.3: CTGGCCGTGGTGTCTGCCAG SEQ ID NO.4: TCGGTGCCCCCGTGGCTTCCGAG Primer pairs for detecting sites p.R587C and p.R607C or p.C606F, with nucleotide sequences shown in SEQ ID NO. 5-6. A specific probe for detecting site p.R587C, with a nucleotide sequence shown in SEQ ID NO. 7. A specific probe for detecting sites p.R607C or p.C606F, with a nucleotide sequence shown in SEQ ID NO. 8. SEQ ID NO.5: CACACGCTGCGAGAGCCAG SEQ ID NO.6: CATGGAGTGGCCACCACTGT SEQ ID NO.7: AGGTGGACGAATGCCGCAGCCACCT SEQ ID NO.8: CAGAACCTCTGCCGCTGCCCTTCTG Primer pairs for detecting sites p.R133C, p.R141C, p.C144S, and p.R153C, with nucleotide sequences shown in SEQ ID NO. 9–10; a specific probe for detecting site p.R133C, with a nucleotide sequence shown in SEQ ID NO. 11; a specific probe for detecting sites p.R141C or p.C144S, with a nucleotide sequence shown in SEQ ID NO. 12; and a specific probe for detecting site p.R153C, with a nucleotide sequence shown in SEQ ID NO. 13. SEQ ID NO.9: TGCCAGATCCCTGCCTCAGC SEQ ID NO.10: GCACTCATCCACGTCGCTT SEQ ID NO.11:CCCACGGTGCCCGCTGCTCAGTGGG SEQ ID NO.12:GATGGACGCTTCCTCTGCTCCTGCCCATC SEQ ID NO.13: TCCTGCCCACCTGGCTACC The primer pair for detecting site p.R332C has the nucleotide sequence shown in SEQ ID NO.14-15; the specific probe for detecting site p.R332C has the nucleotide sequence shown in SEQ ID NO.16. SEQ ID NO.14: ACTGTGCCACAGCCGTGTG SEQ ID NO.15: TCCATGGCTCCCTGCAGAG SEQ ID NO.16: AGTAGACCGCGTGGCTTCTTTCTACT The primer pair for detecting site p.R421C has the nucleotide sequence shown in SEQ ID NO.17-18; the specific probe for detecting site p.R421C has the nucleotide sequence shown in SEQ ID NO.19. SEQ ID NO.17:ACTTGGGCAGGTGCGTGAA SEQ ID NO.18: CTCGTTGACATCGGTCTCACA SEQ ID NO.19: CCAGTGCGGTCGTGGCTACACTGG The primer pair for detecting site p.R544C has the nucleotide sequence shown in SEQ ID NO.20-21; the specific probe for detecting site p.R544C has the nucleotide sequence shown in SEQ ID NO.22. SEQ ID NO.20: CTGAACCAGGATTGGTCCGA SEQ ID NO.21:ATGGGTCAGGGGAGCAGTC SEQ ID NO.22: CCACGCTGTGTGATCGCAACGTGG The primer pairs for detecting sites p.R169C and p.R182C have nucleotide sequences as shown in SEQ ID NO.23-24; the specific probe for detecting site p.R169C has nucleotide sequences as shown in SEQ ID NO.25; and the specific probe for detecting site p.R182C has nucleotide sequences as shown in SEQ ID NO.26. SEQ ID NO.23: AAGCGACGTGGATGAGTGC SEQ ID NO.24: CCTGTGTAGCCAGCTGGACAC SEQ ID NO.25: TGAGCCCTGCCGCCATGGTGGCTCA SEQ ID NO.26: CTGGCTCCTTCCGCTGCCAG SEQ IDN0.3, 4, 7, 8, 11, 12, 13, 16, 19, 22, 25 and 26 are double-labeled wedge probes, with a fluorescent group labeled at the 5' end and a quenching group labeled at the 3' end. The fluorescent group is one of FAM, VIC, ROX and CY5, and the quenching group is one of BHQ1, BHQ2 and BHQ3.
[0026] Example 2 Kit for detecting NOTCH3 gene polymorphism associated with CADASIL disease 1. The main components of the kit are shown in Table 1: Table 1 Main components of the kit
[0027] In Table 1: The PCR reaction solution was AceQ Universal U+ Probe Master Mix V2, purchased from Nanjing Novozymes, which contains Taq enzyme, UNG enzyme, dNTPs, PCR buffer and other components.
[0028] Preparation of positive control samples 1 and 2: The raw materials for positive control 1 are as follows. The two positive control raw materials are diluted with human serum to a concentration of 10 ng / μL, mixed thoroughly, and then aliquoted separately to obtain positive control 1 and positive control 2.
[0029] Preparation of negative control samples Human serum, once melted and mixed evenly, becomes a negative control sample.
[0030] The composition of primers and probes in tubes A, B, and C is shown in Table 2 below (single dose, primer and probe concentration is 100P).
[0031] Table 2
[0032] 2. Testing Steps 2.1 Genome extraction from peripheral blood Genome DNA from peripheral blood of clinical patients was obtained using common and mature peripheral blood genomic DNA extraction methods or commercial nucleic acid extraction kits (such as nucleic acid extraction or purification reagents from Kangwei Century Biotechnology Co., Ltd., Suzhou Medical Device Registration No. 20140031). This genomic DNA was then used as the DNA template for qPCR detection. 6 μL of the extracted genome was added to a PCR reaction tube for each sample. One PCR reaction tube was used for each sample, and PCR amplification was then performed.
[0033] 2.2 Construction of PCR reaction system Prepare the reaction system using a clean 1.5 mL centrifuge tube (D-RNase-free) as follows: The 20 μL PCR reaction system in tube A includes: 4 μL of primers and probes, 10 μL of AceQ Universal U+ ProbeMaster Mix V2 PCR reaction solution, and 6 μL of sample DNA; The 20 μL PCR reaction system in tube B includes: 4 μL of primers and probes, 10 μL of AceQ Universal U+ ProbeMaster Mix V2 PCR reaction solution, and 6 μL of sample DNA; The 20 μL PCR reaction system in tube C includes: 4 μL primers and probes from tube B, 10 μL of AceQ Universal U+ ProbeMaster Mix V2 PCR reaction solution, and 6 μL of sample DNA; Prepare each tube individually. After adding all reagents, tighten the cap (to avoid air bubbles), vortex to mix, and briefly centrifuge to remove all liquid from the tube wall to the bottom. Then, immediately perform the PCR amplification reaction. Each reaction system uses DNA as a template for real-time PCR, with both negative and positive controls included. 2.3 Setting up the PCR reaction program Set the reaction program on the PCR amplification instrument as shown in Table 3 below (set three detection items A / B / C on the machine, and select FAM, VIC, CY5 and ROX for the fluorescence channels).
[0034] Table 3 PCR reaction procedure
[0035] The instrument used was a real-time quantitative PCR instrument (Suzhou Yarui Biotechnology Co., Ltd., model: MA-6000).
[0036] Negative and positive quality control samples are set in the corresponding parts of the machine to monitor possible inhibitory factors in the RT-PCR reaction and the status of reagents and instruments, and to serve as a basis for judging the reliability of the experiment.
[0037] 3. Analysis of test results 3.1 Determination of baseline and threshold After the reaction, the instrument automatically saves the results. After analyzing the images, adjust the Start, End, and Threshold values of the Baseline (these can be adjusted manually; the Start value is between 1 and 15, and the End value is between 5 and 20). The threshold setting principle is that the threshold line exceeds the highest point of the fluorescence curve of the negative control. Negative control: No S-shaped amplification curve is observed in any detection channel, and the Ct value column in the Reports interface displays "Undetermined" or a Ct value greater than or equal to 35. The Ct values of the CY5 detection channel of each positive control are all less than 25.
[0038] 3.2 Result Judgment The melting curve of the negative control should show no melting peaks in any detection channel; the test result of the positive control should show that all monitoring sites are heterozygous. All of the above conditions must be met in the same experiment; otherwise, the experimental results are invalid. The temperature corresponding to the highest point of the melting curve is the Tm value for that site. The judgment of positive results is shown in Table 4 below.
[0039] Table 4. Judgment values for positive results
[0040] The Ct value for each CY5 channel should be less than or equal to 25. If the Ct value for the CY5 channel is greater than 25, it indicates that the amplification may be inhibited or the amount of nucleic acid added is too low. In this case, the result may be incorrect regardless of the result, and it is recommended to retest.
[0041] Figures 1-2 This section shows the results of the tube containing the mutation site in the clinical sample testing; the results of the other two tubes were for wild-type. Figures 1-2 The data analysis is shown in Table 5.
[0042] Table 5
[0043] Example 3: Product performance of the reagent kit described in this invention 1. Conformity rate of positive reference materials Sixteen positive reference samples (PC01~PC16) were tested, and the genotypes determined by the melting curves were 100% consistent with the results. The Ct values of the CY5 detection channels in the three tubes (A, B, and C) were all ≤25.
[0044] 2. Negative reference sample compliance rate Three negative reference samples (NC01-NC03) were tested. The results showed that the genotype determined by the melting curve of NC01 was completely wild; NC02 and NC03 had no Ct value or a Ct value ≥35 and no melting curve.
[0045] 3. Precision Ten parallel tests were performed on each of the three precision reference samples (RC01~RC03). The test results should be as follows: For RC01, the genotype results determined by melting curve analysis were all wild-type, and the coefficient of variation (Tm,%) of Tm values for each channel was ≤1.0%; For RC02, the genotype results determined by melting curve analysis were heterozygous at locus 421 and wild-type at the remaining loci, and the coefficient of variation (Tm,%) of Tm values for each channel was ≤1.0%; For RC03, the genotype results determined by melting curve analysis were heterozygous at locus 544 and wild-type at the remaining loci, and the coefficient of variation (Tm,%) of Tm values for each channel was ≤1.0%.
[0046] 4. Minimum detection limit The limit of detection is 1 ng / μL. When testing the reference standard of the limit of detection, the results should be accurately classified. The results of 20 repeated tests should show that each indicator can be detected at least 19 times and the classification should be accurate.
[0047] 5. Cross-reactivity There is no cross-reactivity between hepatitis B virus, hepatitis C virus, Staphylococcus aureus, Escherichia coli, and yeast; 6. Interfering substances Common endogenous blood interfering substances such as blood lipids, bilirubin, hemoglobin, and albumin, when present in test samples at concentrations of 20 mg / ml, 20 mg / ml, 20 mg / ml, 20 mg / ml, 200 mg / ml, and 210 mg / ml respectively, will not affect the interpretation of the test results. It is not recommended to use samples anticoagulated with heparin, as it will severely inhibit the amplification reaction.
[0048] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can easily understand and modify the technical solutions described in the foregoing embodiments. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details or the described embodiments.
Claims
1. A composition for detecting NOTCH3 gene polymorphism, characterized in that, include: Primer pairs for detecting sites p.R90C, p.C108S, and p.R110C have nucleotide sequences as shown in SEQ ID NO.1-2; a specific probe for detecting site p.R90C has nucleotide sequences as shown in SEQ ID NO.
3. Specific probes for detecting sites p.C108S or p.R110C, the nucleotide sequences of which are shown in SEQ ID NO.4; The primer pairs used to detect sites p.R587C, p.R607C, and p.C606F have nucleotide sequences as shown in SEQ ID NO.5-6; A specific probe for detecting site p.R587C, the nucleotide sequence of which is shown in SEQ ID NO.7; A specific probe for detecting site p.R607C or p.C606F, the nucleotide sequence of which is shown in SEQ ID NO.8; Primer pairs for detecting sites p.R133C, p.R141C, p.C144S, and p.R153C have nucleotide sequences as shown in SEQ ID NO. 9–10; a specific probe for detecting site p.R133C has nucleotide sequences as shown in SEQ ID NO.
11. Specific probes for detecting sites p.R141C or p.C144S, the nucleotide sequences of which are shown in SEQ ID NO.12; A specific probe for detecting site p.R153C, the nucleotide sequence of which is shown in SEQ ID NO.13; The primer pair used to detect site p.R332C has the nucleotide sequence shown in SEQ ID NO.14-15; A specific probe for detecting site p.R332C, the nucleotide sequence of which is shown in SEQ ID NO.16; The primer pair used to detect site p.R421C has the nucleotide sequence shown in SEQ ID NO.17-18; A specific probe for detecting site p.R421C, the nucleotide sequence of which is shown in SEQ ID NO.19; The primer pair used to detect site p.R544C has the nucleotide sequence shown in SEQ ID NO.20-21; A specific probe for detecting site p.R544C, the nucleotide sequence of which is shown in SEQ ID NO.22; The primer pairs used to detect sites p.R169C and p.R182C have nucleotide sequences shown in SEQ ID NO.23-24; The specific probe for detecting site p.R169C has the nucleotide sequence shown in SEQ ID NO.25; the specific probe for detecting site p.R182C has the nucleotide sequence shown in SEQ ID NO.
26.
2. The composition according to claim 1, characterized in that, The nucleotide sequences are those of the specific probes shown in SEQ ID NO. 3, 4, 7, 8, 11, 12, 13, 16, 19, 22, 25 and 26, with a fluorescent group labeled at the 5' end and a quenching group labeled at the 3' end.
3. The composition according to claim 2, characterized in that, The fluorescent group is selected from one of FAM, VIC, CY5 and ROX, and the quenching group is selected from one of BHQ1, BHQ2 and BHQ3 corresponding to the fluorescent group.
4. A kit for detecting NOTCH3 gene polymorphism, characterized in that, The composition comprising any one of claims 1 to 3 for detecting NOTCH3 gene polymorphism.
5. The reagent kit according to claim 4, characterized in that, The kit dispenses the composition for detecting NOTCH3 gene polymorphism into three separate physical reaction tubes; The specific allocation method and dosage are as follows: The concentration of each primer or probe is 100P.
6. The reagent kit according to claim 5, characterized in that, It also includes positive and negative control samples, wherein the positive control sample is an equal mixture of artificially synthesized wild-type plasmids containing all detection sites and artificially synthesized homozygous mutant plasmids; the negative control sample is human serum.
7. A method for detecting NOTCH3 gene polymorphism, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) The genomic DNA obtained in step (1) is mixed with tubes A, B and C of claim 5 to form three independent PCR reaction systems; (3) Perform PCR amplification on the three PCR reaction systems prepared in step (2), and execute the melting curve analysis program after the amplification is completed to monitor the signal changes of each fluorescence channel in real time; (4) Based on the melting curves and corresponding melting temperature values of each reaction system obtained in step (3), determine the genotype of each target site.
8. The method according to claim 7, characterized in that, The PCR amplification reaction procedure in step (3) is as follows: Three detection items, A, B, and C, were set on the PCR amplification instrument, with FAM, VIC, CY5, and ROX selected for each.
9. The use of the composition for detecting NOTCH3 gene polymorphism according to any one of claims 1 to 3, and the kit for detecting NOTCH3 gene polymorphism according to any one of claims 4 to 6, in the detection of NOTCH3 gene polymorphism, wherein the use is for purposes other than disease diagnosis and treatment.