Programmable transduction amplification reaction for circRNA detection, fluorescent biosensor and application thereof
By binding the split coding transduction probes BP1 and BP2 to circRNA, a complete coding transduction probe BP is formed. Then, it is circularized with the padlock probe PP to generate long-chain DNA. The signal is amplified by using DNA-binding dye and nicking endonuclease, which solves the problems of amplification efficiency and specificity in circRNA detection and provides a detection solution with high sensitivity and low cost.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-12
- Publication Date
- 2026-04-03
AI Technical Summary
In existing circRNA detection methods, RCA amplification efficiency is affected by excessively long template length and complex secondary structure, and the reliance on single-time base pairing leads to limited detection specificity.
The split coding transduction probes BP1 and BP2 bind to the reverse splice site of circRNA, and the complete coding transduction probe BP is formed by SplintR ligase. The probe is then circularized with the padlock probe PP, and a long single-stranded DNA amplification product is generated using DNA polymerase. The signal is amplified by DNA binding dye and nicking endonuclease.
It improves the sensitivity and specificity of circRNA detection, provides a multifunctional detection framework, avoids non-specific hybridization background signals, reduces detection costs, and does not require complex instruments, thus adapting to different detection needs.
Smart Images

Figure CN121780700A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a programmable transduction amplification reaction (PTA) for circRNA detection, a fluorescent biosensor, and their applications. Background Technology
[0002] Circular RNA (circRNA) is a covalently closed circular single-stranded RNA formed through backsplicing. circRNA can directly sponge miRNAs to isolate mRNAs via miRNA response elements and act as RNA-binding protein (RBP) scaffolds to regulate gene transcription and translation. Compared to linear biomarkers such as messenger RNA (mRNA) and microRNA (miRNA), circRNA has a significantly longer half-life. Multiple clinical cohort studies have shown that circRNA, as a biomarker, has certain application value in the early diagnosis and prognosis of cancer.
[0003] Due to varying clinical purposes, current methods for detecting circRNAs differ. Researchers commonly use RNA-seq to discover or screen novel circRNA biomarkers. RNA-seq can reveal the actual structure of circRNAs, facilitating further transcriptome analysis. While this method is highly accurate, low-abundance circRNAs may be overlooked in common RNA-seq analyses. Furthermore, its high cost and stringent requirements for skilled personnel and platforms make it difficult to use as a routine clinical detection method for known circRNA disease targets. In addition, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the most commonly used method for detecting specific circRNAs. By designing primers that cross the backsplicing linker (BSJ) to amplify the reverse transcription product, this method offers high sensitivity, ease of operation, and cost-effectiveness, and has become the gold standard for circRNA detection. However, linear RNA generated by endogenous transsplicing can lead to false positive signals in RT-qPCR.
[0004] As an alternative to thermal cycling-based qPCR, which requires complex analytical procedures and instruments, numerous isothermal assays have been developed to advance circRNA detection. Rolling circle amplification (RCA) is a simple and efficient isothermal enzymatic process in which a single primer extends along a circular template under the catalysis of polymerase, generating a long single-stranded DNA product. Therefore, target recognition is often coupled with primer or circular template formation to construct highly sensitive and specific isothermal amplification rapid detection methods. RCA has also been extensively studied in the targeted detection of circRNA. The circular structure of circRNA can serve as a natural template for initiating RCA, and it can be directly amplified under the action of reverse transcriptase and primers. However, when circRNA itself is used as a circular template for RCA, its length is too long and its secondary structure is complex, resulting in low amplification efficiency. In addition, the product obtained by amplifying circRNA itself as a circular template has the characteristic of being complementary to the target sequence, making it impossible to customize the sequence encoding according to experimental needs. As another more universal method, a user-designed independent programmable padlock probe (of appropriate length) is circularized through a circRNA-guided ligation reaction, followed by RCA triggered by an independent primer. This method also includes a target-independent programmable sequence region, facilitating signal amplification and the output after amplification. However, in such methods, the padlock probe's recognition of the target relies solely on a single base pairing, and this single-coding characteristic results in limited specificity. Summary of the Invention
[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a programmable transduction amplification reaction (PTA), a fluorescent biosensor and its application for circRNA detection, to solve a series of problems in current RCA-based circRNA detection, such as: limited programmability; limited RCA amplification efficiency due to excessively long template length; or limited detection specificity due to template circularization guided by single base pairing.
[0006] To achieve the above and other related objectives, the first aspect of the present invention provides a programmable transduction amplification reaction (PTA) for circRNA detection, comprising a first component, a second component, and a third component;
[0007] The first component includes the split coding transduction probes BP1 and BP2, and the SplintR ligase;
[0008] The split coding transduction probes BP1 and BP2 target the upstream and downstream sequences of the back splice site (BSJ) of circRNA, respectively, and are ligated at the BSJ by the SplintR ligase to form a complete coding transduction probe BP.
[0009] The second component includes padlock probe PP, SplintR ligase, and DNA polymerase;
[0010] The padlock probe PP is engineered to include two module sequences: a connection region complementary to the complete coding transduction probe BP sequence, and a programmable functional region; the connection region is used to identify and combine the complete coding transduction probe BP to complete the signal input of the target sequence; the programmable functional region is used to functionalize the amplification product to achieve signal output and amplification;
[0011] The complete coding transduction probe BP serves as a foothold at both ends to mediate its binding with the padlock probe PP, and releases the BSJ sequence of circRNA through a strand displacement reaction; the padlock probe PP is circularized by SplintR ligase to form a rolling circle amplification (RCA) template, while the 3' end of the coding transduction probe BP can initiate the rolling circle amplification reaction under the action of DNA polymerase to generate long-chain DNA single-stranded amplification products.
[0012] The third component includes a DNA-binding dye, a nicking endonuclease, and a reporter probe.
[0013] The DNA single-strand amplification product can directly bind to DNA-binding dyes to generate a fluorescent signal; at the same time, the DNA single-strand amplification product binds to the reporter probe through the base complementary pairing principle, and the reporter probe is specifically cleaved by the action of a cleaving endonuclease to amplify the fluorescent signal.
[0014] In some embodiments, the nucleotide sequence of the split-encoding transduction probe BP1 is shown in SEQ ID NO.2.
[0015] In some embodiments, the nucleotide sequence of the split-encoding transduction probe BP2 is shown in SEQ ID NO.3.
[0016] In some embodiments, the first component further includes the nucleotide sequence of the BSJ sequence clip on the circRNA, such as SEQ ID NO.1.
[0017] In some embodiments, when the amplification product is directly bound to the DNA dye, i.e., when the DNA-binding dye directly binds to the PTA product to report the fluorescence signal, the independent padlock probe PP nucleotide sequence is as shown in SEQ ID NO.4.
[0018] In some embodiments, when signal amplification is achieved by nicking endonuclease (Nb.BbvCI)-mediated reporter probe specific cleavage, the independent padlock probe PP nucleotide sequence is as shown in SEQ ID NO.5, and the reporter probe nucleotide sequence is as shown in SEQ ID NO.6.
[0019] In some embodiments, the first component further includes at least one of the following: buffer, SplintR ligase.
[0020] In some embodiments, the third component further includes at least one of the following: buffer solution, SplintR ligase, deoxynucleoside triphosphates (dNTPs), and DNA polymerase. The deoxynucleoside triphosphates (dNTPs) include, but are not limited to, adenine deoxynucleotide (dATP), thymine deoxynucleotide (dTTP), cytosine deoxynucleotide (dCTP), and guanine deoxynucleotide (dGTP).
[0021] In some embodiments, the buffer is selected from at least one of SplintR Ligase Reaction Buffer and phi29 DNA Polymerase Reaction Buffer, but is not limited thereto. SplintR Ligase Reaction Buffer comprises the following components: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH=7.5; phi29 DNA Polymerase Reaction Buffer comprises the following components: 50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH=7.5.
[0022] In some embodiments, the SplintR ligase is selected from SplintR ligases, but is not limited thereto.
[0023] In some embodiments, the DNA polymerase is selected from phi29 DNA polymerase, but is not limited thereto.
[0024] In some embodiments, the reporter probe nucleotide is labeled with a fluorescent group and a quenching group, or the fluorescent group is selected from FAM, HEX, TET, ROX, TAMRA, JOE, Cy, etc., for example, at least one of 6-FAM, 6-HEX, 6-TET, 6-ROX, 6-TAMRA, 6-JOE, Cy3, Cy5, and the quenching group is selected from at least one of MGB, BHQ1, BHQ2, but is not limited thereto.
[0025] A second aspect of the present invention provides a method for constructing a fluorescent biosensor for circRNA detection using the programmable transduction amplification reaction (PTA) described in the first aspect, comprising the following steps: (1) Construct a ligation reaction system, incubate the split coding transduction probes BP1 and BP2 with the target circRNA, and form a complete coding transduction probe BP under the action of SplintR ligase; (2) The complete coding transduction probe BP is incubated with the padlock probe PP, with its two ends serving as footholds to mediate binding with PP, and the BSJ sequence of circRNA is released through strand displacement reaction; (3) SplintR ligase and DNA polymerase are added for incubation. SplintR ligase catalyzes the circularization of the nicked padlock probe to form a rolling circle amplification template. DNA polymerase catalyzes the RCA reaction initiated with the 3' end of the transduction probe BP as a primer to generate a long-chain DNA single-stranded product, thus constructing the fluorescent biosensor.
[0026] In some embodiments, the primer exchange reaction process in step (1) includes: the split coding transduction probes BP1 and BP2 are first incubated with the target circRNA, then the SplintR ligase is added, and incubation continues to obtain the complete coding transduction probe BP.
[0027] In some embodiments, in the ligation reaction system of step (1), the concentration of the split encoding transduction probe BP1 is 200 nM.
[0028] In some embodiments, in the ligation reaction system of step (1), the concentration of the split encoding transduction probe BP2 is 200 nM.
[0029] In some embodiments, the incubation temperature in the connection reaction system of step (1) is 37°C.
[0030] In some embodiments, in step (1), the split-encoding transduction probes BP1 and BP1 are mixed with circRNA and SplintR ligase and incubated for 60 min.
[0031] In some embodiments, the concentration of the padlock probe PP in the reaction system of step (2) is 300 nM.
[0032] In some embodiments, step (2) further includes: the complete coded transduction probe BP and the padlock probe PP are incubated together, with the annealing temperature preferably being 95 °C and the annealing time preferably being 5 min.
[0033] In some embodiments, in step (3), the incubation temperature is 37 °C and the incubation time is 0.5 h.
[0034] In some embodiments, in step (3), the concentration of the SplintR ligase is 0.3125 units / μl. Here, units / μl is abbreviated as u / μl.
[0035] In some embodiments, in step (3), the concentration of the DNA polymerase is 0.2 units / μl. Here, units / μl is abbreviated as u / μl.
[0036] A third aspect of the present invention provides a fluorescent biosensor for circRNA detection constructed according to the method described in the second aspect, based on a programmable transduction amplification reaction.
[0037] A fourth aspect of the present invention provides a method for detecting circRNA, employing the reaction described in the first aspect and / or the fluorescent biosensor described in the third aspect.
[0038] The fifth aspect of the present invention provides the reaction described in the first aspect, and / or the method described in the second aspect, and / or the application of the fluorescent biosensor described in the third aspect in the preparation of circRNA detection reagents.
[0039] As described above, the programmable transduction amplification reaction, fluorescent biosensor, and their applications for circRNA detection of the present invention have the following beneficial effects:
[0040] This invention proposes a fluorescent biosensor with programmable transduction capability, which targets circRNA and is constructed based on programmable transduction amplification reaction (PTA). It provides a promising new method for the detection of clinical samples and has good detection performance. It has certain potential application value in circRNA detection and other scenarios that use isothermal amplification reactions.
[0041] (1) This invention combines encoding transduction probes with rolling circle amplification (RoBA). The encoding transduction probes can simultaneously encode information about circular RNA targets and padlock probes, and can also enhance target recognition specificity through template ligation and circularization mediated by dual base pairing. Utilizing the programmable nature of the template, by encoding the padlock probes, the single-stranded DNA products generated by the reaction can bind to dyes to generate signals or bind to nicking endonucleases, and mediate reporter probe-specific cleavage to achieve cyclic signal amplification. This modular integration strategy can provide detection solutions to meet different needs, has picomolar sensitivity, and establishes a multifunctional framework for precision molecular diagnostics.
[0042] (2) Compared with other isothermal amplification, the sequence design of the present invention is simple. The split coding transduction probes BP1 and BP2 avoid the high background signal caused by non-specific hybridization. Furthermore, the infinitely extended DNA strand of RCA can allow more dyes or reporter probes to bind, thus solving the problem of low sensitivity in current isothermal amplification.
[0043] (3) Compared with the existing gold standard RT-qPCR for detecting cicrRNA, the detection method based on the present invention does not require complex instruments and equipment, does not require reverse transcription, and the process of detecting cicrRNA is carried out only under isothermal conditions at 37°C. Attached Figure Description
[0044] Figure 1 This is a schematic diagram of the programmable transduction amplification reaction (PTA) and fluorescent biosensor used for circRNA detection in this invention.
[0045] Figure 2 Figure 1 shows the feasibility results of the PTA ligation reaction, and Figure 2 shows the results of gel electrophoresis characterization of the ligation reaction (a, b).
[0046] Figure 3 The diagram shows the feasibility results of the PTA chain substitution reaction, and the results obtained by gel electrophoresis characterization of the ligation reaction (a, b, c).
[0047] Figure 4 The diagram shows the feasibility results of the PTA reaction, and the results obtained by gel electrophoresis characterization of PTA.
[0048] Figure 5 To illustrate the establishment process of the PTA system, Figure (a) represents the fluorescence amplification curves of the PTA reaction under conditions with and without a target and other limiting factors; Figure (b) represents the amplification kinetics curves of PTA for different target concentrations; Figure (c) represents the linear relationship between fluorescence intensity and target concentration; Figure (d) is a schematic diagram comparing three detection methods: (i) RT-RCA; (ii) Padlock-RCA; (iii) PTA; Figure (e) represents the comparison of fluorescence signal kinetics between RT-RCA and PTA; Figure (f) represents the comparison of specificity between Padlock-RCA and PTA.
[0049] Figure 6 The diagram shows the feasibility of the PTA-N reaction, and the results are obtained from gel electrophoresis characterization of PTA-N.
[0050] Figure 7 The diagram shows the feasibility results of the PTA-N reaction, representing the fluorescence spectrum of the PTA-N reaction with and without a target and other limiting conditions;
[0051] Figure 8To optimize the connection reaction conditions, Figure a shows the optimization of BP1 and BP2 concentrations, and Figure b shows the optimization of connection time.
[0052] Figure 9 Figure 1 shows the optimization of RCA reaction conditions, where Figure a represents the optimization of PP concentration and SplintR ligase concentration. Figure c represents the optimization of Phi29 polymerase concentration, and Figure d represents the optimization of RCA reaction time.
[0053] Figure 10 To optimize the concentration of Nb.BbvCI enzyme.
[0054] Figure 11 To verify the detection range and specificity of PTA-N, Figure a shows the fluorescence response curves of PTA-N to different target concentrations, Figure b shows the linear relationship between fluorescence intensity and target concentration (10 pM-200 nM), and Figure c shows the specificity analysis of PTA-N. Detailed Implementation
[0055] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0056] In this invention, unless otherwise stated, the term "a plurality of" means two or more.
[0057] The character " / " indicates that the objects before and after it are in an "or" relationship. For example, A / B means: A or B.
[0058] The term "and / or" describes an association between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or A and B.
[0059] In addition, unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or prepared by existing methods. Example
[0060] I. Experimental Materials
[0061] 6× loading buffer, 50-200bp DNA Marker, dATP, dTTP, dCTP, dGTP, and all oligonucleotides purified by HPLC were purchased from Sangon Biotech (Shanghai, China). 6× loading buffer and 20-200bp DNA Marker were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). AugeGreen (20X in water) was purchased from US Everbright Biotechnology Co., Ltd. (Suzhou, China). SplintR ligase and Phi29 DNA polymerase were purchased from New England Biolabs (Beijing, China). Deionized water (≥18 MΩ, Millipore Bedford, MA, USA) was used in all experiments.
[0062] The nucleotide sequences involved in this invention are shown in Tables 1 and 2.
[0063] Table 1. List of DNA nucleotide sequences involved in the PTA reaction system DNA Sequence from 5' to 3' BSJ Sequences of circRNA CTCAACAGACAACCAGCAACACCGTGACAG SEQ ID NO.1 Bridge Transducer Probe1 (BP1) P-TGGTTGTCTGTTGCCTACTG SEQ ID NO.2 Bridge Transducer Probe2 (BP2) GTCACGAGTCACGGTGTTGC SEQ ID NO.3 PP (Augegreen) P-GCAACACCGTGACTCGTGACCGTCGCCGTCCAGCTCGACCCAGTAGGCAACAGACAACCA SEQ ID NO.4 PP(Nb.BbvCI) P-GCAACACCGTGACTCGTGACTGCTGAGGTGCGTGCTGAGGTCAGTAGGCAACAGACAACCA SEQ ID NO.5 Probe(Nb.BbvCI) CY5-TTGCTGAGGTCC-MGB SEQ ID NO.6
[0064] II. Experimental Instruments Fluorescence spectra were measured using an F-4700 (Hitachi, Japan) fluorescence spectrophotometer (Hitachi, Japan) and a quantitative PCR instrument (Thermo Fisher, USA). Natural polyacrylamide gel electrophoresis (PAGE) was performed on an electrophoresis apparatus (Bio-Rad, USA), and image analysis was performed using a Chemi-Doc XRS system (Bio-Rad, USA).
[0065] III. Experimental Procedure 1. Construct a fluorescence sensor for detecting circRNA based on programmable transduction amplification (PTA) reaction.
[0066] 1.1 Technical Principles:
[0067] like Figure 1 As shown, firstly, in order to identify different circRNAs, based on the programmability of nucleic acids, split-encoding transduction probes BP1 and BP2 were designed according to the circRNA sequence.
[0068] When the target is present, the BSJ sequence of the target binds to BP1 and BP2. Under the action of SplintR Ligase, the 5'-P of BP1 binds to the 3'-OH of BP2, generating the complete encoding transduction probe BP. Subsequently, the padlock probe PP is added, and BP binds to PP according to the complementary base pairing principle.
[0069] Then, under the action of Phi29 polymerase, a linear single-stranded DNA was generated using RCA. This single-stranded DNA was composed of repeating short DNA sequences.
[0070] When the generated single-stranded DNA binds to DNA dye, it can directly produce a fluorescent signal.
[0071] When the generated single-stranded DNA binds to the reporter probe, which is modified with fluorescent and quenching groups, it is cleaved by Nb.BbvCI upon binding to the single-stranded DNA in the orbital, generating a fluorescent signal.
[0072] However, in the absence of a target, BP1 and BP2 exist independently without fluorescence signal.
[0073] 1.2 Preparation process:
[0074] (1) Construct a linkage reaction system to obtain the BP1-BP2-target complex.
[0075] Take SplintR ligase buffer (0.6 μL, 10×), BP1, BP2 (2 μL, 10 μM), and target (2 μL), heat at 80℃ for 5 min, then rapidly cool to room temperature. Next, add SplintR ligase (0.5 μL), SplintR Ligase Buffer (0.4 μL, 10×), and 2.5 μL of DEPC water to a total volume of 10 μL. Incubate at 37℃ for 1 h, then heat to 70℃ for 20 min to inactivate the enzyme. The obtained product is used for the next reaction.
[0076] (2) Constructing the PTA system.
[0077] 10 μL of BP1-BP2-target was conjugated with PP(PTA) (10 μL, 3 μM). After the reaction, 4 μL of the mixture was added to an RCA detection system containing 2 μL of 10× Phi29 buffer, 0.25 μL of SplintR ligase, 0.4 μL of Phi29 DNA polymerase, 0.2 μL of BSA, 2 μL of dNTPs, 1 μL of 20× AugeGreen dye, and 10.15 μL of DEPC water, for a total volume of 20 μL. The RCA reaction was performed in a qPCR instrument at 37°C for 80 minutes, with fluorescence data monitored every 1 minute.
[0078] (3) Constructing the PTA-N system
[0079] 10 μL of BP1-BP2-target was conjugated with PP(PTA-N) (10 μL, 3 μM). After the reaction, 4 μL of the mixture was added to an RCA detection system containing 2 μL of 10× phi29 buffer, 0.25 μL of SplintR ligase, 0.4 μL of phi29 DNA polymerase, 0.2 μL of BSA, 2 μL of dNTPs, and 7.15 μL of DEPC water. After incubating the RCA reaction at 37°C for 30 minutes, 1 μL of Nb.BbvCI enzyme, 2 μL of rCutSmart™ buffer, and 1 μL of probe (50 μM) were added. The mixture was thoroughly mixed and incubated at 37°C for another hour, after which the fluorescence intensity was measured.
[0080] 1.3 Fluorescence Detection
[0081] Add 20 μL of the above reactants to 80 μL of LDPPC water, mix well, and then add to a quartz cuvette. Measure using a fluorescence spectrophotometer, specifically including the following steps:
[0082] Fluorescent cuvette cleaning: Immerse the fluorescent cuvette in alcohol and then rinse with DEPC water; Parameter settings: Set the excitation wavelength to 520nm, the emission wavelength range to 490-600nm, and the voltage to 650V; Zeroing: Add DEPC water to the fluorescent cuvette for zeroing; Detection: Add the reaction solution to the fluorescent cuvette and click detect to obtain the fluorescence signal.
[0083] 2. Verify the feasibility of the PTA system:
[0084] 2.1 The feasibility of the linkage reaction in the PTA system was verified using PAGE, and the results are as follows: Figure 2 As shown.
[0085] Among them, Figure 2 In lane a: Lane Marker is a 20 bp-500 bp DNA Marker; Lane 1 is a DNA Marker; Lane 2 is BP1; Lane 3 is BP2; Lane 4 is the target; Lane 5 is BP1 + BP2 + target.
[0086] from Figure 2 As can be seen: the bands shown in lane 5 indicate that when the target is present, BP1 and BP2 can bind to the target to form the BP1-BP2-target complex.
[0087] To verify whether the ligation products of BP1 and BP2 can form a complete BP, denaturing PAGE was used for verification, and the results are as follows. Figure 2 In lane b: lane markers are 20 bp-500 bp DNA markers; lane 1 is a DNA marker; lane 2 is BP1; lane 3 is BP2; lane 4 is the target; lane 5 is BP; lane 6 is BP1 + BP2 + target.
[0088] from Figure 2 b. As can be seen, the new band shown in lane 6 is located in the same position as BP, indicating that the connection reaction can form a complete BP.
[0089] 2.2 The displacement reaction in the PTA system was verified using PAGE, and the results are as follows: Figure 3 As shown in a, b, and c:
[0090] Figure 3 In lane a: lane markers are 20 bp-500 bp DNA markers; lane 1 is a DNA marker; lane 2 is BP1; lane 3 is the target; lane 4 is PP; lane 5 is BP1 + target; lane 6 is BP1 + PP; lane 7 is BP1 + target; lane 8 is BP1 + PP.
[0091] Figure 3 In lane b: lane markers are 20 bp-500 bp DNA markers; lane 1 is a DNA marker; lane 2 is BP2; lane 3 is the target; lane 4 is PP; lane 5 is BP2 + target; lane 6 is BP2 + PP; lane 7 is BP2 + target; lane 8 is BP2 + PP.
[0092] Figure 3In lane c: lane markers are 20 bp-500 bp DNA markers; lane 1 is a DNA marker; lane 2 is BP; lane 3 is the target; lane 4 is PP; lane 5 is BP + target; lane 6 is BP + PP; lane 7 is BP2 + target; lane 8 is BP + PP.
[0093] from Figure 3 As can be seen in lanes a, b, and c: the position of the new product shown in lane 8 is consistent with that in lane 6, indicating that PP can displace the target to facilitate the next reaction. Its position is consistent with BP, indicating that the linkage reaction can form a complete BP.
[0094] 2.3 The feasibility of the PTA system was verified using denaturing PAGE, and the results are as follows: Figure 4 As shown:
[0095] Lane markers are 20 bp-500 bp DNA markers; Lane 1 is a DNA marker; Lane 2 is BP1; Lane 3 is BP2; Lane 4 is the target; Lane 5 is BP; Lane 6 is PP; Lane 7 is BP1 + BP2 + target; Lane 8 is BP1 + BP2 + target + PP; Lane 9 is BP1 + BP2 + PP; Lane 10 is BP + PP; Lane 11 is a PTA reaction with the addition of target; Lane 12 is a PTA reaction without the addition of target; Lane 13 is a PTA reaction with the addition of BP.
[0096] from Figure 4 It is evident that significant rolling circle amplification only occurs when the target is present (lane 11) or a pre-formed complete BP is present (lane 13). In contrast, no detectable amplification products were observed when the target was absent (lane 12). These results demonstrate that the PTA reaction proceeds according to the expected mechanism.
[0097] 2.4 Analysis of the fluorescence amplification curves of the PTA reaction under conditions with and without a target and other limiting factors ( Figure 5 a) The results showed that a significant fluorescence signal was only generated in the presence of the target, effectively eliminating non-specific interference caused by other reaction conditions.
[0098] 3. Validation of PTA's detection range
[0099] After demonstrating its feasibility, the detection range of PTA was verified using different concentrations of target. The results showed that the detection range of PTA was 50 pM to 200 nM. Figure 5 b) The linear regression equation is ΔRFU = 96.23C + 233.10, with a correlation coefficient (R²) of 0.880. The limit of detection is 3.71 pM. Figure 5 c).
[0100] 4. Comparison with classic RT-RCA and Padlock-RCA ( Figure 5 d), the results show that the signal strength generated by RT-RCA is significantly lower than that of PTA ( Figure 5 e) Regarding specificity assessment, while Padlock-RCA can achieve strong signal amplification, its specificity is limited in distinguishing homologous linear RNAs. In contrast, PTA exhibits superior discrimination ability, accurately identifying targets even in the presence of two or more mismatches. Figure 5 f).
[0101] 5. Verify the feasibility of the PTA-N system.
[0102] 5.1 The feasibility of the PTA system was verified using denaturing PAGE, and the results are as follows: Figure 6 As shown:
[0103] Lane markers are 20 bp-500 bp DNA markers; Lane 1 is a DNA marker; Lane 2 is BP1; Lane 3 is BP2; Lane 4 is target; Lane 5 is BP; Lane 6 is PP; Lane 7 is BP1 + BP2 + target; Lane 8 is BP1 + BP2 + target + PP; Lane 9 is BP1 + BP2 + PP; Lane 10 is BP + PP; Lane 11 is PTA-N reaction with the addition of target; Lane 12 is PTA-N reaction with no addition of target; Lane 13 is PTA-N reaction with the addition of BP.
[0104] from Figure 6 It is evident that significant rolling circle amplification only occurs when the target is present (lane 11) or a pre-formed complete BP is present (lane 13). In contrast, no detectable amplification products were observed when the target was absent (lane 12). These results demonstrate that the PTA reaction proceeds according to the expected mechanism.
[0105] 5.2 Analysis of the fluorescence spectra of the PTA-N reaction under target-free and other limiting conditions ( Figure 7 The results showed that significant fluorescence signals were only generated in the presence of the target, and PTA-N had a significantly higher signal-to-noise ratio (S / N = 9.46) compared to PTA (S / N = 1.66).
[0106] 6. Optimization of PTA-N system conditions:
[0107] After confirming the feasibility of PTA-N, the next step is to optimize the PTA-N conditions. The concentrations of BP1 and BP2 are adjusted sequentially (…). Figure 8 a) The reaction time of the connection step ( Figure 8 b) Concentration of PP ( Figure 9 a) Concentration of SplintR ligase ( Figure 9 b) Concentration of Phi29 polymerase ( Figure 9 c) RCA reaction time ( Figure 9 d) and Nb.BbvCI enzyme concentration ( Figure 10 The reaction was optimized. As shown in the results, considering both reagent and time costs, the optimal reaction conditions were 200 nM, 60 min, 300 nM, 0.3125 U / μL, 0.2 U / μL, 30 min, and 0.2 U / μL, respectively, with the increase of the concentration of each component and the reaction time.
[0108] 7. Validation of the detection range and specificity of PTA-N
[0109] After obtaining optimal reaction conditions, the detection range of PTA-N was verified using different concentrations of target. The results showed that the detection range of PTA was 50 pM to 200 nM. Figure 11 a) The linear regression equation is ΔRFU = 264.50C - 164.35, R² = 0.967. The limit of detection is 1.06 pM. Figure 11 b). Subsequently, specificity verification showed that, compared to the PTA method, the use of the Nb.BbvCI enzyme, which can specifically recognize programmable amplification products, further improved the specificity of PTA-N and effectively suppressed background signals (b). Figure 11 c).
[0110] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.
Claims
1. A programmable transduction amplification reaction (PTA) for circRNA detection, characterized in that, It includes the first component, the second component, and the third component; The first component includes split coding transduction probes BP1 and BP2 and SplintR ligase; The split coding transduction probes BP1 and BP2 target the upstream and downstream sequences of the back splice site (BSJ) of circRNA, respectively, and are ligated at the BSJ by the SplintR ligase to form a complete coding transduction probe BP. The second component includes padlock probe PP, SplintR ligase, and DNA polymerase; The padlock probe PP is engineered to include two module sequences: a connection region complementary to the complete coding transduction probe BP sequence, and a programmable functional region; the connection region is used to identify and combine the complete coding transduction probe BP to complete the signal input of the target sequence; the programmable functional region is used to functionalize the amplification product to achieve signal output and amplification; The complete coding transduction probe BP serves as a foothold at both ends to mediate its binding with the padlock probe PP, and releases the BSJ sequence of circRNA through a strand displacement reaction; the padlock probe PP is circularized by SplintR ligase to form a rolling circle amplification (RCA) template, while the 3' end of the complete coding transduction probe BP can initiate the rolling circle amplification reaction under the action of DNA polymerase to generate long-chain DNA single-stranded amplification products. The third component includes a DNA-binding dye, a nicking endonuclease, and a reporter probe. The DNA single-strand amplification product can directly bind to DNA-binding dyes to generate a fluorescent signal; at the same time, the DNA single-strand amplification product binds to the reporter probe through the base complementary pairing principle, and the reporter probe is specifically cleaved by the action of a cleaving endonuclease to amplify the fluorescent signal.
2. The programmable transduction amplification reaction (PTA) for circRNA detection according to claim 1, characterized in that: The nucleotide sequence of the split-encoding transduction probe BP1 is shown in SEQ ID NO.2; And / or, the nucleotide sequence of the split-encoding transduction probe BP2 is shown in SEQ ID NO.3; And / or, the first component further includes the nucleotide sequence of the BSJ sequence on the circRNA as shown in SEQ ID NO.
1.
3. The programmable transduction amplification reaction (PTA) for circRNA detection according to claim 1, characterized in that: When the amplification product binds directly to the DNA dye, i.e., when the reporter fluorescence signal is generated by the direct binding of the DNA-binding dye (Augegreen) to the PTA product, the nucleotide sequence of the padlock probe PP is shown in SEQ ID NO.4; And / or, when signal amplification is achieved by reporter probe-specific cleavage mediated by nicking endonuclease (Nb.BbvCI), the padlock probe PP nucleotide sequence is as shown in SEQ ID NO.5, and the reporter probe nucleotide sequence is as shown in SEQ ID NO.
6.
4. The programmable transduction amplification reaction (PTA) for circRNA detection according to claim 1, characterized in that: The first component further includes at least one of the following: a ligation reaction buffer; And / or, the second component further includes at least one of the following: polymerization reaction buffer, deoxynucleoside triphosphate; And / or, the reporting probes in the third component are labeled with fluorescent groups and quenching groups, respectively.
5. A method for constructing a fluorescent biosensor for circRNA detection based on a programmable transduction amplification reaction using the reaction described in any one of claims 1 to 4, characterized in that, Includes the following steps: (1) Construct a ligation reaction system, incubate the split coding transduction probes BP1 and BP2 with the target circRNA, and form a complete coding transduction probe BP under the action of SplintR ligase; (2) The complete coding transduction probe BP is incubated with the padlock probe PP, with its two ends serving as footholds to mediate binding with PP, and the BSJ sequence of circRNA is released through strand displacement reaction; (3) SplintR ligase and DNA polymerase are added for incubation. SplintR ligase catalyzes the circularization of the padlock probe PP to form a rolling circle amplification template. DNA polymerase catalyzes the initiation of the RCA reaction with the 3' end encoding the transduction probe BP as a primer to generate a long-chain DNA single-stranded product. (4) Add DNA-binding dye to bind with DNA single-strand amplification products to construct the fluorescent biosensor; in addition, add nicking endonuclease and specific reporter probe to bind with DNA single-strand amplification products, and use the nicking endonuclease to specifically cleave the reporter probe to construct the fluorescent biosensor.
6. The method according to claim 5, characterized in that: The ligation reaction process in step (1) includes: the split-encoding transduction probes BP1 and BP2 recognize and bind to the BSJ sequence of the circRNA, and BP1 and BP2 are ligated by SplintR ligase to form a complete encoding transduction probe BP; And / or, in the ligation reaction system of step (1), the split coding transduction probe BP1 is 200 nM, the split coding transduction probe BP2 is 200 nM, and the SplintR ligase concentration is 0.625 U / μL; And / or, in the reaction system of step (2), the concentration of the independent padlock probe PP is 300 nM; And / or, in the reaction system of step (3), the concentration of SplintR ligase is 0.3125 U / μL, and the concentration of DNA polymerase is 0.2 U / μL; And / or, in the reaction system of step (4), the DNA dye is 1 μM, the nicking endonuclease concentration is 0.4 U / μL, and the reporter probe concentration is 50 μM.
7. A fluorescent biosensor for circRNA detection based on a programmable transduction amplification reaction, constructed according to any one of claims 5 to 6.
8. A method for detecting circRNA, characterized in that: The reaction described in any one of claims 1 to 4 is used, and / or the fluorescent biosensor described in claim 7 is used.
9. The reaction according to any one of claims 1 to 4, and / or the method according to claims 5 to 6, and / or the use of the fluorescent biosensor according to claim 7 in the preparation of circRNA detection reagents.