Probe for detecting gastric cancer RNF180 gene methylation by using nuclear track membrane electrochemical biosensor and application of probe

Abstract

The invention discloses a probe for detecting gastric cancer RNF180 gene methylation through a nuclear track membrane electrochemical biosensor and application of the probe, and belongs to the technical field of biomolecule detection. The probe adopts a three-section structural design, comprises a 5 '-terminal amino modification region, a spacer region and a core recognition region, and realizes cooperation and unification of specific recognition, membrane surface stable fixation and isothermal amplification functions. A nuclear track membrane electrochemical biosensor constructed based on the probe integrates an LAMP isothermal amplification technology to form a probe fixation-isothermal amplification-in-situ capture-electrochemical detection integrated detection system, and has the advantages of high specificity, high sensitivity, simplicity and convenience; the method can effectively solve the problems that a traditional detection technology is complex in operation, depends on professional equipment, and is insufficient in specificity and sensitivity, is suitable for stomach cancer early-stage noninvasive screening, bedside diagnosis and large-scale population screening, and provides an innovative and reliable technical scheme for stomach cancer early-stage diagnosis.

Description

Technical Field

[0001] This invention belongs to the field of biomolecular detection technology, specifically relating to a probe for detecting RNF180 gene methylation in gastric cancer using a nuclear pore membrane electrochemical biosensor and its application, suitable for early non-invasive screening, bedside diagnosis and large-scale population screening of gastric cancer. Background Technology

[0002] Gastric cancer (GC) is a complex and heterogeneous disease, currently the fifth most common malignant tumor worldwide and the third leading cause of cancer-related deaths. Its high mortality rate stems primarily from the fact that over 80% of patients are diagnosed at an advanced stage, making early diagnosis crucial for improving patient prognosis and increasing five-year survival rates. Currently, endoscopic combined with pathological diagnosis is the gold standard for gastric cancer diagnosis, but its widespread application is limited by two factors: firstly, it heavily relies on the professional competence of the examiner; and secondly, patients generally have low acceptance of invasive procedures. Although serum tumor markers such as carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9), and carbohydrate antigen 72-4 (CA72-4) are widely used clinically, their specificity and sensitivity in the early diagnosis of gastric cancer are significantly insufficient, with sensitivity for early-stage gastric cancer often ranging from 20% to 47%.

[0003] DNA methylation, as a crucial mechanism of epigenetic regulation, has shown great potential in the field of early tumor diagnosis. DNA methylation refers to the process by which DNA methyltransferases add methyl groups to cytosine in CpG sequences. When abnormally high methylation occurs in the promoter region of a gene, its expression is often silenced. Methylation of the ring finger protein 180 (RNF180) gene exhibits highly specific and sensitive changes in gastric cancer and precancerous lesions, making it an important potential molecular marker. RNF180 itself is a tumor suppressor gene; methylation of its promoter region leads to transcriptional silencing, causing it to lose its regulatory function on abnormal cell proliferation, thereby participating in the carcinogenesis of gastric mucosal cells. Studies have shown that elevated RNF180 gene methylation levels can be detected in precancerous gastric lesions, such as atrophic gastritis and intestinal metaplasia, and this epigenetic change precedes morphological changes in tumors, providing a key molecular target for ultra-early warning and diagnosis of gastric cancer.

[0004] However, current mainstream detection technologies for RNF180 gene methylation, such as methylation-specific polymerase chain reaction (MSP) and quantitative real-time methylation-specific PCR (qMSP), still have limitations such as complex operation procedures, long detection cycles, reliance on specialized laboratory equipment, and high costs, making it difficult to meet the urgent needs of rapid clinical testing, point-of-care diagnosis, and large-scale population screening. Therefore, developing a RNF180 gene methylation detection technology that combines high specificity, high sensitivity, speed, and convenience has become key to breaking through the bottleneck in the early diagnosis of gastric cancer.

[0005] Biosensor technology is a novel analytical technique that integrates biorecognition elements and physicochemical signal conversion devices, offering significant advantages such as fast response, ease of operation, low sample requirements, and real-time detection. Combining biosensor technology with RNF180 gene methylation detection, by designing biorecognition elements that specifically identify RNF180 methylation CpG sites and coupling them with a high-sensitivity signal conversion system, a novel detection platform is expected to be constructed. Nuclear pore membranes, as a novel material with nanoscale pore structures, possess characteristics such as large specific surface area, uniform pore size, and good biocompatibility, providing an ideal carrier for the immobilization of biorecognition elements and significantly improving recognition efficiency and detection sensitivity. This invention, based on a nuclear pore membrane electrochemical biosensor, designs a specific recognition probe and integrates loop-mediated isothermal amplification (LAMP) technology to achieve efficient, rapid, and accurate detection of RNF180 gene methylation, providing an innovative technical solution for the early diagnosis of gastric cancer. Summary of the Invention

[0006] The purpose of this invention is to provide a probe for detecting RNF180 gene methylation in gastric cancer using a nuclear pore membrane electrochemical biosensor. This probe addresses the problems of insufficient specificity, limited functionality, and loss of activity after immobilization of traditional probes, and achieves synergistic effects in specific recognition, membrane pore immobilization stability, and amplification function.

[0007] Another objective of this invention is to provide a nuclear pore membrane electrochemical biosensor and detection method based on the above-mentioned probe, constructing an integrated detection system of "probe immobilization-isothermal amplification-in-situ capture-electrochemical detection", improving the convenience, sensitivity and stability of detection, and meeting the needs of point-of-care testing (POCT) for early gastric cancer and large-scale population screening.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] (1) Design of specific capture probes

[0010] Based on the methylation characteristics of the RNF180 gene promoter, the complete sequence of the RNF180 gene (Gene ID: 285671, Chr5: 64165351-64372869) and annotation information were obtained from the NCBI database. MethPrimer software was used to predict that the methylation site Chr5: 64165680-64165936 is a high-methylation region. This region contains multiple consecutive CG sites and no single nucleotide polymorphisms (SNPs), ensuring the specificity of the detection. The probe adopts a three-segment structure design, as shown in SEQ ID NO. 12, 5'-NH2-(CH2)6-TTTTT-GGGCGTTACGTTCGAGGTC-3', which balances specific recognition, membrane surface immobilization ability, and isothermal amplification function. The design of each region is as follows:

[0011] 5' Amino Modification Region: The amino group (-NH2) connected by the 6-carbon linker (-(CH2)6-) can be stably covalently bound to the activated carboxyl group in the PET core pore membrane channel through amide bonds, avoiding probe aggregation caused by short linkers;

[0012] Spacer region: Consists of 4-6 consecutive thymine bases (T... n Composed of n=4-6), this invention selects 5 T as the spacer region, which can keep the core recognition region away from the surface of the nuclear pore membrane, effectively avoiding the interference of membrane surface charge on enzyme binding and primer extension during the subsequent LAMP isothermal amplification process, and ensuring that the amplification reaction is carried out efficiently.

[0013] The core recognition region is a specific nucleotide sequence of 19 bp, as shown in SEQ ID NO.3, 5'-GGGCGTTACGTTCGAGGTC-3', which is completely complementary to the core CpG island of the RNF180 gene promoter (GenBank accession number: NC_000005.10, Chr5: nucleotides 64165752-64165770). It contains three consecutive CG methylation sites at nucleotides 64165755-64165756, 64165760-64165761, and 64165764-64165765 of Chr5, respectively. It also functions as the forward external primer F3 in the LAMP isothermal amplification system, realizing the integration of "amplification-recognition" and simplifying the detection process.

[0014] (2) Preparation of functionalized nuclear pore membranes

[0015] The preparation of functionalized nuclear pore membranes includes steps such as reagent preparation, nuclear pore membrane activation, probe coating, sealing, and cleaning and drying, as detailed below:

[0016] A. Reagent preparation:

[0017] Solution A: Prepare 0.02-0.05M 2-morpholinoethanesulfonic acid (MES) buffer to dissolve 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) to a concentration of 0.5-0.8 mg / mL. Adjust the pH to 5.5-6.0, mix thoroughly, and pour into a coating device for later use to activate the carboxyl groups on the surface of the nuclear pore membrane.

[0018] Solution B: Add the designed amino-recognition probe to phosphate-buffered saline (PBS), adjust the pH to 7.4-7.6, mix well, and store in a refrigerator at 2-8℃ for later use to ensure the stability of the probe, which is used for covalent binding of the probe to the nuclear pore membrane.

[0019] Solution C: Add glycine to TE (Tris-EDTA) buffer, adjust the pH to 7.4-7.6, mix well, and store in a refrigerator at 2-8℃ for later use. This solution is used to block the active sites on the surface of nuclear pore membranes that have not been bound to probes.

[0020] Solution D: Add NaCl and Tween-20 to 1×TE buffer, dissolve completely, adjust pH to 7.2-7.5, mix well, and store in a refrigerator at 2-8℃ for later use. This solution is used to clean unbound probes and impurities from the surface of nuclear pore membranes.

[0021] B. Nuclear pore membrane activation: Fix the etched nuclear pore membrane in the coating device, ensuring that the nuclear pore membrane is completely immersed in solution A and that there are no air bubbles on the surface. Place the coating device on a transfer decolorizing shaker and activate it continuously at 25-30℃ for 0.5-2 hours with an oscillation frequency of 1-3 seconds / cycle to fully activate the carboxyl groups on the surface of the nuclear pore membrane.

[0022] C. Probe Coating: After activation, pour out solution A from the coating device, wash the coating device and nuclear pore membrane twice with 1×PBS solution, then pour in solution B, ensuring that the nuclear pore membrane is completely immersed and there are no air bubbles on the surface. Place the coating device on a transfer decolorization shaker and continue coating for 4-6 hours at an oscillation frequency of 2-5 s / cycle, so that the probe covalently binds to the carboxyl groups on the surface of the nuclear pore membrane through amide bonds.

[0023] D. Sealing treatment: After coating, pour out solution B, wash twice with 1×TE solution, pour in solution C, ensure that the nuclear pore membrane is completely immersed and there are no air bubbles on the surface, and shake on a transfer decolorizing shaker at an oscillation frequency of 1-3 s / cycle for 10-60 min. Then place the coating device in a refrigerator at 2-8℃ for 6-18 h to seal the active sites of unbound probes and reduce non-specific binding.

[0024] E. Cleaning and drying: After sealing, pour out solution C, add 100-300mL of solution D, and clean with an oscillation frequency of 1-3s / cycle for 1-5min. Repeat the cleaning 2-3 times. The cleaning is considered complete when the pH of the solution after cleaning is 7.2-7.5. Take out the nuclear pore membrane, spread it flat on a culture dish, and dry it in a 40-60℃ forced-air drying oven for 1-2h. Remove the uncoated parts at the edges to obtain the functionalized nuclear pore membrane.

[0025] (3) Assembly of nuclear pore membrane electrochemical biosensors

[0026] The sensor is assembled from a functionalized nucleopore membrane, an H-type electrolytic cell, an electrode assembly, and a constant temperature control module, as follows:

[0027] The functionalized nucleopore membrane was cut into a 2×2cm square, fixed in the central spacer of the H-type electrolytic cell, and clamped with a polytetrafluoroethylene sealing ring to ensure that the left and right chambers are sealed and leak-free.

[0028] PBS with pH 7.4-7.6 was injected into the left detection chamber and the right buffer chamber of the H-type electrolyzer as electrolyte, with a volume of 5-10 mL. The electrolyte level was ensured to be 1-2 mm above the edge of the nuclear pore membrane to ensure the stability of electrochemical signal transmission.

[0029] Install the Ag / AgCl electrodes in the electrolyte in the two chambers respectively, ensuring that the electrodes are in full contact with the electrolyte, and connect the electrode leads to the electrochemical workstation;

[0030] The assembled H-type electrolytic cell is placed in a constant temperature water bath oscillator to form a constant temperature control module, which is used to regulate the temperature and oscillation rate of the LAMP amplification reaction.

[0031] (4) Detection method for RNF180 gene methylation

[0032] The above-mentioned nuclear pore membrane electrochemical biosensor was used to detect RNF180 gene methylation. The detection method included standard pretreatment, LAMP isothermal amplification, in situ capture, and electrochemical detection. The specific steps are as follows:

[0033] A. Design and synthesize LAMP-related primers: serial number sequence name SEQ ID NO.3 GGGCGTTACGTTCGAGGTC F3 primer SEQ ID NO.7 TACCTACAACCCCGACCCCGGTAGGGTCGTTGGTTGTGG FIP primers SEQ ID NO.8 TAGTTCGAGCGTTTTTCGCGGGGACGACGACGATACCGATTC BIP primers SEQ ID NO.9 GGGTGGGAATTCGTAGACG B3 primer SEQ ID NO.10 GACCTCGAACGTAACGCCC LOOP F primer SEQ ID NO.11 TTTTGTCGTTTTTCGTTTCGTC LOOP B primer

[0034] B. Standard pretreatment: Take 20-100 μL of standard, add 20-100 μL of 10×Bst buffer and 160-800 μL of 1×PBS solution, shake to mix evenly in EP tube, and then heat in a 90-95℃ water bath for 3-10 min to denature the DNA of the standard.

[0035] C. LAMP isothermal amplification: Inject the prepared standard solution into the left detection chamber of the H-type electrolytic cell, and simultaneously add the LAMP amplification reaction system (total system 20-50 μL). The components and final concentrations are as follows: 10×LAMP buffer 2-3 μL, dNTPs mixture 0.8-1.2 mmol / L, MgSO4 solution 3-6 mmol / L, B3 primer (10 μmol / L) 0.5-2 μL, FIP primer (40 μmol / L) 0.5-2 μL, BIP primer (40 μmol / L) 0.5-2 μL, LOOP F primer (40 μmol / L) 0.5-2 μL, LOOP B primer (40 μmol / L) 0.5-2 μL, Bst DNA Add polymerase at 0.08-0.16 U / μL, and supplement the remainder with enzyme-free ultrapure water; adjust the oscillation rate of the constant temperature water bath shaker to 40-80 rpm, set the temperature to 60-67℃, and amplify at this temperature for 10-40 min.

[0036] D. In-situ capture: After the amplification reaction is completed, stop oscillation and continue incubation at 55℃ for 10-30 min to allow the amplification product to specifically bind to the specific probe fixed on the functionalized nuclear pore membrane, forming a "nuclear pore membrane-probe-amplification product" complex. This leads to changes in the charge distribution within the pores, increases electron migration resistance, and achieves signal amplification.

[0037] E. Electrochemical detection: Insert the electrode and connect it to the electrochemical workstation. Use cyclic voltammetry for detection. Set the upper limit voltage to 1V, the lower limit voltage to -1V, the starting voltage to 0V, the scan rate to 100mV / s, and the number of cycles to 5. Record the current values ​​at 1V and -1V. Subtract the baseline current value to obtain the current change ΔI. Attached Figure Description

[0038] Figure 1 A schematic diagram of an electrochemical biosensor for detecting RNF180 gene methylation in gastric cancer.

[0039] Figure 2 melting curve of candidate probes in real-time PCR

[0040] Figure 3 Cyclic voltammetric response of target DNA methylated by different concentrations of RNF180

[0041] Figure 4 Standard curve of relative change in RNF180 methylation target concentration versus current

[0042] Figure 5 Repeatability detection using the biosensor of this invention

[0043] Figure 6Stability detection using the biosensor of this invention

[0044] Figure 7 Specificity of the biosensor of the present invention Detailed Implementation

[0045] The present invention will now be described in further detail with reference to embodiments, so that those skilled in the art can implement it based on the description. It should be understood that terms such as "having," "comprising," and "including" as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used in the following examples are commercially available unless otherwise specified; for examples where specific conditions are not specified, they are conducted under conventional conditions or conditions recommended by the manufacturer; and for reagents or instruments whose manufacturers are not specified, they are all conventional products that can be purchased commercially.

[0047] Example 1

[0048] A probe design for detecting RNF180 gene methylation in gastric cancer using a nuclear pore membrane electrochemical biosensor includes the following steps:

[0049] (1) Target region screening

[0050] First, the complete sequence of the RNF180 gene was retrieved from the NCBI database to obtain the gene ID (Gene ID: 285671, Chr5: 64165351-64372869) and annotation information. Then, the promoter region genome sequence was retrieved from the database, and the methylation sites were predicted using MethPrimer software to screen out fragments with a high concentration of methylation sites (Chr5: 64165680-64165936).

[0051] (2) Probe sequence design

[0052] Based on the complementary sequence of the core target region, six candidate probes containing consecutive hypermethylation sites were designed. These probes were synthesized by a professional biotechnology company, purified using the high-efficiency salting-out (HAP) method, and their purity was verified by mass spectrometry to be ≥98%. The specific sequences are as follows: serial number sequence Location SEQ ID NO.1 GGTCGGGGTTGTAGGTATAGTTC Chr5: 64165775-64165797 SEQ ID NO.2 CCAACAACCAAACTCTAAAAACTC Chr5: 64165874-64165897 SEQ ID NO.3 GGGCGTTACGTTCGAGGTC Chr5: 64165752-64165770 SEQ ID NO.4 CTCTAAAAACTCGCTACGACTCC Chr5: 64165863-64165885 SEQ ID NO.5 GTTCGGGTGGGAATTCGTAGA Chr5: 64165689-64165709 SEQ ID NO.6 GATTCGACGAAACGAAAAACGA Chr5: 64165826-64165847

[0053] (3) Preliminary PCR screening: The six candidate probes were preliminarily screened using quantitative real-time PCR to exclude probes with non-specific binding and low amplification efficiency.

[0054] ① Experimental system (25μL): 2.5μL 10×PCR buffer, 2μL 2.5mmol / L dNTPs, 1μL 10μmol / L probe, 0.2μL 5U / μL Taq DNA polymerase, 2μL RNF180 methylated DNA template, 1μL 5×SYBR Green I fluorescent dye, and sterile deionized water to 25μL;

[0055] ② Reaction program: 4 min at 95℃; 2.5 min at 62-68℃; 1 min at 72℃, for a total of 40 cycles; followed by melting curve analysis: 15 s at 95℃, 1 min at 60℃, then the temperature was increased to 95℃ at a rate of 0.8℃ / s, while fluorescence signals were continuously collected.

[0056] ③ Screening results: such as Figure 2 As shown, the amplification curves of SEQ ID NO.3 and SEQ ID NO.4 probes exhibit a single sharp melting peak with a Tm value of 84.93℃, indicating good amplification specificity and high efficiency. SEQ ID NO.1 and SEQ ID NO.2 probes did not show a melting peak, indicating that specific amplification was not possible and the sensitivity was low. SEQ ID NO.5 and SEQ ID NO.6 probes showed mixed peaks and low fluorescence signal intensity, suggesting non-specific amplification and insufficient amplification efficiency. Therefore, the forward probe SEQ ID NO.3, a 19bp fragment (Chr5: nucleotides 64165752-64165770) containing three methylation sites (positions 64165755-64165756, 64165760-64165761, and 64165764-64165765), was selected as the target probe for subsequent experiments.

[0057] (4) Probe synthesis: The target probe sequence was introduced with a 6-carbon linker arm, amino modification and spacer region at the 5' end and submitted to Shanghai Sangon Biotech Co., Ltd. for synthesis. The purification method was high performance liquid chromatography (HPLC) and the purity was verified by mass spectrometry to be ≥98%. The synthesized probe was dissolved in 0.01mol / L PBS pH7.4 to prepare a 100μmol / L stock solution, which was aliquoted and stored at -20℃ for later use.

[0058] Example 2

[0059] (1) Reagent preparation:

[0060] ① Weigh 0.39g MES, add 100mL of purified water, dissolve completely, then add 5mL of 10mg / mL EDC solution, adjust the pH to 5.5, mix thoroughly to form solution A, and pour into the coating device for later use;

[0061] ② Take 100 mL of 1xPBS solution, add 1 μL of 100 μmol / L probe solution, adjust the pH to 7.4, mix well to form solution B, and store in a refrigerator at 2-8℃ for later use.

[0062] ③ Weigh 3.75g of glycine, add 100ml of 1xTE solution, adjust the pH to 7.5, mix well to form solution C, and store in a refrigerator at 2-8℃ for later use;

[0063] ④ Weigh 1.74g NaCl and 100μL Tween-20, add 200 mL of 1xTE solution, and after complete dissolution, adjust the pH to 7.2. Mix well to form solution D, and store in a refrigerator at 2-8℃ for later use.

[0064] (2) The preparation steps of functionalized nuclear pore membranes are as follows:

[0065] ① Place the porous membrane in anhydrous ethanol and ultrasonically clean it (300W) for 5 minutes to remove impurities remaining on the membrane surface from the factory. Then transfer it to deionized water and ultrasonically clean it for 3 minutes to remove ethanol residue. Finally, place the membrane in an oven at 60℃ and dry it for 2 hours to avoid deformation of the membrane structure due to high temperature. Store it for later use after drying.

[0066] ② Fix the nuclear pore membrane in the coating device, ensuring that the nuclear pore membrane is completely immersed in the solution and that there are no air bubbles on the surface. Place the coating device on a transfer decolorization shaker and activate it for 1 hour at an oscillation frequency of 2 seconds per cycle.

[0067] ③ After activation, pour out all of solution A from the coating tank, wash the coating device and nuclear pore membrane twice with 1xPBS solution, then pour solution B into the coating device, ensuring that the nuclear pore membrane is completely immersed in the solution and there are no air bubbles on the surface. Then place the coating device on a transfer decolorization shaker and continue coating for 4 hours with an oscillation frequency of 2s / cycle.

[0068] ④ After coating is completed, pour out all solution B in the coating tank, wash the coating device and nuclear pore membrane twice with 1xTE solution, then pour solution C into the coating device, ensuring that the nuclear pore membrane is completely immersed in the solution and there are no air bubbles on the surface. Then place the coating device on a transfer decolorization shaker and shake at an oscillation frequency of 2s / cycle for 30min. After that, place the coating device in a refrigerator at 2-8℃ and seal it overnight for 18h.

[0069] ⑤ After sealing, pour out all solution C from the coating tank, take 100 mL of solution D and pour it into the coating tank. Wash with an oscillation frequency of 2 s / cycle for 1 min, and wash 2-3 times. The washing is considered complete when the pH of the solution after washing is 7.2.

[0070] ⑥ After cleaning, remove the nuclear pore membrane from the coating device, spread it flat on a culture dish, and place it in a forced-air drying oven at 40°C for 1 hour to remove the uncoated parts at the edges, thus obtaining the functionalized nuclear pore membrane.

[0071] Example 3

[0072] (1) The establishment of the standard curve is carried out in the following steps:

[0073] ① Cut the functionalized nuclear pore membrane into a 2x2 cm square. Take one of the cut nuclear pore membranes as the diaphragm of the dual-cell electrolytic cell. Use 1xPBS solution as the electrolyte. Use two Ag / AgCl electrodes as the anode and cathode of the electrolytic cell. Connect the anode to the working electrode clamp of the electrochemical workstation and connect the cathode to the counter electrode and reference electrode clamp to assemble the electrolytic cell for testing.

[0074] ② Use the cyclic voltammetry method to monitor the current response of the system. Set the upper limit voltage to 1V, the lower limit voltage to -1V, the starting voltage to 0V, the scan rate to 100mV / s, and the number of cycles to 5. Start the test.

[0075] ③ Record the current values ​​at 1V and -1V as I0, which serves as the baseline;

[0076] ④ Dilute the RNF180 methylated target DNA standard with 1×PBS, using a dilution gradient of 10. 3 copies / mL, 10 4 copies / mL, 10 5 copies / mL, 10 6 copies / mL, 10 7 Take 100 μL of each sample and add 100 μL of 10×Bst buffer and 800 μL of 1×PBS solution. Mix the samples thoroughly by shaking in a sample tube and then heat in a water bath at 90-95℃ for 10 min.

[0077] ⑤ After heating, inject the methylated target DNA standard into the left chamber of the H-type electrolytic cell containing the functionalized nuclear pore membrane, and simultaneously add the LAMP amplification reaction system (total system 25 μL). The components and final concentrations are as follows: 10×LAMP buffer 2.5 μL, dNTPs mixture (10 mmol / L) 2 μL, MgSO4 solution (50 mmol / L) 1.5 μL, B3 primer (10 μmol / L) 0.5 μL, FIP primer (40 μmol / L) 2 μL, BIP primer (40 μmol / L) 2 μL, LOOP F primer (40 μmol / L) 2 μL, LOOP B primer (40 μmol / L) 2 μL, Bst DNA polymerase (8 U / μL) 0.5 μL, and the remainder is supplemented with enzyme-free ultrapure water; adjust the oscillation speed of the constant temperature water bath shaker to 50 rpm, set the temperature to 65℃, and amplify at this temperature for 20 min.

[0078] ⑥ After the amplification reaction is completed, set the temperature of the constant temperature water bath shaker to 55℃, continue incubation for 30 minutes, adjust the voltage, and use the cyclic voltammetry method to prepare for testing;

[0079] ⑦ Perform the test using the test parameters from step 2;

[0080] ⑧ Record the current values ​​at 1V and -1V as I1, and calculate ΔI;

[0081] ⑨ Based on the current value of the sensor, a standard curve was plotted to establish a linear relationship between ΔI and the target concentration. The concentration of RNF180 gene methylation was calculated using the ΔI value of the test standard.

[0082] (2) Experimental results:

[0083] The results are as follows Figure 3 As shown, with the gradual increase in target concentration, the binding with the capture probe increases, and the steric hindrance within the nanochannel further increases, resulting in a decrease in electron mobility and thus a reduction in current. The detection of the target analyte was achieved by calculating the relative change rate of current before and after the addition of the standard in the electrochemical workstation, and a standard curve was plotted with the horizontal and vertical axes representing the relative change in concentration and current, respectively. Figure 4 Linear regression analysis yielded the regression equation: y = 24lgx + 28.3923, with a correlation coefficient R0. 2 =0.9727.

[0084] Example 4

[0085] (1) Stability

[0086] To evaluate the sensor's performance, a concentration of 10 was selected. 5Using a standard sample of [copies / mL] as the test sample, the nuclear pore membrane was measured five times under the same experimental conditions using the same sensor, with each measurement 30 minutes apart. The response current value was recorded for each measurement, and the current response values ​​are shown below. Figure 5 As shown, the coefficient of variation (CV) of the current response value is ≤0.5%, indicating that the sensor has excellent detection repeatability. Further evaluation of the sensor's storage stability was conducted by storing the prepared sensor at 4℃ and removing it on days 1, 2, 3, 7, and 14. The sensor was then subjected to 10 tests under the same conditions. 5 Copies / mL of standard were used to detect the current response. Results are as follows: Figure 6 As shown, after 7 days of storage, the sensor still maintains 98.01% of its initial response current, indicating that the sensor has excellent long-term storage stability and reliability at 4℃.

[0087] (2) Specificity

[0088] To investigate the specificity of this detection method for RNF180 gene methylation, 10 methylation genes from colorectal cancer and lung cancer were used. 5 Using a standard solution of [copies / mL] as a control, the experiment was conducted according to the above detection method, and the results are as follows: Figure 7 As shown, under the same concentration conditions, the relative changes in current corresponding to each interfering substance were 5 μA and 15 μA, respectively; while when the target substance was RNF180, the relative change in current significantly increased to 60 μA, with a cross-reactivity rate ≤5%. The above data clearly demonstrate that the sensor and detection method described in this invention exhibit high specificity in recognizing the RNF180 methylation gene, effectively distinguishing the target substance from other methylation sites, and possessing good anti-interference performance.

[0089] The above description is merely the preferred embodiment of the present invention and is not intended to limit the spirit and principles of the present invention. Any modifications, equivalent substitutions, improvements, etc., made should be included within the protection scope of the present invention.

Claims

1. A probe for detecting methylation of the RNF180 gene in gastric cancer using a nuclear pore membrane electrochemical biosensor, characterized in that, The probe has a three-segment structure and also functions as the forward external primer F3 of the LAMP isothermal amplification system. It includes a 5' amino-modified region, a spacer region, and a core recognition region, specifically as shown in SEQ ID NO.12, which is 5'-NH2-(CH2)6-TTTTT-GGGCGTTACGTTCGAGGTC-3'. The 5' end amino-modified region is composed of an amino group and a 6-carbon linker covalently connected. The amino group can be stably covalently bonded to the carboxyl group activated by EDC in the pores of the PET nuclear pore membrane through an amide bond, thereby achieving the fixation and high-density arrangement of the probe on the surface of the nuclear pore membrane. The spacer region consists of 4-6 consecutive thymine bases, which can keep the core recognition region away from the nuclear pore membrane surface, effectively avoiding the spatial steric hindrance and charge interference of membrane surface charge on enzyme-primer binding and amplification extension during LAMP isothermal amplification, thus ensuring the specificity and efficiency of the amplification reaction. The core recognition region is a 19 bp nucleotide with the sequence 5'-GGGCGTTACGTTCGAGGTC-3' as shown in SEQ ID NO.

3. This sequence also functions as the forward external primer F3 in the LAMP isothermal amplification system. The core recognition region is completely complementary to the core CpG island of the RNF180 gene promoter. The GenBank accession number of the core CpG island is NC_000005.

10. The sequence is located at nucleotides 64165752-64165770 of Chr5 and contains three consecutive CG methylation sites located at positions 64165755-64165756, 64165760-64165761, and 64165764-64165765 of Chr5, respectively.

2. The application of the probe for detecting RNF180 gene methylation in gastric cancer using a nuclear pore membrane electrochemical biosensor according to claim 1, characterized in that, The LAMP isothermal amplification system contains 6 specific primers, the sequences, functions, and design principles of which are as follows: The FIP primers of the amplification system, as shown in SEQ ID NO.7, are 5'-TACCTACAACCCCGACCCCGGTAGGGTCGTTGGTTGTGG-3'. The FIP primers are composed of the F1c sequence 5'-TACCTACAACCCCGACCCCGG-3' and the F2 sequence 5'-TAGGGTCGTTGGTTGTGG-3' linked by a phosphodiester bond. The F1c sequence is complementary to the 3' end region of the target DNA single strand, and the F2 sequence is complementary to the inner region of the target DNA single strand. They specifically bind to the single-stranded DNA released from the target DNA and initiate the internal extension process of the amplification reaction. The BIP primers of the amplification system, as shown in SEQ ID NO.8, are 5'-TAGTTCGAGCGTTTTTCGCGGG-GACGACGACGATACCGATTC-3'. The BIP primers consist of the B1c sequence 5'-TAGTTCGAGCGTTTTTCGCGGG-3' and the B2 sequence 5'-GACGACGACGATACCGATTC-3'. The B1c sequence is complementary to the 3' end region of the target DNA complementary strand, and the B2 sequence is complementary to the inner region of the target DNA complementary strand. This allows for specific binding to the target DNA complementary strand, assisting in the formation of the stem-loop structure required for the amplification reaction and ensuring the efficient execution of the amplification reaction. The F3 primer of the amplification system is the core recognition region SEQ ID NO.3 of the probe of claim 1. The F3 primer acts as a forward external primer, specifically binding to the target DNA and initiating the initial step of the amplification reaction. The B3 primer of the amplification system, as shown in SEQ ID NO.9, is 5'-GGGTGGGAATTCGTAGACG-3'. The B3 primer acts as a reverse external primer, specifically binding to the complementary strand of the target DNA, guiding the synthesis of double-stranded DNA, and promoting the efficient initiation of the amplification reaction. The LOOP F primer of the amplification system, as shown in SEQ ID NO.10, is 5'-GACCTCGAACGTAACGCCC-3'. The LOOP F primer is designed for the loop region of the stem-loop structure formed during the amplification of the target DNA. It can specifically bind to the positive loop region of the stem-loop structure, accelerate the exponential amplification phase of the LAMP reaction, and shorten the amplification time. The LOOP B primer of the amplification system, as shown in SEQ ID NO.11, is 5'-TTTTGTCGTTTTTCGTTTCGTC-3'. The LOOP B primer is designed for the reverse loop region of the stem-loop structure formed during the amplification of the target DNA. It can specifically bind to the reverse loop region of the stem-loop structure and work synergistically with the LOOP F primer to further improve the exponential amplification efficiency.

3. The application of the probe for detecting RNF180 gene methylation in gastric cancer using a nuclear pore membrane electrochemical biosensor according to claim 1, characterized in that, The sensor consists of a functionalized nucleopore membrane, an H-type electrolyzer, an electrode assembly, and a constant temperature control module. These components work together to achieve an integrated process of target immobilization, LAMP amplification, and electrochemical signal capture and detection, as detailed below: The functionalized nuclear pore membrane is formed by bombarding polyethylene terephthalate (PET) target material with heavy ions to create nuclear tracks, followed by UV photosensitization and chemical etching processes to create a nanoporous structure with uniform pore size and density. After EDC activation, the probe described in claim 1 is oriented and fixed to the inner wall of the nuclear pore membrane pores via amide bonds, forming a high-density specific recognition interface that can specifically capture RNF180 methylated target DNA and its amplification products. The functionalized nuclear pore membrane has a pore size of 100-200 nm and a pore density of 102. 8 -10 11 pcs / cm 2 Activation temperature 25-30℃, EDC concentration 0.5-0.8 mg / mL; The H-shaped electrolyzer has an overall H-shaped symmetrical structure, divided into two independent buffer chambers, each with a volume of 5-10 mL. Both chambers are filled with pH 7.4- A 7.6% phosphate buffer solution is used as the electrolyte, with a volume of 5-10 mL, which can ensure the stability and uniformity of electrochemical signal transmission. The functionalized nucleopore membrane is clamped between the two chambers by a polytetrafluoroethylene sealing ring to ensure that the chambers are sealed and leak-free, while also facilitating the rapid replacement of the functionalized nucleopore membrane. The electrode assembly consists of two Ag / AgCl electrodes, which are installed in the left and right chambers respectively, to capture electrochemical signals and convert them into detectable current data. The constant temperature control module is a constant temperature water bath oscillator, which can regulate the reaction temperature in the H-type electrolytic cell and adjust the oscillation rate to 40-80 rpm, providing a stable constant temperature environment of 60-67℃ for the LAMP amplification reaction. It can efficiently amplify the RNF180 methylated gene target DNA within 10-40 minutes, ensuring amplification efficiency and specificity.

Images