SNP molecular marker, KASP primer, kit and method for detecting panax notoginseng ginsenoside Re content character
By developing SNP molecular markers and KASP primers for Panax notoginseng and using the SNP-14797854 locus for genotyping, the problem of identifying ginsenoside Re content in Panax notoginseng breeding was solved, and efficient variety selection and genetic improvement were achieved.
Patent Information
- Application Number
- CN202511857406.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-04-03
AI Technical Summary
Panax notoginseng has a mixed genetic background, rich genetic diversity, and a high degree of heterozygosity of single genes, which leads to low efficiency of traditional breeding methods and makes it difficult to achieve efficient variety selection, especially the accurate identification and improvement of ginsenoside Re content.
To develop an SNP molecular marker and KASP primers for detecting the content of ginsenoside Re in Panax notoginseng, to perform genotyping using the SNP-14797854 locus, to identify plants with high ginsenoside Re content using the KASP genotyping method, and to provide a kit and corresponding detection method.
This technology enables the accurate identification of Panax notoginseng plants with high ginsenoside Re content in the early stages of breeding, improving breeding selection efficiency, saving time and resources, and supporting the genetic improvement of Panax notoginseng varieties.
Smart Images

Figure CN121780741A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics and breeding technology, and specifically relates to an SNP molecular marker, KASP primer, kit, and method for detecting the content of ginsenoside Re in Panax notoginseng. Background Technology
[0002] Panax notoginseng (Burk.) FHChen is a perennial herb belonging to the genus Panax L. of the family Araliaceae. It is mainly produced in Wenshan Prefecture, Yunnan Province. Also known as Tianqi powder or Jinbuhuan, it is a precious traditional Chinese medicine, with the root used medicinally. Panax notoginseng is rich in saponins, polysaccharides, and flavonoids. Ginsenosides are the most important active ingredient in Panax notoginseng, and their content and types are important indicators for evaluating its quality. Studies have found that saponin sugar chain degradation or C-17 side chain changes produce rare ginsenosides with higher bioavailability and significant pharmacological activities, such as anti-tumor, hepatoprotective, and nervous system protective effects. Ginsenoside Re, a secondary saponin in Panax notoginseng, has received widespread attention in recent years. Research shows that ginsenoside Re has various pharmacological activities, with its core functions concentrated in cardiovascular protection, nerve regulation, anti-fatigue, and immune enhancement. It has already seen some applications in health products, functional foods, and adjuvant medicine.
[0003] Despite years of artificial cultivation, Panax notoginseng retains a mixed genetic background with rich genetic diversity. As a cross-pollinated plant, Panax notoginseng exhibits high heterozygosity of single genes, a complex genetic basis, and a long growth period, making pure-line breeding extremely difficult. Currently, Panax notoginseng variety selection primarily relies on group mixed selection, which is the main breeding technology currently meeting the needs of Panax notoginseng variety selection. Quality breeding is the core measure for selecting superior varieties, but traditional breeding methods have limitations in efficiency and accuracy. The emergence and application of high-throughput sequencing and genome association analysis (GWAS) have opened up new avenues for the genetic improvement and variety selection of Panax notoginseng. High-throughput sequencing technology can comprehensively analyze the genetic information of Panax notoginseng, revealing its genetic diversity and providing strong support for precision breeding.
[0004] With the continuous advancement of omics technologies, molecular genetic breeding of medicinal plants using molecular markers can significantly improve breeding efficiency and make molecular breeding targeting the enhancement of effective components in medicinal plants possible. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level, including base insertions and deletions, transversions, and transitions; it is the most common type of heritable variation. As a third-generation molecular marker, SNPs are widely used in molecular genetics, genome research, genetic breeding, and many other fields. Compared with other molecular markers, SNPs are widely distributed, genetically stable, and easy to genotype, making them very suitable for rapid interspecific identification. The content and types of saponins in Panax notoginseng are core objectives in Panax notoginseng variety selection. Therefore, by utilizing known saponin biosynthesis genes and abundant Panax notoginseng germplasm resources, we can identify SNPs significantly associated with ginsenoside content in Panax notoginseng, develop KASP molecular markers for assisted breeding, and achieve early molecular-assisted selection of target traits to improve breeding efficiency and accelerate the selection process of superior varieties. Summary of the Invention
[0005] To address the above problems, the purpose of this invention is to provide an SNP molecular marker, KASP primers, kit, and method for detecting the content of ginsenoside Re in Panax notoginseng.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A SNP molecular marker associated with the content of ginsenoside Re in Panax notoginseng, wherein the SNP molecular marker is SNP-14797854, located at position 14797854 on chromosome Chr9 of Panax notoginseng, and the allele at this locus is T or A.
[0007] Further preferred, the Panax notoginseng plants with the genotype TT at the SNP-14797854 locus have significantly higher ginsenoside Re content than plants with the genotype TA or AA.
[0008] This invention also provides a set of KASP genotyping primer pairs for detecting SNP molecular markers, characterized in that the primer pairs comprise: Upstream primer SNP-F: 5'-GAAGGTGACCAAGTTCATGCTTGACGTTGGGGCCGGACAT-3'; Upstream primer SNP-H: 5'-GAAGGTCGGAGTCAACGGATTTGACGTTGGGGCCGGACAA-3'; Downstream primer SNP-R: 5'-CTCCCTCCCCATCTCATTCCTGATT-3'.
[0009] The present invention also provides a kit for assisted breeding of Panax notoginseng ginsenoside Re content, comprising the aforementioned KASP genotyping primer pair.
[0010] This invention also provides a KASP genotyping method for detecting the content of ginsenoside Re in Panax notoginseng, comprising the following steps: S1. Obtain the genomic DNA of the Panax notoginseng sample to be tested; S2. Using the DNA obtained in step S1 as a template, perform PCR amplification using the KASP genotyping primer pair; S3. Detect the fluorescence signal of the PCR amplification product to determine the genotype of the SNP molecular marker site; S4. Based on the genotype, determine the potential content of ginsenoside Re in the Panax notoginseng sample.
[0011] More preferably, in step S4, if the genotype is TT, the Panax notoginseng sample is determined to have the potential for high anthropogenic saponin Re content; if the genotype is TA or AA, the Panax notoginseng sample is determined to have the potential for low anthropogenic saponin Re content.
[0012] More preferably, the PCR amplification reaction procedure in step S2 includes: first, a hot start at 95°C for 10 minutes; then, 10 cycles of landing PCR, each cycle including denaturation at 95°C for 20 seconds, and an annealing / extension step of 45 seconds starting at 61°C and decreasing by 0.6°C per cycle; finally, 40 cycles of conventional PCR, each cycle including denaturation at 95°C for 20 seconds and annealing / extension at 55°C for 40 seconds.
[0013] More preferably, the PCR amplification reaction system in step S2 is 2 μL, comprising: 1 μL of 2× KASP MasterMix, 1 μL of template DNA at a concentration of 10-50 ng / μL, and the upstream primers F and H and the downstream primer R as described in claim 3.
[0014] More preferably, in step S1, the genomic DNA is extracted using the CTAB method.
[0015] The present invention has the following beneficial effects: Firstly, the SNPs significantly associated with ginsenoside Re content in Panax notoginseng provided in this invention were obtained through association analysis of 173 natural Panax notoginseng populations. Using SNP loci as genotype data and ginsenoside Re content as phenotypic data, genome-wide association analysis (GWAS) was performed using EMMAX software with a mixed linear model (MLM). The SNP molecular marker SNP-14797854, located at base 14797854 on chromosome 1, provides technical support for marker-assisted breeding of the ginsenoside Re content trait in Panax notoginseng.
[0016] Secondly, the KASP primer combination developed in this invention can directly and specifically distinguish and detect the T or A bases at the mutation site of SNP-14797854. When using this KASP primer combination to identify the content of ginsenoside Re, the two genotypes can be clearly separated. In molecular marker SNP-14797854, the dot near the Y-axis indicates the AA allelic variant site, with genotype AA, and the ginsenoside Re content of Panax notoginseng with this genotype is relatively low; the dot near the X-axis indicates the TT allelic variant site, with genotype TT, and the ginsenoside Re content of Panax notoginseng with this genotype is relatively high. The KASP primer combination developed in this invention has good application value, enabling pre-selection and molecular-assisted breeding of the ginsenoside Re content trait in Panax notoginseng. It can accurately identify Panax notoginseng plants with high ginsenoside Re content in the early stages of breeding, thus avoiding elimination when undesirable traits are discovered later, greatly saving time and resources. It has important theoretical and practical guiding significance for the genetic improvement process of breeding for ginsenoside Re content in Panax notoginseng and improving breeding selection efficiency. Attached Figure Description
[0017] Figure 1 Manhattan and QQ-plots of GWAS results for ginsenoside Re in Panax notoginseng; Figure 2 A statistical graph showing the allelic variation and phenotypic significance of ginsenoside Re content in Panax notoginseng; Figure 3 Genotyping results of different Panax notoginseng samples using KASP-specific primers. Detailed Implementation
[0018] The following description, in conjunction with specific embodiments of the present invention, provides further details. It should be noted that these descriptions are intended to aid in understanding the invention but do not constitute a limitation thereof. Furthermore, the technical features described in the various embodiments of the invention below can be combined with each other as long as they do not conflict with each other.
[0019] Example 1 Nucleotide mutation sites (SNPs) related to the content of ginsenoside Re in Panax notoginseng were obtained. (1) DNA extraction and high-throughput sequencing: We collected 173 Panax notoginseng natural population materials, extracted genomic DNA using the CTAB method, and performed 10X whole-genome resequencing.
[0020] (2) Determination of ginsenoside Re content: After drying at 50℃, the sample was pulverized using a pulverizer and passed through a No. 4 sieve. 0.6 g of the sample was accurately weighed using an analytical balance and placed in a 50 ml Erlenmeyer flask. 50 ml of methanol was added, and the flask was weighed. The flask was sealed with sealing film, sonicated for 30 min, and then allowed to stand for 20 h. The sealing film was then removed, and the sample was weighed again. The weight lost due to evaporation was replenished with methanol, and the mixture was shaken well. The solution was then filtered through a 0.22 μm microporous membrane to obtain 1 ml of the sample solution. Ginsenoside Re was quantitatively analyzed using high-performance liquid chromatography (HPLC) with the external standard method. The chromatographic column was an Agilent ZORBAX SB-AQ (3.5µm, 4.6×150mm). The mobile phase consisted of ultrapure water (A) and acetonitrile (B), with the following gradient elution program: 0–20 min, 20%B; 20–55 min, 36%B; 55–60 min, 40%B; 60–70 min, 36–45%B; 70–79 min, 45–60%B; 79–80 min, 80%B; 80–81 min, 80%B; 81.5–83 min, 20%B. The flow rate was 0.5 mL / min, the column temperature was 30℃, and the injection volume was 10 µL. The detection wavelength was 203 nm. The compounds were identified based on their retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.
[0021] (3) Genome-wide association analysis (GWAS) Using SNP loci as genotypic data and ginsenoside Re content as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). The Manhattan plot and QQ-plot were obtained as shown below. Figure 1Using -log10(P)>6 as the threshold, the X-axis of the Manhattan plot represents each SNP on all chromosomes, and the Y-axis represents the P-value of each SNP. Different colors represent the 12 chromosomes of Panax notoginseng. SNPs above the horizontal line are selected as candidate significant SNP sites. The QQplot can infer the rationality of the model and the location of SNP sites by comparing the positions of predicted and observed values. Among them, the SNP molecular marker SNP-14797854, which is significantly associated with ginsenoside Re, is located at base 14797854 on chromosome 9. By comparing with the Panax notoginseng reference genome, the sequence allelic variation of SNPs was extracted, and combined with the ginsenoside Re content of the population material for joint analysis. SNP-14797854 has three genotypes: TT, AA, and TA. After using the T-test, it was found that the TT genotype has a higher content of ginsenoside Re, which is the dominant genotype. Figure 2 ).
[0022] The gene sequence containing 100 bp before and after the SNP-14797854 site is shown in SEQ ID NO.1: AGAGAGGCTGCAAATGCAGGCACCCATAACTGGAAGACATCGTAGATGATTAAATCAGGATTTACTGTATTTAGAATGTTGATGACGTTGGGGCCGGACA[T / a]ACCAAGGGCCTTGATCAAATCAGGAATGAGATGGGGAGGGAGACCTTTGGTTGTGTGATGGTGCGGCGGCAGCTCGGTTTGTGAAGTTAACTGGAATTCT(SEQ ID NO:1) Example 2 Development of SNP-labeled KASP-specific primers Using NCBI Primer The BLAST function was used to design three primers based on the sequence SEQ ID NO.1: upstream primer SNP-F, upstream primer SNP-H, and downstream primer SNP-R. SNP-F and SNP-H contain FAM and HEX fluorescent linker sequences (underlined), respectively, as shown below: SNP-F: 5'- GAAGGTGACCAAGTTCATGCTTGACGTTGGGGCCGGACAT -3'; SNP-H: 5'- GAAGGTCGGAGTCAACGGATTTGACGTTGGGGCCGGACAA -3'; SNP-R: 5'-CTCCCTCCCCCATCTCATTCCTGATT-3'.
[0023] Example 3 Genotyping of SNP loci in different Panax notoginseng samples and its application The authenticity of SNP-14797854 in the natural population of Panax notoginseng was verified using the high-throughput genotyping system GeneMatrix (GM). Genomic DNA was extracted from 94 randomly selected Panax notoginseng single plants. Using the genomic DNA as a template, PCR amplification was performed using the SNP marker KASP-specific primers developed in Example 2.
[0024] After diluting the sample DNA 5 times, transfer it to a 100 μL PCR plate, and add 2 positive controls and 2 NTCs to each plate.
[0025] The KASP reaction system consisted of 2 μL, including 1 μL of 2×Master Mix, 1 μL of 20 ng / μL sample DNA, and 0.01 μL of KASP primer mixture, comprising 0.002 μL of upstream primer 1 (100 μM), 0.002 μL of upstream primer 2 (100 μM), and 0.006 μL of universal primer (100 μM). An equal volume of double-distilled water was used instead of sample DNA in the negative control reaction. The DNA sample plate, primer mixture, and KASPmaster Mix were placed in the corresponding positions on the Arrayer. The 384*1 pipetting protocol was selected, and the DNA and primer mixture were added to the 384-well microplate via the MatrixArrayer. The device automatically constructed the reaction system and heat-sealed the reaction plate.
[0026] The PCR amplification program requires four stages: Stage 1 denaturation at 95°C for 10 min; Stage 2 denaturation at 95°C for 20 s followed by annealing at 61°C for 45 s, for a total of 10 cycles (each cycle decreasing by 0.6°C); Stage 3 denaturation at 95°C for 20 s followed by annealing at 55°C for 40 s, for a total of 40 cycles.
[0027] After PCR amplification, remove the reaction plate and allow it to cool to room temperature. If there is water on the surface, wipe it clean. Place the plate in a scanner for fluorescence scanning. Use a Matrix Scanner to read the fluorescence signal values and perform genotyping and clustering of the samples. In the molecular marker SNP-14797854, samples showing blue near the Y-axis are alleles linked to the HEX fluorescent tag sequence, i.e., carrying the AA allelic variant site, with genotype AA. The content of ginsenoside Re in Panax notoginseng with this genotype is relatively low. Samples showing red near the X-axis are alleles linked to the FAM fluorescent tag sequence, i.e., carrying the TT allelic variant site, with genotype TT. The content of ginsenoside Re in Panax notoginseng with this genotype is relatively high. Figure 3 ).
[0028] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.
Claims
1. A SNP molecular marker related to the content of ginsenoside Re in Panax notoginseng, characterized in that, The SNP molecular marker is SNP-14797854, located at position 14797854 on chromosome 7Chr9, with alleles of T or A at this locus.
2. The SNP molecular marker according to claim 1, characterized in that, The content of ginsenoside Re in Panax notoginseng plants with genotype TT at the SNP-14797854 locus was significantly higher than that in plants with genotype TA or AA.
3. A set of KASP genotyping primer pairs for detecting the SNP molecular marker of claim 1, characterized in that, The primer pair comprises: Upstream primer SNP-F: 5'-GAAGGTGACCAAGTTCATGCTTGACGTTGGGGCCGGACAT-3'; Upstream primer SNP-H: 5'-GAAGGTCGGAGTCAACGGATTTGACGTTGGGGCCGGACAA-3'; Downstream primer SNP-R: 5'-CTCCCTCCCCATCTCATTCCTGATT-3'.
4. A kit for assisted breeding of Panax notoginseng with ginsenoside Re content, characterized in that, It includes the KASP genotyping primer pair as described in claim 3.
5. A KASP genotyping method for detecting the content of ginsenoside Re in Panax notoginseng, characterized in that, Includes the following steps: S1. Obtain the genomic DNA of the Panax notoginseng sample to be tested; S2. Using the DNA obtained in step S1 as a template, perform PCR amplification using the KASP genotyping primer pair as described in claim 3 or 4. S3. Detect the fluorescence signal of the PCR amplification product to determine the genotype of the SNP molecular marker site; S4. Based on the genotype, determine the potential content of ginsenoside Re in the Panax notoginseng sample.
6. The method according to claim 5, characterized in that, In step S4, if the genotype is TT, the Panax notoginseng sample is determined to have the potential for high human parameter saponin Re content; if the genotype is TA or AA, the Panax notoginseng sample is determined to have the potential for low human parameter saponin Re content.
7. The method according to claim 5, characterized in that, The PCR amplification reaction procedure in step S2 includes: first, a hot start at 95°C for 10 minutes; then, 10 cycles of landing PCR, each cycle including denaturation at 95°C for 20 seconds, and an annealing / extension step of 45 seconds starting at 61°C and decreasing by 0.6°C per cycle; finally, 40 cycles of conventional PCR, each cycle including denaturation at 95°C for 20 seconds and annealing / extension at 55°C for 40 seconds.
8. The method according to claim 5, characterized in that, The PCR amplification reaction system described in step S2 is 2 μL, containing: 1 μL of 2× KASP Master Mix, 1 μL of template DNA with a concentration of 10-50 ng / μL, and the upstream primers F and H and the downstream primer R as described in claim 3.
9. The method according to claim 5, characterized in that, In step S1, the genomic DNA is extracted using the CTAB method.