Method for synchronously and quickly identifying ginseng and American ginseng based on dual high-resolution melting curve technology and application

Abstract

The invention discloses a method for synchronously and rapidly identifying ginseng and American ginseng based on a dual high-resolution melting curve technology and application, and belongs to the technical field of traditional Chinese medicine identification. The invention discloses a synchronous and rapid ginseng and American ginseng identification method based on a dual high-resolution melting curve technology, which comprises the following steps: screening a specific sequence based on a ginseng whole genome, and designing ginseng specific identification primers RS-F and RS-R and American ginseng specific identification primers XYS-F and XYS-R. The dual high-resolution melting curve technology Dual HRM can be effectively used for rapidly identifying the ginseng and American ginseng mixture, and compared with a traditional molecular identification method, the method saves time (lt); the method has the advantages of low cost, simple operation, strong specificity and high accuracy, can be efficiently applied to the identification work of ginseng and American ginseng, ensures the quality and medicinal value of ginseng and American ginseng, and provides guarantee for the medication safety and clinical curative effect of ginseng and American ginseng.

Description

Technical Field

[0001] This invention relates to the field of traditional Chinese medicine identification technology, and more specifically to a method and application for simultaneous rapid identification of ginseng and American ginseng based on dual high-resolution melting curve (Dual HRM) technology. Background Technology

[0002] Species in the genus *Panax* have high medicinal value and a long history. Due to their close kinship and extreme similarity in morphology and chemical composition, they have always been a key group for the identification and research of original medicinal plant species. Ginseng and American ginseng, as the most economically valuable and historically cultivated species in this genus, occupy an important position in traditional Chinese medicine and health products. In recent years, with the popularization of the concept of "medicine and food sharing the same origin" and the expansion of related health product markets, the demand for ginseng products has increased significantly, demonstrating huge market potential. However, due to the long growth cycle and high economic value of ginseng, the market is frequently flooded with inferior products and adulterated goods, seriously disrupting market order and hindering the sustainable development of the traditional Chinese medicine industry.

[0003] With the development of sequencing and bioinformatics analysis technologies, the whole-genome information of an increasing number of species has been deciphered. Supported by molecular biology, species-specific DNA sequences can be screened from massive amounts of genomic data, enabling accurate species differentiation. High-resolution melting curve (HRM) analysis, as a powerful tool combining simplicity, specificity, and high sensitivity, has further promoted the practical application of this technology. Therefore, screening for specific sequences from the whole genome and establishing efficient identification methods has significant research value and application implications.

[0004] Therefore, providing a method for simultaneous and rapid identification of ginseng and American ginseng based on dual high-resolution melting curve technology and its application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method and application for simultaneous rapid identification of ginseng and American ginseng based on dual high-resolution melting curve technology. By using mixed ginseng and American ginseng-specific identification primers, the mixed DNA of ginseng and American ginseng is simultaneously amplified, and the resulting amplification melting curve can simultaneously identify ginseng and American ginseng.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A specific primer for rapid identification of ginseng, comprising RS-F and RS-R; the nucleotide sequence of RS-F is shown in SEQ ID NO.1; the nucleotide sequence of RS-R is shown in SEQ ID NO.2.

[0007] Furthermore, a specific primer for rapid identification of American ginseng includes XYS-F and XYS-R; the nucleotide sequence of XYS-F is shown in SEQ ID NO.3; and the nucleotide sequence of XYS-R is shown in SEQ ID NO.4.

[0008] Furthermore, a detection kit containing specific primers for identifying ginseng and specific primers for identifying American ginseng is included.

[0009] Furthermore, the application of the aforementioned test kit in the simultaneous identification of ginseng and American ginseng.

[0010] Furthermore, a rapid identification method for ginseng and American ginseng based on high-resolution melting curve technology includes the following steps: Genomic DNA was extracted from the sample to be tested; using the genomic DNA as a template, HRM amplification was performed on the genomic DNA using the specific primers for ginseng and the specific primers for American ginseng, respectively. If the HRM melting curve shows a main peak at 78.2 ± 0.3 ℃, it indicates that the sample to be tested is ginseng; If the HRM melting curve shows a main peak at 73.3 ± 0.3℃, it indicates that the sample to be tested is American ginseng.

[0011] Furthermore, the reaction system for HRM amplification is as follows: 10 μL of 2 × SupRealQ Ultra Hunter SYBR qPCRMaster Mix U+, 0.4 μL each of 10 μM upstream and downstream primers, 1 μL of DNA template, and sterile double-distilled water to make up to 20 μL. The HRM amplification reaction program is as follows: 95 ℃ for 30 s; 95 ℃ for 8 s, 65 ℃ for 20 s, 35 cycles; starting from 60 ℃, the temperature is increased to 95 ℃ in 0.5 ℃ increments, and held for 5 s at each temperature step to generate a melting curve.

[0012] Furthermore, the aforementioned identification method is applied in the identification of ginseng and American ginseng.

[0013] Furthermore, a method for simultaneous and rapid identification of ginseng and American ginseng based on dual high-resolution melting curve technology includes the following steps: Extract genomic DNA from the sample to be tested; The genomic DNA was amplified using a mixture of ginseng-specific primers and American ginseng-specific primers via Dual HRM. If the Dual HRM melting curve shows a single peak at 78.2 ± 0.3 ℃, it indicates that the sample to be tested is ginseng; If the Dual HRM melting curve shows a single peak at 73.3 ± 0.3℃, it indicates that the sample to be tested is American ginseng; If the Dual HRM melting curve shows two peaks at 78.2 ± 0.3 ℃ and 73.3 ± 0.3 ℃, it indicates that the sample contains both ginseng and American ginseng.

[0014] Furthermore, the reaction system for the Dual HRM amplification is as follows: 10 μL of 2 × SupRealQ Ultra Hunter SYBRqPCR Master Mix U+, 0.3 μL each of 5 μM ginseng upstream and downstream primers, 0.4 μL each of 10 μM American ginseng upstream and downstream primers, 1 μL of mixed DNA template, and sterile double-distilled water to make up to 20 μL. The Dual HRM amplification reaction program is as follows: 95 ℃ for 30 s; 95 ℃ for 8 s, 65 ℃ for 20 s, for 35 cycles; starting from 60 ℃, the temperature is increased to 95 ℃ in 0.5 ℃ increments, and held for 5 s at each temperature step to generate a melting curve.

[0015] Furthermore, the aforementioned identification method is applied to the simultaneous identification of ginseng and American ginseng.

[0016] As can be seen from the above technical solution, compared with the prior art, this invention discloses a method and application for simultaneous rapid identification of ginseng and American ginseng based on dual high-resolution melting curve technology. This invention discloses a dual HRM-specific mixed primer that can simultaneously identify ginseng and American ginseng, providing a basis for ensuring the safety and standardization of clinical medication of ginseng and American ginseng. Specifically, it includes bioinformatics analysis based on the whole genome of the Panax genus, screening for specific sequences of ginseng and American ginseng, and designing ginseng-specific primers RS-F and RS-R and American ginseng-specific primers XYS-F and XYS-R. Using the mixed primers and the dual HRM identification method, ginseng and American ginseng can be rapidly and accurately identified simultaneously, establishing an accurate, sensitive, rapid, stable, and reproducible identification method. This invention identifies ginseng and American ginseng by the difference in melting curves detected in the dual HRM test. Then, the designed dual HRM was validated using 127 commercially available Panax genus herbal tea samples and 10 commercially available Panax genus traditional Chinese medicine samples to determine the identification efficiency of this technique. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0018] Figure 1 The image shows the PCR results specific to ginseng and American ginseng; where A: ginseng-specific PCR amplification; B: American ginseng-specific PCR amplification. M is the DL 2000 DNA marker; BC are blank controls; 1-5 are ginseng samples; and 6-10 are American ginseng samples.

[0019] Figure 2 For HRM identification of ginseng ( Pa. ginseng ) and American ginseng ( Pa. quinquefolius ( ), where A: HRM detection mixed solution system; B: HRM melting curve analysis of ginseng and American ginseng (template amount is 20 ng / µL); C: determination of detection sensitivity of ginseng HRM validation system; D: determination of detection sensitivity of American ginseng HRM validation system.

[0020] Figure 3 Dual HRM was used to identify a mixture of ginseng and American ginseng; where A: Dual HRM detection mixed solution system; B and C: ratio of ginseng and American ginseng primer mixture; D: determination of the detection sensitivity of Dual HRM for the mixture of ginseng and American ginseng at the optimal ratio of ginseng and American ginseng primer mixture (1.5 µM: 4 µM).

[0021] Figure 4 The images show the Dual HRM identification results of commercially available ginseng herbal tea samples and traditional Chinese medicine samples; where AB: Dual HRM identification results of commercially available ginseng herbal tea samples; CD: Dual HRM identification results of commercially available American ginseng herbal tea samples; E: Dual HRM identification results of commercially available ginseng traditional Chinese medicine samples. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Example 1: Obtaining and validating specific identification primers for ginseng and American ginseng. 1.1 Whole genome analysis of Panax ginseng Genome data for ginseng species were retrieved from the National Center for Biotechnology Information (NCBI) and the National Genomics Data Center (NGDC) using "Panax" as the keyword, and downloaded in FASTA format. Alternatively, relevant publications were searched in the PubMed database using "Panax, genome" as the keyword, and genome data were downloaded via links provided in the literature (Table 1). The nine obtained genome fragments were then divided into 25 bp segments to establish a short fragment database, resulting in (L-25+1)25-mers, where L represents the total genome length. A multi-step filtering strategy was then applied to the database: first, sequences with GC content between 35% and 65% were retained; second, the filtered sequences were compared with genomes of other ginseng species, and fragments exhibiting ≥4 nucleotide mismatches or ≥1 nucleotide insertion / deletion compared to other species' genome sequences were selected. For species with multiple genome assemblies, only selected genome fragments shared across all assemblies were considered candidate target sequences. These candidate target sequences were then mapped onto the entire genome of the species to determine their genomic location. Then, BLAST was used to screen out sequences of significant differences between ginseng and American ginseng in the Panax genus. Ginseng-specific primers RS-F and RS-R and American ginseng-specific primers XYS-F and XYS-R were designed.

[0024] Table 1

[0025] 1.2 Experimental Materials In this embodiment, five ginseng samples and five American ginseng samples were used to determine the specific identification primers for ginseng and American ginseng.

[0026] 1.3 Genome Extraction After wiping the sample surface with 75% ethanol, place it in a 40 ℃ drying oven for 3-6 h. After the sample is completely dry, take about 100 mg of the sample and grind it into a fine powder. Use a plant genome extraction kit to extract DNA. Store the obtained DNA sample at -20 ℃ for later use.

[0027] 1.4 PCR Amplification Conditions Using the screened specific sequences as templates, ginseng-specific primers RS-F and RS-R, and American ginseng-specific primers XYS-F and XYS-R were designed. The primers were synthesized by Hefei Youkang Biotechnology Co., Ltd. The specific primer sequences are as follows: RS-F: 5′-GTTTGAATTTAGACACTCAATCGTG-3′; SEQ ID NO. 1.

[0028] RS-R: 5′-CGGTTCCATAGCTCACAATGCA-3′; SEQ ID NO. 2.

[0029] XYS-F: 5′-GCGTACTTTGCTTGATTCCTT-3′; SEQ ID NO. 3.

[0030] XSY-R: 5′-CCCTCCTTTCCCTTTGACA-3′; SEQ ID NO.4.

[0031] PCR amplification reaction system: 2 × Rapid Taq Master Mix 25 μL, 10 μM upstream and downstream primers 2 μL each, DNA template ≥50 ng, add sterile double-distilled water to make up to 50 μL.

[0032] PCR reaction conditions for ginseng: 95 ℃ for 3 min; 95 ℃ for 15 s, 57 ℃ for 15 s, 72 ℃ for 4 s, 35 cycles; 72 ℃ for 5 min.

[0033] PCR reaction conditions for American ginseng: 95 ℃ for 3 min; 95 ℃ for 15 s, 55 ℃ for 15 s, 72 ℃ for 4 s, 35 cycles; 72 ℃ for 5 min.

[0034] 1.5 Validation results of specific PCR primers The products of the ginseng-specific PCR reaction were electrophoresed on a 1% agarose gel. Only the ginseng PCR product contained a 207 bp fragment, while the American ginseng PCR product did not contain a 207 bp fragment. Figure 1 A); The products of the PCR reaction specific to American ginseng were electrophoresed on a 1% agarose gel. Only the PCR product of American ginseng contained a 211 bp fragment, while the PCR product of ginseng did not contain a 211 bp fragment. Figure 1 B).

[0035] 1.6 Ginseng and American ginseng HRM amplification HRM amplification reaction system: 10 μL of 2 × SupRealQ Ultra Hunter SYBR qPCR Master Mix (U+), 0.4 μL each of 10 μM forward and reverse primers, 20 ng of DNA template, and sterile double-distilled water to bring the volume to 20 μL. Figure 2 A). HRM reaction conditions: 95 ℃ for 30 s; 95 ℃ for 8 s, 65 ℃ for 20 s, 35 cycles; starting from 60 ℃, the temperature is increased to 95 ℃ in 0.5 ℃ increments, and held for 5 s at each temperature step to produce a melting curve.

[0036] Sensitivity testing: DNA templates were set at concentrations of 0.5, 1, 3, 5, 10, 20, and 50 ng.

[0037] 1.7 Validation results of HRM amplification of ginseng and American ginseng Ginseng showed a dissolution curve at 78.2 ± 0.3 ℃, while American ginseng showed a dissolution curve at 73.3 ± 0.3 ℃, with a clear difference. Figure 2 B). HRM sensitivity studies of ginseng and American ginseng showed that their limits of detection could both reach 0.5 ng ( Figure 2 CD).

[0038] Example 2: Validation of simultaneous rapid dual HRM identification of ginseng and American ginseng 2.1 Experimental Materials In Example 1, ginseng and American ginseng DNA samples were extracted and mixed at the same concentration in a 1:1 ratio.

[0039] 2.2 Optimization of primer mixing conditions for Dual HRM identification With a final concentration of 4 μM for American ginseng primers, the final concentrations of ginseng primers were set to 4 μM, 3 μM, 2 μM, 1.5 μM, 1 μM, and 0.5 μM, respectively. The sensitivity of dual HRM amplification DNA was tested at 0.5, 1, 3, 5, 10, 20, and 50 ng, respectively.

[0040] The optimized 20 μL Dual HRM identification and amplification system consisted of: 10 μL of 2×SupRealQ Ultra Hunter SYBR qPCRMaster Mix (U+), 0.4 μL each of 10 μM American ginseng upstream and downstream primers, 0.3 μL each of 5 μM ginseng upstream and downstream primers, 20 ng of mixed DNA template, and sterile double-distilled water to bring the volume to 20 μL. Dual HRM amplification reaction conditions were: 95 ℃ for 30 s; 95 ℃ for 8 s, 65 ℃ for 20 s, for 35 cycles; starting at 60 ℃, the temperature was increased to 95 ℃ in 0.5 ℃ increments, and held for 5 s at each temperature step to generate melting curves.

[0041] 2.3 Dual HRM Identification and Amplification Validation Results Dual HRM amplification of a mixture of ginseng and American ginseng ( Figure 3 The amplification temperature showed a double peak at 78.2 ± 0.3 ℃ and 73.3 ± 0.3 ℃, consistent with the HRM amplification temperatures of ginseng and American ginseng. Dual HRM amplification sensitivity studies showed that its detection limit could reach as low as 3 ng.

[0042] Example 3: Application of Dual HRM identification technology for ginseng and American ginseng in commercially available ginseng-derived medicinal tea samples and traditional Chinese medicine samples. The Dual HRM identification technique for ginseng and American ginseng was further applied to identify 127 commercially available ginseng-derived herbal tea samples and 10 commercially available ginseng-derived traditional Chinese medicine samples.

[0043] Using the optimized Dual HRM amplification system and reaction parameters described in Example 2, Dual HRM identification was performed on 127 commercially available ginseng herbal tea samples and 10 ginseng-derived traditional Chinese medicine samples. The results showed that among 65 ginseng herbal tea samples, 29 were ginseng samples, 18 were American ginseng samples, and 18 were mixed samples of ginseng and American ginseng. Figure 4 AB). Among 62 American ginseng tea samples, 56 American ginseng samples, 2 ginseng samples, 2 mixed ginseng and American ginseng samples, and 2 samples without peaks were detected. For the two samples that did not show a melting curve, expert morphological identification and ITS2-2F (ATGCGATACTTGGTGTGAAT; SEQ ID NO.5) and ITS2-3R (GACGCTTCTCCAGACTACAAT; SEQ ID NO.6) sequencing strategies were used to identify the original species, which was determined to be Platycodon grandiflorus ( ). Figure 4 CD). Dual HRM analysis was performed on 10 commercially available ginseng-related traditional Chinese medicine samples, including 4 samples containing ginseng, 5 samples containing American ginseng, and 1 sample containing both species. All samples showed corresponding melting curves. Figure 4 E). This demonstrates the accuracy and application prospects of using the Dual HRM amplification system to simultaneously identify ginseng and American ginseng.

[0044] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0045] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A specific primer for rapid identification of ginseng, characterized in that, It includes RS-F and RS-R; the nucleotide sequence of RS-F is shown in SEQ ID NO.1; the nucleotide sequence of RS-R is shown in SEQ ID NO.

2.

2. A specific primer for rapid identification of American ginseng, characterized in that, It includes XYS-F and XYS-R; the nucleotide sequence of XYS-F is shown in SEQ ID NO.3; the nucleotide sequence of XYS-R is shown in SEQ ID NO.

4.

3. A detection kit comprising the primers described in claims 1 and 2.

4. The application of the test kit according to claim 3 in the simultaneous identification of ginseng and American ginseng.

5. A rapid identification method for ginseng and American ginseng based on high-resolution melting curve technology, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; Using genomic DNA as a template, HRM amplification of genomic DNA was performed using the ginseng-specific primers described in claim 1 and the American ginseng-specific primers described in claim 2, respectively. If the HRM melting curve shows a main peak at 78.2 ± 0.3 ℃, it indicates that the sample to be tested is ginseng; If the HRM melting curve shows a main peak at 73.3 ± 0.3℃, it indicates that the sample to be tested is American ginseng.

6. The rapid identification method for ginseng and American ginseng based on high-resolution melting curve technology according to claim 5, characterized in that, The reaction system for HRM amplification was as follows: 10 μL of 2 × SupRealQ Ultra Hunter SYBR qPCRMaster Mix U+, 0.4 μL each of 10 μM upstream and downstream primers, 1 μL of DNA template, and sterile double-distilled water to bring the volume to 20 μL. The HRM amplification reaction program is as follows: 95 ℃ for 30 s; 95 ℃ for 8 s, 65 ℃ for 20 s, 35 cycles; starting from 60 ℃, the temperature is increased to 95 ℃ in 0.5 ℃ increments, and held for 5 s at each temperature step to generate a melting curve.

7. The application of the identification method according to claim 6 in the identification of ginseng and American ginseng.

8. A method for simultaneous and rapid identification of ginseng and American ginseng based on dual high-resolution melting curve technology, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; Dual HRM amplification of genomic DNA was performed using a mixture of ginseng-specific primers as described in claim 1 and American ginseng-specific primers as described in claim 2. If the Dual HRM melting curve shows a single peak at 78.2 ± 0.3 ℃, it indicates that the sample to be tested is ginseng; If the Dual HRM melting curve shows a single peak at 73.3 ± 0.3℃, it indicates that the sample to be tested is American ginseng; If the Dual HRM melting curve shows two peaks at 78.2 ± 0.3 ℃ and 73.3 ± 0.3 ℃, it indicates that the sample contains both ginseng and American ginseng.

9. The method for simultaneous and rapid identification of ginseng and American ginseng based on dual high-resolution melting curve technology according to claim 8, characterized in that, The reaction system for Dual HRM amplification was as follows: 10 μL of 2 × SupRealQ Ultra HunterSYBR qPCR Master Mix U+, 0.3 μL each of 5 μM ginseng upstream and downstream primers, 0.4 μL each of 10 μM American ginseng upstream and downstream primers, 1 μL of mixed DNA template, and sterile double-distilled water to make up to 20 μL. The Dual HRM amplification reaction program is as follows: 95 ℃ for 30 s; 95 ℃ for 8 s, 65 ℃ for 20 s, for 35 cycles; starting from 60 ℃, the temperature is increased to 95 ℃ in 0.5 ℃ increments, and held for 5 s at each temperature step to generate a melting curve.

10. The application of the identification method according to claim 9 in the simultaneous identification of ginseng and American ginseng.

Images