Canine parvovirus-rabies bivalent dog oral vaccine based on replication-deficient canine parvovirus packaging vector and preparation
By constructing a replication-defective canine parvovirus vector and inserting the rabies virus glycoprotein gene, a bivalent oral vaccine for canine parvovirus and rabies was developed. This solved the safety and transmission risks of existing vaccines in stray and wild animals, and achieved a highly efficient and safe immunization effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-04-07
AI Technical Summary
Existing rabies vaccines face safety controversies and difficulties in large-scale implementation when used to immunize stray and wild animals. Furthermore, existing oral vaccines pose safety and transmission risks.
A replication-defective canine parvovirus was used as a vector to insert the rabies virus glycoprotein gene, and a canine parvovirus-rabies bivalent oral vaccine was constructed. Immunization was carried out orally, taking advantage of the stability and safety of canine parvovirus to achieve infection and immune response in intestinal cells.
It achieves effective control of canine pathogens, improves vaccine safety and compliance, can deliver exogenous genes through the digestive tract, induces a good mucosal immune response, and is suitable for immunization of pet dogs and stray dogs.
Smart Images

Figure CN121801965A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of vaccine technology, and in particular to a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector and its preparation. Background Technology
[0002] Rabies is a zoonotic infectious disease caused by the neurotropic rabies virus (RABV), with an extremely high mortality rate, approaching 100%. The disease is particularly prevalent in Asia and Africa, with the main sources of infection being domestic or stray dogs and cats. Approximately 99% of human infections are caused by bites or scratches from these animals. In my country, stray dogs are key hosts for virus transmission. Effective control of human rabies hinges on reducing the number of stray animals and widely implementing vaccination programs for domestic dogs, increasing vaccination coverage to over 70%, thereby blocking virus transmission within animal populations. While existing rabies vaccines play a crucial role in prevention and control, large-scale immunization of wild and stray animals remains a challenge. Due to the difficulty in capturing and vaccinating these animals, oral bait immunization has gradually become a research focus, and developing efficient, low-cost oral vaccines has become a key direction for current rabies control. Oral vaccines deliver antigens through the digestive tract, inducing a specific immune response in the body. Releasing these formulations into the natural environment holds promise for establishing an immune barrier among wild animals and dog populations. For example, several European countries have successfully eliminated rabies using oral vaccines containing the SAG2 attenuated strain; in North America, recombinant vaccinia virus vaccines expressing the rabies virus ERA strain glycoprotein have significantly controlled the epidemic in wild animals. However, there are safety controversies surrounding live attenuated vaccines and recombinant poxvirus vaccines, including cases of adverse reactions after human exposure and the risk that horizontal transmission of attenuated strains among animals may exacerbate the spread of the virus.
[0003] Canine parvovirus type 2 (CPV-2) is a common pathogen primarily transmitted through the digestive tract in canines. It is non-enveloped and highly stable in the external environment. CPV-2 mainly infects rapidly dividing cells in dogs, such as intestinal epithelial cells and lymphohematopoietic cells. Existing technology (ZL202110446154.3) replaces approximately 4700 nt of the NS and VP protein expression regions in the CPV-2 genome with a CMV promoter, exogenous EGFP gene, and termination sequence of only about 1700 nt, while retaining the ITR regions at both ends of the CPV-2 genome as packaging elements. The resulting recombinant plasmid is co-transfected with helper plasmids expressing viral NS and VP proteins to rescue and package replication-defective CPV-2 virus. The obtained recombinant viral genome contains multiple cloning sites, allowing for convenient insertion of exogenous genes, making it a highly safe viral vector. Summary of the Invention
[0004] To overcome the shortcomings and drawbacks of existing rabies vaccines for stray animals and wild animals, the primary objective of this invention is to provide a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector. This vaccine can induce effective immune protection in dogs while possessing higher biosafety, avoiding the horizontal transmission and exposure risks that may be caused by live attenuated vaccines. Thus, it provides a novel, safe, and practical immunization tool for controlling and eliminating rabies in domestic dogs and stray dogs.
[0005] Another object of the present invention is to provide a method for preparing the above-mentioned canine parvovirus-rabies bivalent oral vaccine.
[0006] The objective of this invention is achieved through the following technical solution: A recombinant vector ITR plasmid is obtained by replacing the EGFP sequence in the vector ITR plasmid pITR-P-EGFP-TS-ITR with the full-length sequence of the rabies virus glycoprotein (RABV-G) gene, the full-length sequence of which is shown in SEQ ID NO:1.
[0007] The recombinant vector ITR plasmid contains the core element ITR-P-RABV-G-TS-ITR, the nucleotide sequence of which is shown in SEQ ID NO:2.
[0008] The method for constructing the recombinant vector ITR plasmid includes the following steps: (1) The full-length sequence of the rabies virus glycoprotein gene, as shown in SEQ ID NO:1, was artificially synthesized; (2) The vector ITR plasmid pITR-P-EGFP-TS-ITR was used Hin dIII and Eco The RI was double-digested and ligated with the full-length sequence of the rabies virus glycoprotein gene obtained in step (1) to obtain the recombinant vector ITR plasmid.
[0009] The application of the recombinant vector ITR plasmid in the construction of a canine parvovirus-rabies bivalent vaccine.
[0010] A canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector is obtained by co-transfecting cells with the aforementioned recombinant vector ITR plasmid and helper plasmid pCPV-NS-VP for virus packaging.
[0011] The oral canine vaccine for parvovirus and rabies based on a replication-defective canine parvovirus packaging vector preferably further comprises an adjuvant.
[0012] The method for preparing a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector includes the following steps: (1) Culture animal cells in DMEM medium containing 10% (v / v) FBS until the confluence reaches 70-80%; (2) Mix Opti-MEM Medium and Lipofectamine 3000 Reagent to obtain solution A; mix Opti-MEM Medium, P3000 Reagent, recombinant vector ITR plasmid and helper plasmid pCPV-NS-VP to obtain solution B; (3) Add solution B to solution A in a volume ratio of 1:1, mix well and let stand to obtain a liposome / DNA mixture; (4) Discard the culture medium in step (1) and replace it with serum-free DMEM culture medium without antibiotics. Add the liposome / DNA mixture that has been left to stand in step (3) dropwise and mix well. After successful transfection, lyse the cells, centrifuge, and collect the cell supernatant, which is the canine parvovirus-rabies bivalent oral vaccine based on the replication-defective canine parvovirus packaging vector.
[0013] The cells mentioned in step (1) can be F81 cells.
[0014] The preferred mass ratio of the recombinant vector ITR plasmid and the helper plasmid pCPV-NS-VP in step (2) is 47:80.
[0015] The volume ratio of solution A and solution B in step (3) is preferably 1:1.
[0016] The total transfection time in step (4) is preferably 48 h, wherein the liposome / DNA mixture is added and incubated for 6 h; after incubation, the transfection medium is discarded and DMEM medium containing 10% (v / v) FBS is added for further culture.
[0017] The cell supernatant described in step (4) can be further purified.
[0018] Technical principle of the invention: This invention is based on a previously constructed replication-defective canine parvovirus (CPV-2) packaging vector platform (CN113061625B: A replication-defective canine parvovirus packaging vector, replication-defective recombinant canine parvovirus, and its preparation and application). The full-length sequence and extracellular coding sequence of the rabies virus glycoprotein (RABV-G) gene were inserted into the multiple cloning site of this vector genome, successfully rescuing and packaging two replication-defective CPV-2 recombinant virus particles capable of expressing the rabies virus G protein. Furthermore, this replication-defective CPV-2 recombinant virus was designed as an oral vaccine formulation for oral immunization of rabid dogs. To systematically evaluate the immunogenicity of this candidate vaccine, serum from immunized dogs was collected periodically, and the titer of neutralizing antibodies against canine parvovirus and the level of specific neutralizing antibodies against rabies virus were detected, thereby comprehensively assessing its ability to elicit an immune response.
[0019] The present invention has the following advantages and effects compared with the prior art: (1) Canine parvovirus has high structural stability and can infect intestinal epithelial cells. It has a natural advantage as a viral vector for oral vaccines. It is not only easy to preserve, but also very easy to deliver exogenous genes into intestinal cells for expression through digestive tract infection, thereby inducing a good mucosal immune response. (2) The present invention is based on a replication-defective canine parvovirus vector, which has high safety. It can infect and enter the host cell, but it will not replicate and proliferate inside. However, it can express the foreign gene it carries, thereby activating the intestinal mucosal immunity.
[0020] (3) This invention uses a replication-defective canine parvovirus as a vector and inserts the glycoprotein gene of rabies virus into its genome to design an oral bivalent vaccine that can simultaneously prevent and control two canine pathogens.
[0021] (4) This invention investigated the oral immunization effects of inserting the full-length gene of rabies virus glycoprotein and the extracellular antigen region gene into the genome of a replication-defective canine parvovirus. It was found that the recombinant virus containing the full-length gene of glycoprotein had a better immunization effect than the recombinant virus containing only the extracellular antigen region gene.
[0022] (5) This invention provides an oral bivalent vaccine that, compared to injectable vaccines, has better animal compliance and is easier to administer via feeding to pet dogs and stray dogs. This invention provides a new strategy for the development of oral rabies vaccines. Attached Figure Description
[0023] Figure 1 This is a schematic diagram of recombinant plasmid construction.
[0024] Figure 2 This is an immunofluorescence (×100) image of F81 cells infected with a replication-defective CPV-2 recombinant virus.
[0025] Figure 3 This is a Western blot result of F81 cells infected with a replication-defective CPV-2 recombinant virus.
[0026] Figure 4 This graph shows the changes in CPV neutralizing antibody levels at different time points after oral vaccination against CPV-2 recombinant virus vaccine in beagle dogs. The significant differences between groups are indicated by *** based on two-way ANOVA analysis of variance. P <0.001.
[0027] Figure 5 This graph shows the changes in RABV neutralizing antibody levels at different time points after oral immunogenicity-deficient CPV-2 recombinant virus vaccine in beagle dogs. * indicates significant differences between groups based on two-way ANOVA analysis. P <0.05, ** indicates P <0.01, *** indicates P <0.001. Detailed Implementation
[0028] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0029] The vector ITR plasmid pITR-P-EGFP-TS-ITR and the helper plasmid pCPV-NS-VP in the examples have been disclosed in Chinese patent (CN113061625B A replication-defective canine parvovirus packaging vector, replication-defective recombinant canine parvovirus and its preparation and application).
[0030] The canine parvovirus New CPV-2a subtype strain CPV-BM in the examples has been disclosed in the reference (Qian Peng. Isolation, identification, genetic evolution analysis and establishment of TaqMan probe fluorescence quantitative method for canine and feline parvoviruses in Guangzhou area [D]. South China Agricultural University, 2018.).
[0031] Example 1 1. Gene synthesis and recombinant plasmid construction (1) Codon optimization of the full-length sequence of the rabies virus glycoprotein (RABV-G) gene The full-length sequence of the glycoprotein (G) gene of the rabies inactivated vaccine strain CTN-1 (GenBank accession number: JN234418.1) was used as the sequence to be optimized, and GenSmart was used by GenScript Biotech Inc. TM The codon optimization system was optimized according to canine codon preferences, with a 6×His tag peptide added to the 3' end. To further increase expression levels, a Kozak sequence was added to the 5' end, and additional tags were added to both sides. Hin d III and Eco RI restriction site. The obtained sequence is as follows: The codon-optimized full-length RABV-G sequence:
[0032] Note: Italicized sequences are restriction enzyme sites, shaded sequences are Kozak sequences, the first underlined sequence is the extracellular region of the glycoprotein, and the second underlined sequence is the 6×His tag peptide.
[0033] (2) Gene synthesis was performed on the full-length sequence and extracellular region sequence of the glycoprotein gene optimized in step (1) (Suzhou Genewise Biotechnology Co., Ltd.). The full-length sequence and extracellular region sequence of the glycoprotein gene were respectively synthesized by... Hin d III and Eco The RI restriction site was cloned into the pITR-P-EGFP-TS-ITR plasmid, replacing the EGFP gene, to obtain recombinant plasmids, named pITR-RABV-G and pITR-RABV-Get, respectively. The construction method is as follows: Figure 1 As shown, the ITR region sequences in the two recombinant plasmids after construction are as follows: ITR-P-RABV-G-TS-ITR sequence: GGTACCATTCTTTAGAACCAACTGACCAAGTTCACGTACGTATGACGTGATGACGCGCGCTGCGCGCGCTGCCTACGGCAGTCACACGTCATACGTACGCTCCTTGGTCAGTTGGTTCTAAAGAATGATAGGCGGTTTGTGTGTTTAAACTTGGGCGGGAAAAGGCTCGAGTACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTT AAGCTTGCCACCATGGTGATTCCCCAGGCTCTATTGTTTGTCCCGTTACTTGTCTTCCCTC TGTGTTTTGGCAAATTTCCTATATATACCATCCCTGATAAATTGGGGCCGTGGAGTCCCATTGACATCCACCACCTG AGCTGCCCTAATAATCTCGTGGTAGAGGATGAGGGCTGCACCAATCTGTCAGGGTTTTCTTACATGGAGCTTAAGGT CGGTTATATATCCGCCATTAAGGTGAACGGTTTCACATGTACAGGCGTTGTCACAGAAGCAGAAACGTACACTAACT TTGTTGGTTACGTGACCACTACCTTCAAGAGAAAGCACTTTCGTCCCACGCCTGACGCCTGCAGAAGCGCCTACAAC TGGAAGATGGCAGGAGATCCCAGATATGAAGAAAGCCTGCACAACCCGTATCCTGACTACCACTGGCTGCGCACAGT GAAGACGACTAAGGAGAGCGTAGTAATCATAAGTCCATCTGTGGCTGACTTGGATCCATACGACAAGTCACTACATT CCAGAGTCTTTCCACGGGGAAAATGCTCCGGCATCACCGTGAGCAGTGCTTACTGCTCTACCAATCATGATTATACA ATCTGGATGCCTGAAAATCCCCGCTTAGGAACGAGCTGTGATATTTTCACCAACTCACGGGGAAAAAGGGCATCCAA GGGCAGTAAAACTTGCGGATTCGTTGATGAGCGGGGGCTGTATAAAAGTTTAAAGGGCGCGTGTAAACTTAAGCTGT GCGGCGTGCTGGGTCTGCGCTTGATGGACGGCACCTGGGTGGCAATTCAAACAAGCAATGAAACCAAATGGTGTCCTCCAGATCAGCTGGTTAATCTGCATGACTTCCACAGTGACGAAATCGAGCATTTGGTCGTGGAGGAACTGGTTAAAAA ACGGGAGGAATGTCTCGATGCCCTTGAGTCCATTATGACCACGAAATCAGTGAGCTTCCGTAGGCTAAGCCACCTCA GGAAGCTCGTCCCTGGTTTCGGGAAAGCATACACCATATTCAACAAAACTTTGATGGAGGCCGATGCTCATTACAAG TCTGTACGCACATGGAATGAGATCATTCCATCGAAGGGCTGTTTGAGAGTCGGAGGGCGATGCCACCCACACGTCAA TGGAGTCTTCTTTAACGGGATTATTCTCGGTCCAGACGGCCATGTGCTGATACCCGAGATGCAGTCTTCTCTCCTGC AGCAGCACATGGAGCTGCTGGAGTCCAGCGTGATCCCCCTCATGCACCCCCTTGCCGATCCGTCGACTGTGTTCAAG GACGGAGACGAGGTTGAAGATTTTGTGGAGGTGCATCTTCCAGATGTGCATAAGCAGGTGAGTGGAGTGGACCTGGG CCTGCCCAACTGGGGCAAAGACGTCCTCATGGGCGCCGGGGTGCTCACAGCGTTGATGCTCATGATCTTTCTTATGA CATGCTGCCGGAGAACTAACAGGGCTGAGTCAATCCAGCACAGTCTGGGGGAAACTGGAAGGAAGGTTTCCGTGACA TCACAAAGCGGGCGAGTTATCTCCAGCTGGGAATCTTATAAGTCCGGAGGGGAAACCAAACTGCACCACCACCACCA CCACTGAGAATTC CGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGGATCCCCTTACCATAAGTATCAATCTGTCTTTAAGGGGGGGGTGGGTGGGAGATGCACAACATCAGTAGACTGACTGGCCTGGTTGGTTGCGCTTAATCAACCAGACCGCTATGCGGTCTGGTTGATTAAGCAGAGCAACCAACCAGGCCAGTCAGTCTACTGATGTTGTGCATCTCCCACCCACCCCCCCCTTAAAGACAGATTGAGCGGCCGCGAGCTC Note: The underlined part is the full-length sequence of the glycoprotein gene.
[0034] > ITR-P-RABV-Get-TS-ITR sequence: GGTACCATTCTTTAGAACCAACTGACCAAGTTCACGTACGTATGACGTGATGACGCGCGCTGCGCGCGCTGCCTACGGCAGTCACACGTCATACGTACGCTCCTTGGTCAGTTGGTTCTAAAGAATGATAGGCGGTTTGTGTGTTTAAACTTGGGCGGGAAAAGGCTCGAGTACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTT AAGCTTGCCACCATGGTGATTCCCCAGGCTCTATTGTTTGTCCCGTTACTTGTCTTCCCTC TGTGTTTTGGCAAATTTCCTATATATACCATCCCTGATAAATTGGGGCCGTGGAGTCCCATTGACATCCACCACCTG AGCTGCCCTAATAATCTCGTGGTAGAGGATGAGGGCTGCACCAATCTGTCAGGGTTTTCTTACATGGAGCTTAAGGT CGGTTATATATCCGCCATTAAGGTGAACGGTTTCACATGTACAGGCGTTGTCACAGAAGCAGAAACGTACACTAACT TTGTTGGTTACGTGACCACTACCTTCAAGAGAAAGCACTTTCGTCCCACGCCTGACGCCTGCAGAAGCGCCTACAAC TGGAAGATGGCAGGAGATCCCAGATATGAAGAAAGCCTGCACAACCCGTATCCTGACTACCACTGGCTGCGCACAGT GAAGACGACTAAGGAGAGCGTAGTAATCATAAGTCCATCTGTGGCTGACTTGGATCCATACGACAAGTCACTACATT CCAGAGTCTTTCCACGGGGAAAATGCTCCGGCATCACCGTGAGCAGTGCTTACTGCTCTACCAATCATGATTATACA ATCTGGATGCCTGAAAATCCCCGCTTAGGAACGAGCTGTGATATTTTCACCAACTCACGGGGAAAAAGGGCATCCAA GGGCAGTAAAACTTGCGGATTCGTTGATGAGCGGGGGCTGTATAAAAGTTTAAAGGGCGCGTGTAAACTTAAGCTGT GCGGCGTGCTGGGTCTGCGCTTGATGGACGGCACCTGGGTGGCAATTCAAACAAGCAATGAAACCAAATGGTGTCCT CCAGATCAGCTGGTTAATCTGCATGACTTCCACAGTGACGAAATCGAGCATTTGGTCGTGGAGGAACTGGTTAAAAA ACGGGAGGAATGTCTCGATGCCCTTGAGTCCATTATGACCACGAAATCAGTGAGCTTCCGTAGGCTAAGCCACCTCA GGAAGCTCGTCCCTGGTTTCGGGAAAGCATACACCATATTCAACAAAACTTTGATGGAGGCCGATGCTCATTACAAG TCTGTACGCACATGGAATGAGATCATTCCATCGAAGGGCTGTTTGAGAGTCGGAGGGCGATGCCACCCACACGTCAA TGGAGTCTTCTTTAACGGGATTATTCTCGGTCCAGACGGCCATGTGCTGATACCCGAGATGCAGTCTTCTCTCCTGC AGCAGCACATGGAGCTGCTGGAGTCCAGCGTGATCCCCCTCATGCACCCCCTTGCCGATCCGTCGACTGTGTTCAAG GACGGAGACGAGGTTGAAGATTTTGTGGAGGTGCATCTTCCAGATGTGCATAAGCAGGTGAGTGGAGTGGACCTGGG CCTGCCCAACTGGGGCAAACACCACCACCACCACCACTGAGAATTC CGTCTAGAGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGC GGTGGGCTCTATGGCTTCTGAGGCGGAAAGGATCCCCTTACCATAAGTATCAATCTGTCTTTAAGGGGGGGGTGGGTGGGAGATGCACAACATCAGTAGACTGACTGGCCTGGTTGGTTGCGCTT AATCAACCAGACCGCTATGCGGTCTGGTTGATTAAGCAGAGCAACCAACCAGGCCAGTCAGTCTACTGATGTTGTGCATCTCCCACCCACCCCCCCCTTAAAGACAGATTGAGCGGCCGCGAGCTC Note: The underlined portion is the extracellular region sequence of the glycoprotein gene.
[0035] 2. Packaging of replication-defective CPV-2 recombinant viruses The packaging method for the replication-defective CPV-2 recombinant virus is based on patent ZL202110446154.3, and the specific method is as follows: (1) Cell transfection ① Cell plating: After digesting the cultured F81 cells (cat kidney epithelial cells, passaged and preserved by the Veterinary Microbiology Laboratory of South China Agricultural University) with trypsin, the cells were dispersed in DMEM medium containing 10% (v / v) FBS to adjust the cell concentration to 4×10⁻⁶ cells / year. 4 Add cells / mL to a 12-well plate at a rate of 1 mL / well, and transfect when the cells reach a confluence of 70%–80%.
[0036] ② When performing transfection, replace 1 mL of serum-free DMEM medium without antibiotics shortly before adding the liposome / DNA mixture.
[0037] ③ Prepare solution A (Opti-MEM Medium 62.5 μL, Lipofectamine 3000 Reagent 2.5 μL) and solution B (Opti-MEM Medium 62.5 μL, P3000 Reagent 2.5 μL, helper plasmid pCPV-NS-VP 800 ng, plasmid pITR-RABV-G or pITR-RABV-Get 470 ng, with pITR-P-EGFP-TS-ITR as the control).
[0038] ④ Add solution B to solution A at a volume ratio of 1:1, mix well, and let stand at room temperature for 15 min to obtain a liposome / DNA mixture.
[0039] ⑤ While retaining the original culture medium, add 125 μL of liposome / DNA mixture dropwise, gently shaking the culture plate as you add.
[0040] ⑥ Place in a carbon dioxide cell culture incubator and incubate for 6 h. Then discard the transfection medium and add 1 mL of DMEM medium containing 10% (v / v) FBS.
[0041] ⑦ After 48 h of transfection, freeze the cells at -80℃ and thaw them at room temperature. Repeat this freeze-thaw cycle 3 times. After the last thaw, aliquot the supernatant into 1.5 mL EP tubes, centrifuge at 12,000 r / min for 10 min at 4℃, transfer the supernatant to 1.5 mL EP tubes, and store at -80℃ for later use. This is the solution of replication-defective CPV-2 recombinant virus (CPV-EGFP, CPV-RABV-G, and CPV-RABV-Get).
[0042] (2) Porcine erythrocyte agglutination test Add 25 μL of PBS diluent (pH 6.8) to each well of a 96-well V-type hemagglutination plate. Add 25 μL of the supernatant of transfected cells prepared in step (1) or the positive control CPV-BM virus (isolated by the Veterinary Microbiology Laboratory of South China Agricultural University) to the first well. Perform 2-fold dilutions on the hemagglutination plate. The last well serves as the negative control. Add 25 μL of 1.0% (V / V) porcine erythrocyte suspension (purchased from Beijing Bio-Lab Technology Co., Ltd., catalog number: QS013) to each well. Shake well for 1 min and then place at 4°C for 1-2 h. The maximum dilution of the virus that shows 100% agglutination is the HA titer of the virus when the erythrocytes in the control well do not agglutinate at all and settle to the bottom of the well as small round dots.
[0043] The results of the porcine erythrocyte agglutination assay are shown in Table 1. After co-transfecting F81 cells with the vectors pITR-RABV-G and pITR-RABV-Get and the helper plasmid pCPV-NS-VP, the hemagglutination titers of the supernatant of the transfected cells reached 1:256 and 1:512, respectively, indicating that the recombinant plasmids can be co-transfected with the helper plasmids to package CPV-2 virus particles with hemagglutination activity.
[0044] Table 1. HA titer of packaging-defective recombinant viruses plasmid pITR-RABV-G+pCPV-NS-VP pITR-RABV-Get+pCPV-NS-VP pITR-P-EGFP-TS-ITR+pCPV-NS-VP HA valence 1:256 1:512 1:512 Defective recombinant virus CPV-RABV-G CPV-RABV-Get CPV-EGFP 3. Analysis of cell infection by replication-defective CPV-2 recombinant virus (1) Replication-defective CPV-2 recombinant virus infects F81 cells ①F81 cells were seeded into 48-well plates using standard methods. After the F81 cells in the 48-well plates grew into a monolayer, the replication-defective CPV-2 recombinant virus packaged in step 2 was seeded (the virus was diluted 100 times with a hemagglutination titer of 1:256, and 50 μL was added to each well), and the cells were cultured for another 48 h.
[0045] ② Discard the culture medium, add 1 mL of pre-cooled 80% (v / v) acetone solution to each well, and fix at -20℃ for 30 min. The control group CPV-EGFP does not need to be fixed and can be observed directly.
[0046] ③ After discarding the acetone, wash each well three times with sterile PBS.
[0047] ④ Add 500 μL of 6×His monoclonal antibody diluted 1:500 with PBS (purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number: 66005-1) to each well and incubate overnight at 37°C.
[0048] ⑤ Wash three times with sterile PBS, add 300 μL of FITC-labeled goat anti-mouse IgG secondary antibody diluted 1:1000 with PBS to each well (purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number: SA00003-1), and incubate at 37℃ for 1 h.
[0049] ⑥ Wash three times with sterile PBS, and finally add 1 mL of sterile PBS to each well and observe under a fluorescence inverted microscope.
[0050] Immunofluorescence results are shown in Figure 2 The three replication-defective recombinant CPV-2 viruses (CPV-EGFP, CPV-RABV-G and CPV-RABV-Get) obtained by packaging were able to infect F81 cells and could introduce and express the three foreign genes (EGFP, RABV-G and RABV-Get) into the infected cells.
[0051] (2) Analysis of RABV-G protein expression in cells infected with replication-defective CPV-2 recombinant virus ① Take F81 cells infected with the replication-defective CPV-2 recombinant virus from step (1) ①, add 100 μL RIPA cell lysis buffer and 1 μL PMSF, and incubate for 5 min; then collect the cell samples after incubation in a 1.5 mL EP tube, add 6× Loading Buffer according to the ratio, and boil at 100℃ for 10 min.
[0052] ②After boiling, centrifuge at 12,000 g for 3 min and collect the supernatant into a 1.5 mL EP tube.
[0053] ③ The above samples were analyzed by electrophoresis in a 12% SDS-polyacrylamide gel (SDS-PAGE). 1× electrophoresis buffer was added to the electrophoresis tank. The stacking gel was electrophoresed at 80 V for 30 min, and the separating gel was electrophoresed at 120 V for 60 min.
[0054] ④ After SDS-PAGE, remove the gel and prepare a polyacrylamide gel-membrane "sandwich" in the following order: sponge pad - 3 layers of filter paper - gel - PVDF membrane - 3 layers of filter paper - sponge pad. Transfer the fixed gel-membrane "sandwich" to an electrophoresis apparatus for electrophoresis at a constant current of 200 mA for 45 min. After the transfer was complete, the PVDF membrane was removed and the following procedures were performed: Washing: Wash the membrane 3 times with PBST, 5 min each time; Blocking: Block with PBST containing 10% (w / w) skim milk powder for 3 h; Washing: Discard the blocking solution and wash the membrane 3 times with PBST, 10 min each time; Add primary antibody: Rabies virus glycoprotein mouse monoclonal antibody diluted 1:200 (prepared by the Veterinary Microbiology Laboratory of South China Agricultural University according to standard methods, or commercially available), incubate at 4℃ overnight; Washing: Discard the primary antibody and wash the membrane 5 times with PBST, 10 min each time; Add secondary antibody: HRP-goat anti-mouse IgG (purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number: SA00001-1) diluted 1:2000 as secondary antibody, incubate at 37℃ for 1 h; Washing: Discard the secondary antibody and wash the membrane 5 times with PBST, 10 min each time; Color development: Add an appropriate amount of TMB color development solution and take pictures using a chemiluminescence imaging system.
[0055] Western blot results are shown below. Figure 3 Replication-deficient CPV-2 recombinant viruses CPV-RABV-G and CPV-RABV-Get can successfully express the full-length and extracellular regions of the glycoprotein after infecting F81 cells.
[0056] 4. Evaluation of the effect of oral immunization on beagles (1) The three replication-defective recombinant CPV-2 viruses (CPV-EGFP, CPV-RABV-G, and CPV-RABV-Get) obtained from packaging were uniformly diluted to a hemagglutination titer of 1:256. 1 mL of the virus solution was mixed with an appropriate amount of puppy-specific formula goat milk powder at room temperature to prepare a 10 mL oral dose for a single dog. Fifteen 2-month-old beagles that were negative for canine parvovirus antibodies were selected and divided into 3 groups. They were orally immunized with CPV-RABV-G, CPV-RABV-Get, and a negative control group (CPV-EGFP), respectively. A booster immunization with the same dose was performed on day 15 after immunization. Blood was collected on days 7, 14, 21, and 28 after immunization. The serum was separated by centrifugation and inactivated at 56°C for 30 min.
[0057] (2) Determination of neutralizing antibody titer against canine parvovirus Serum was serially diluted (1:4, 1:8, 1:16, ..., 1:1024) in 96-well cell culture plates. An equal volume of 100 TCID45 solution was added to each well. 50 CPV-BM virus solution (isolated by the Veterinary Microbiology Laboratory of South China Agricultural University) was prepared. After mixing, it was incubated at 37°C for 1 h. Prepared F81 cells were added to each well, and the culture plate was incubated at 37°C with 5% CO2 for 72 h. Viral infection in each well was detected using immunofluorescence. The serum dilution that protected 50% of the wells from lesions was calculated using the Reed-Muench method; this dilution was the neutralizing antibody titer of the serum.
[0058] (3) Determine the titer of rabies virus neutralizing antibodies. The titer of rabies virus neutralizing antibodies in serum was determined using the fluorescent antibody virus neutralization assay (FAVN method).
[0059] Following oral immunization of beagle dogs with different groups of replication-deficient recombinant CPV-2 vaccines, no CPV neutralizing antibodies were produced in any group on day 7 post-immunization. On day 14 post-immunization, the CPV neutralizing antibody titers in the serum of dogs immunized in the CPV-RABV-G and CPV-RABV-Get groups began to be significantly higher than those in the negative control group. Figure 4 Following booster immunization, on days 21 and 28, the neutralizing antibody titers in both the CPV-RABV-G and CPV-RABV-Get groups exceeded 1:32. Figure 4 ).
[0060] On day 14 after oral immunization, the CPV-RABV-G and CPV-RABV-Get groups produced significantly higher levels of RABV neutralizing antibodies than the negative control group, with the CPV-RABV-G group showing a highly significant difference in neutralizing antibody levels. P<0.001). On day 21 post-boost immunization, the neutralizing antibody titer in the CPV-RABV-G group began to exceed the protective level by 0.5 IU / mL, and was significantly higher than that in the CPV-RABV-Get group. On day 28 post-immunization, the neutralizing antibody titer in the CPV-RABV-G group continued to rise, exceeding 1 IU / mL.
[0061] The above experimental results indicate that the oral immunization effect of the replication-deficient CPV-2 recombinant virus vaccine CPV-RABV-G, which expresses the full-length gene of the rabies virus glycoprotein, is superior to that of the replication-deficient CPV-2 recombinant virus vaccine CPV-RABV-Get, which only expresses the outer membrane region of the glycoprotein.
[0062] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A recombinant vector ITR plasmid, characterized in that... The EGFP sequence in the ITR vector plasmid pITR-P-EGFP-TS-ITR was replaced with the full-length sequence of the rabies virus glycoprotein gene, as shown in SEQ ID NO:
1.
2. The recombinant vector ITR plasmid according to claim 1, characterized in that: The recombinant vector ITR plasmid contains the core element ITR-P-RABV-G-TS-ITR, the nucleotide sequence of which is shown in SEQ ID NO:
2.
3. The method for constructing the recombinant vector ITR plasmid according to claim 1 or 2, characterized in that... It includes the following steps: (1) The full-length sequence of the rabies virus glycoprotein gene, as shown in SEQ ID NO:1, was artificially synthesized; (2) The vector ITR plasmid pITR-P-EGFP-TS-ITR was used Hin dIII and Eco The RI was double-digested and ligated with the full-length sequence of the rabies virus glycoprotein gene obtained in step (1) to obtain the recombinant vector ITR plasmid.
4. The use of the recombinant vector ITR plasmid according to claim 1 or 2 in the construction of a canine parvovirus-rabies bivalent vaccine.
5. A canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector, characterized in that... The virus is packaged by co-transfecting cells with the recombinant vector ITR plasmid as described in claim 1 or 2 and the helper plasmid pCPV-NS-VP.
6. The canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector according to claim 5, characterized in that: The canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector also contains an adjuvant.
7. The method for preparing a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector as described in claim 5 or 6, characterized in that... It includes the following steps: (1) Culture animal cells in DMEM medium containing 10% (v / v) FBS until the confluence reaches 70-80%; (2) Mix Opti-MEM Medium and Lipofectamine 3000 Reagent to obtain solution A; mix Opti-MEM Medium, P3000 Reagent, recombinant vector ITR plasmid and helper plasmid pCPV-NS-VP to obtain solution B; (3) Add solution B to solution A, mix well and let stand to obtain liposome / DNA mixture; (4) Discard the culture medium in step (1) and replace it with serum-free DMEM culture medium without antibiotics. Add the liposome / DNA mixture that has been left to stand in step (3) dropwise and mix well. After successful transfection, lyse the cells, centrifuge, and collect the cell supernatant, which is the canine parvovirus-rabies bivalent oral vaccine based on the replication-defective canine parvovirus packaging vector.
8. The method for preparing a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector according to claim 7, characterized in that: The cells mentioned in step (1) are F81 cells.
9. The method for preparing a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector according to claim 7, characterized in that: The mass ratio of the recombinant vector ITR plasmid and the helper plasmid pCPV-NS-VP in step (2) is 47:
80.
10. The method for preparing a canine parvovirus-rabies bivalent oral vaccine based on a replication-defective canine parvovirus packaging vector according to claim 7, characterized in that: The volume ratio of solution A and solution B in step (3) is 1:1.
Citation Information
Patent Citations
A replication-defective canine parvovirus packaging vector, a replication-defective recombinant canine parvovirus, and its preparation and application.
CN113061625B