DP1 protein for regulating and controlling female fertility of rice as well as coding gene and application of DP1 protein

Abstract

The invention relates to the technical field of plant molecular biology, in particular to a DP1 protein for regulating and controlling female fertility of rice as well as a coding gene and application of the DP1 protein. According to the invention, after the expression of the DP1 gene is destroyed, the rice has genic male sterility, the female setting rate is as low as 0.5%, the female sterility character is stable and is not influenced by environmental conditions, and the male sterility is completely normal; after the DP1 gene is further introduced, the female fertility of the rice can be restored. Therefore, the DP1 protein and the coding gene thereof play an important role in the aspects of utilizing the heterosis of crops and removing male parent seeds in hybrid seed production. The invention provides a new element for research and development of a novel hybrid breeding and seed production technology of rice, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and in particular to the DP1 protein that regulates female fertility in rice, its encoding gene, and its applications. Background Technology

[0002] Hybrid rice is the F1 generation obtained by crossing parent rice lines. Its yield is often more than 15% higher than that of conventional rice parents, and its resistance and adaptability are also far superior to the parents. Therefore, the application and promotion of hybrid rice is an important way to increase rice yield.

[0003] Traditional hybrid rice technology involves first developing a male-sterile female parent, then planting it alternately in the field with a fertile conventional rice variety or a male parent with specific fertility recovery capabilities. During peak flowering, artificial pollination is assisted, allowing the female parent to capture pollen from the male parent, thus producing a hybrid. Because the male parent still possesses self-pollination ability, it must be removed at harvest to ensure that mechanically harvested hybrids are free of male parent seeds. This not only increases labor costs but also prevents fully mechanized production.

[0004] Female sterility refers to the inability of female reproductive organs to produce offspring while male reproductive organs remain viable and produce viable pollen. By modifying the male parent of a hybrid to be female-sterile and then fertilizing it with a male-sterile line, the process of removing the male parent in hybrid seed production can be eliminated, enabling mechanized production. Since the removal of the male parent is unnecessary, it can be mixed with the female parent for sowing, further reducing seed production steps. Furthermore, mixed sowing changes the traditional alternating row planting pattern of male and female parents in the "three-line" and "two-line" seed production methods, shortening the relative distance between the parents. This promotes natural fertilization and increases the yield of hybrid seeds, which is likely to be a major trend in future hybrid rice technology.

[0005] Currently, the female sterility genes that have been cloned in rice include FST , LOG , OsAPC6 , PTB1 , FMS1 , FMS2 . FSTOsAPC6 is a pleiotropic gene, with different mutants exhibiting varying phenotypes, but all showing abnormal midrib formation in leaves and malformed flower development. Midrib loss causes the plant's leaves to spread out, hindering high photosynthetic productivity, which is a drawback of this mutant. LOG is a cytokinin-activating enzyme essential for maintaining meristem activity; its loss of function leads to premature termination of shoot apical meristem development, causing not only female sterility but also reducing the number of spike branches and spikelets (Takashi et al., 2007, Direct control of shoot meristem activity by a cytokinin-activating enzyme, Nature, 445: 652-655). OsAPC6 primarily disrupts normal endosperm development by affecting gibberellin responses, thus leading to female sterility. osapc6 The development of male gametes in the mutant was not affected, thus making it a relatively good female-sterile mutant. However, interference with the gibberellin signaling pathway also led to cell reduction and stunted plant height (Kumar et al., 2010, A candidate gene OsAPC6 of anaphase-promoting complex of rice identified through T-DNA insertion Functional & Integrative Genomics, 10: 349-358; Awasthie et al. 2012, Abnormal endosperm development causes female sterility in riceinsertional mutant OsAPC6, Plant Science, 183: 167-174). The dwarfing phenotype has a certain adverse effect on cross-pollination, reducing the application value of the mutant in hybrid seed production. FMS1 is an important regulator of early embryo sac development, and its abnormality causes the embryo sac to stop developing at an earlier stage. FMS1 possesses the NB-ARC domain, a common domain in plant disease resistance proteins, but its function in disease resistance is currently undetermined. Therefore, loss-of-function mutants of FMS1 pose a potential risk of disease susceptibility. FMS2, also known as OsMADS13, is a member of the MADS-box family and is widely involved in the differentiation of floral meristems and the formation of floral organs. FMS2It is also a pleiotropic gene. In addition to the homologous transformation of ovules into carpels, its mutants can also affect the formation of other floral organs to varying degrees, resulting in a variety of floral organ structures (Ludovico et al., 2007, The D-lineage MADS-box gene OsMADS13 controls ovule identity in rice, The Plant Journal, 52: 690-699). PTB1 Encodes a RING-type E3 ubiquitin ligase that positively regulates rice panicle grain setting rate by promoting pollen tube growth (Li et al., 2013, Natural variation in PTB1 regulates rice seed setting rate by controlling pollen tube growth, Nature Communications, 2013, 4: 2793). ptb1 The self-crossing seed set rate of the mutant is less than 2%. Except for female sterility, other agronomic traits are not changed. It is currently a better female sterile mutant that can be used for hybrid seed production. Summary of the Invention

[0006] To overcome the current problems of difficult mechanized seed production, low production efficiency, and high labor costs in hybrid rice technology, creating and utilizing superior female-sterile materials is a crucial breakthrough. Based on this, the present invention proposes the following technical solution.

[0007] In a first aspect, the present invention provides a DP1 protein, the amino acid sequence of which is shown in SEQ ID NO.3.

[0008] Secondly, the present invention provides the gene encoding the DP1 protein.

[0009] Preferably, the nucleotide sequence of the gene is as shown in SEQ ID NO.1 or SEQ ID NO.2. SEQ ID NO.1 is the nucleotide sequence of the rice genome, and SEQ ID NO.2 is its CDS sequence.

[0010] rice DP1 The gene is located on chromosome 7 of rice. Its dominant allele plays a key role in female fertility in plants, while the loss-of-function recessive allele leads to female sterility.

[0011] Thirdly, the present invention provides a biological material containing the DP1 protein or the gene described herein.

[0012] In specific implementation, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant cells or tissues.

[0013] Fourthly, the present invention provides the application of the DP1 protein, the gene, or the biological material in the preparation of transgenic rice.

[0014] Transgenic rice is prepared by utilizing the DP1 protein or the gene to achieve the purpose of improving rice germplasm resources.

[0015] Preferably, the improvement of rice germplasm resources includes the development of new hybridization breeding technologies, and the improvement of growth traits such as yield, quality, resistance to diseases and pests, stress resistance, and lodging resistance.

[0016] Preferably, female-sterile paternal materials are prepared using the DP1 protein, the gene, or the biological material, and then combined with male-sterile maternal lines. This eliminates the need for artificial or mechanical emasculation, and fully mechanized hybridization is achieved through mixed sowing.

[0017] The above methods can significantly reduce seed production costs and increase seed production output.

[0018] Fifthly, the present invention provides the use of the DP1 protein, the gene, or the biological material in at least one of the following aspects: (1) Regulating female fertility in rice; (2) To create nuclear-sterile female-sterile rice; (3) Create rice with female fertility.

[0019] In some implementations, nuclear sterility in rice is caused by disrupting or eliminating the expression or activity of the DP1 protein or the gene in the rice.

[0020] In some implementations, rice is restored to female fertility by producing or having the expression or activity of the DP1 protein or the gene.

[0021] Since fertility restoration genes for female-sterile lines are widely present in rice germplasm resources, female fertility can be restored by converting wild-type genes.

[0022] Preferably, female fertility of rice is restored by introducing the DP1 protein or the gene into rice plants where the expression or activity of the DP1 protein or the gene is absent.

[0023] In some implementation schemes, after the occurrence of nuclear sterility in females, the female seed setting rate is as low as below 0.5%. Moreover, fertility is stable, unaffected by light and temperature conditions, and genetically conforms to recessive inheritance.

[0024] In this invention, the nuclear sterile female infertility is a recessive nuclear sterile female infertility.

[0025] In a sixth aspect, the present invention provides a method for regulating female fertility in rice, comprising: causing nuclear sterility in rice by disrupting or eliminating the expression or activity of the DP1 protein or the gene in rice; or restoring female fertility in rice by allowing rice to produce or have the expression or activity of the DP1 protein or the gene.

[0026] In specific implementation schemes, the use of the DP1 protein or the gene to influence the function of the same or homologous genes in other plants at the genomic, and / or transcriptomic, and / or proteomic levels to control the fertility of female reproductive organs also falls within the scope of protection of this invention.

[0027] In specific implementation schemes, the specific technical means employed by the method include, but are not limited to: introducing a mutant sequence of the gene into the plant to cause female sterility, causing an endogenous sequence mutation of the gene in the plant, introducing an antisense sequence of the gene into the plant, using a hairpin, or linking the gene with other nucleotide sequences to regulate female fertility in rice, or any method known to those skilled in the art for regulating female fertility in rice.

[0028] In a specific implementation plan, the preferred technical means employed by the method are: physicochemical mutagenesis, insertion mutation, gene targeting and knockout, introduction of antisense genes, and introduction of co-inhibition or hairpin structures.

[0029] Preferably, the specific technical means employed in the method is to use the CRISPR / Cas system to knock out the gene in rice, causing the rice to exhibit nuclear sterility-type female sterility.

[0030] In specific implementations, the insertion, deletion, and / or substitution of several nucleotides in the gene, thereby altering the female fertility of rice, also falls within the scope of protection of this invention.

[0031] The present invention DP1 It is highly expressed mainly in the early stages of young spikelet development.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a DP1 protein and its encoding gene capable of regulating female fertility in rice. When this gene is knocked out or its expression is suppressed, the female seed setting rate is as low as 0.5%, and the female sterility trait is stable and unaffected by environmental conditions. Furthermore, male fertility is completely normal except for female sterility. Through plant biotechnology, the DP1 protein and its encoding gene of this invention will play an important role in utilizing heterosis in crops and removing paternal seeds in hybrid seed production. This invention provides a new component for the development of novel hybrid breeding technologies for rice and has broad application prospects. Attached Figure Description

[0033] Figure 1 It is wild type (93-11) and dp1 Comparison of seed setting rate and pistil morphology in mutants.

[0034] Figure 2 Is the pollen in the wild type (93-11) and dp1 The pollen tube growth status 60 min after germination on the mutant stigma. The arrow points to the position reached by the tip of the pollen tube.

[0035] Figure 3 yes DP1 The location interval marker loss status (a), and a schematic diagram of the missing fragments and candidate genes (b).

[0036] Figure 4 This is a schematic diagram of the gene editing vector structure.

[0037] Figure 5 It is a knockout mutant KO-8 and KO-23 The mutated sequence.

[0038] Figure 6 It is wild type, KO-8 and KO-23 The morphology of stamens (top row) and pistils (bottom row), with each arrow pointing to a stigma of the mutant.

[0039] Figure 7 yes dp1 mutants and complementary strains pC1300-DP1-16 The fruit set rate, pollen starch staining and stigma morphology.

[0040] Figure 8 yes DP1 Relative expression levels in different tissues of rice. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels. The rice plant materials used in the following embodiments (including...) dp1 The mutant is available to the public from the applicant and is used solely for verifying the invention; it may not be used for any other purpose. The following examples are merely illustrations, and the public may also employ other methods. DP1 The gene-deleted mutant was used for verification.

[0042] The female sterility described in this invention specifically refers to the abnormal development of female reproductive organs in plants (the inability to produce normal pistils, ovaries, or normal female gametophytes) and the loss of female fertility caused by functional changes in plant cell nuclear genes, i.e., female nuclear sterility. The abnormality and recovery of female reproductive organ fertility are both controlled by nuclear genes.

[0043] Example 1: Screening and Phenotypic Identification of Female-Sterile Mutants in Rice In a cobalt-60 radiation mutant library of the indica rice variety 93-11, a family with an extremely low seed setting rate was found in the M2 generation, with the average seed setting rate of sterile plants being approximately 0.5%. This mutant was named... dp1 Wild-type plants of the same lineage produced fruit normally after self-pollination under bagging, while... dp1 The mutant is infertile. However, pollination of rice variety 93-11 with the mutant as the male parent resulted in normal seed production. Pollen staining with an iodine-potassium iodide solution (0.6% KI, 0.3% I2, w / w) showed that both mutant and wild-type pollen grains were round, uniform in size, and stained blue-black. Cultivation of pollen grains released on the same day in 1% glucose medium resulted in normal germination of both mutant and wild-type pollen grains. These experiments indicate that the sterility of this mutant is female sterility. In the self-pollination progeny of heterozygous individuals obtained through artificial pollination, the number of fertile and sterile plants were 162 and 51 respectively, conforming to a 3:1 segregation ratio, indicating... dp1 Female infertility is a recessive trait controlled by a single locus. For three consecutive years... dp1 The mutant was sown monthly in Lingao and Lingshui, Hainan Province, to investigate its photothermal characteristics. The results showed... dp1 The fact that the female remains infertile throughout indicates that this infertility trait is stable and unaffected by environmental factors such as light and temperature.

[0044] Compared to wild type 93-11 ( Figure 1 ), dp1 The mutant and spikelet morphology were normal. Under a stereomicroscope, there was no significant difference between the stamens of the mutant and the wild type, and the pollen morphology and germination were normal. Except for the ovary being lighter in green, the morphology of the mutant pistil was almost the same as that of the wild type. However, some mutant pistils had multiple stigmas.

[0045] Florals were collected 60 minutes after self-pollination and fixed overnight with Carnoy's fixative (ethanol: glacial acetic acid, volume ratio 3:1), then transferred to 70% ethanol for long-term preservation. The pistils were dissected under an optical microscope in 70% ethanol and rehydrated using a series of gradually diluted ethanol solutions (50%, 30%, 10%) and distilled water (20 minutes each). The samples were then treated in 1M sodium hydroxide solution at 55°C for 30 minutes, followed by rinsing three times with distilled water. The samples were stained with 0.1% (w / w) aniline blue in 0.1 M K3PO3 (pH 8.5) for 6–8 hours and imaged under a microscope with UV excitation. Compared to the wild type, pollen tubes showed increased activity after pollen germination. dp1 Elongation is severely inhibited in the stigma of the mutant. Figure 2 ).

[0046] Example 2: Rice female sterility gene DP1 Genetic localization For cloning DP1 Genes, we will... dp1 The mutant was crossed with the indica rice variety Longke 638S to construct an F3 mapping population. Preliminary localization will... DP1 The locus is located on the short arm of chromosome 7. Within the mapping region, some primers failed to amplify in the mutant, indicating a possible large deletion. The MkF2 / MkR2 primers amplified in both wild-type and mutant strains, while the MkF3 / MkR3 primers amplified only in the wild-type. Similarly, the MkF5 / MkR5 primers were effective in both lines, but the MkF4 / MkR4 primers failed to amplify in the mutant.

[0047] Based on the Nipponbare genome sequence, we designed flanking primers MkF1 (upstream of MkR2) and MkR1 (downstream of MkF5) to identify... dp1 Mutation. PCR amplification using this primer pair produced no product in the wild type, but amplification products were found in the mutant; comparison of the mutant amplification products with the Nipponbare genome sequence revealed... dp1 The mutant contains a 37.9 kb fragment ( Figure 3The missing fragment contains a predicted gene encoding the WD40 protein, the corresponding sequence of which is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.3.

[0048] Example 3 DP1 Obtaining and phenotypic analysis of gene knockout lines Knockout using CRISPR / Cas9 DP1 Genes are used to verify gene function. The steps are as follows: According to the method of Ma et al. (Ma X, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. MolPlant, 2015, 8: 1274-84), DP1 Gene target sites 1 and 2 are ligated into the vector pC9M middle( Figure 4 ), obtain carrier pC9M-DP1 .

[0049] The target site sequence is as follows: SEQ ID NO.4: CGTAGCTGCGCGCTGAGGTGC SEQ ID NO.5: ACAAGAGTCTTCGAGAGAAC The vector was transferred into Agrobacterium strain EHA105 via electroporation and used to infect callus tissue of japonica rice Zhonghua 11. Regenerated transgenic lines were obtained after hygromycin resistance selection, differentiation, and rooting. Sequencing confirmed that the two knockout lines... KO-8 (1 bp T deletion in exon 2) and KO-23 (4 bp missing CTTG) Figure 5 A frameshift mutation occurs.

[0050] Furthermore, both knockout lines exhibited extremely low seed setting rates, with normal stamens but a small number of pistils displaying a multi-stigma morphology, consistent with... dp1 The mutants were essentially identical. Both knockout lines showed normal vegetative growth and pollen fertility, but some pistils exhibited increased stigma branching (approximately 40% had three stigmas and 10% had four stigmas), with an average seed set rate of 0.43%. Figure 5 The pollen tubes also stopped at the top of the ovary, and the embryo sac developed abnormally. dp1 Phenotypic consistency. The offspring of heterozygotes after self-fertilization conform to Mendelian segregation at a ratio of 3:1 (fertile: sterile).

[0051] Example 4 dp1 Obtaining and phenotypic analysis of mutant transgenic complementary lines Using genomic DNA from sequence 93-11 as a template, primers DP1G-F: CATGATTACGAATTCGAGCTCGGTACCCAAAGCGAAGGACACGAACACA (SEQ ID NO.6) and DP1G-F: GACGTTGTAAAACGACGGCCAGTGCCAGCCCATGTGGTAATCCCTT (SEQ ID NO.7) were used to amplify the DNA containing the following genes: DP1 The full-length gene fragment, 1851 bp upstream of the start codon ATG and 767 bp downstream of the stop codon TAG, was extracted. This fragment was ligated into pCAMBIA1300 to obtain plasmid pC1300-DP1. pC1300-DP1 was then transformed into Agrobacterium strain EH105 via electroporation, resulting in infection. dp1 Sixteen transgenic positive plants were obtained from mutant callus tissue through resistance selection, differentiation, and rooting. Among them, 15 plants partially regained fertility, and 1 plant... pC1300-DP1-16 Fertility fully restored ( Figure 7 ).

[0052] In summary, the present invention has discovered DP1 When gene expression is disrupted, rice exhibits nuclear sterility-type female sterility, with female seed setting rate dropping below 0.5%, and the female sterility trait remains stable and unaffected by environmental conditions, while male fertility remains completely normal; further... DP1 Introducing gene deletion materials DP1 Genes can restore female fertility in rice.

[0053] Example 5 DP1 Gene expression analysis according to DP1 Primers DP1-qF: TGCAATCGGCTCTCTCATGT (SEQ ID NO.8) and DP1-qR: GCGAGTCTTCGGCCATCTTA (SEQ ID NO.9) were designed based on the nucleotide sequences of the genome and coding regions of rice, while using rice as a base. GADPH Primers were designed to use the gene as an internal control: GADPH-ACF1: GAATGGCTTTCCGTGTT (SEQ ID NO. 10) and GAPDH-ACR1: CAAGGTCCTCCTCAACG (SEQ ID NO. 11). Expression levels were analyzed using real-time quantitative PCR.

[0054] cDNA synthesis: Incense spikes from different stages (93-11), ranging from young spikelet 1 (1-1.5 mm long) to young spikelet 8 (reaching maximum spikelet length) (refer to Feng et al., 2009, Rice pollen development process and its stages, Chinese Journal of Rice Science, 2001, 15: 21-28), as well as young roots, stems, nodes, leaves, leaf sheaths, and seeds were selected; transported in liquid nitrogen and stored at -80℃; RNA was extracted from the above tissues using the TRIzol RNA extraction kit (Invitrogen), and immediately processed using PrimeScript. RT Use the reagent kit (TaKaRa) to reverse transcribe RNA into cDNA according to the instructions.

[0055] Real-time PCR: using MonAmp TM SYBR ® The Green Master Mix kit was used, and fluorescence was amplified and detected using a PikoReal 96 real-time PCR instrument (Thermo Fishe). Leaves were used as a control group, and 2... -ΔΔCT The method calculates the concentration of each sample. DP1 The relative expression levels were determined. The quantitative PCR reaction system was as follows: SYBR Green Mix 5 μL, Forward Primer 0.5 μL, Reverse Primer 0.5 μL, cDNA 1 μL, and ultrapure water 3 μL. The PCR reaction program was: denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s, annealing-extension at 60℃ for 1 min, for 40 cycles. The melting curve was initiated at 60℃ for 30 s; the final temperature was 95℃; the holding time was 1 s; and the temperature increment was 0.2℃ / cycle.

[0056] The results are as follows Figure 8 As shown, DP1 The gene is mainly expressed in the young panicle, while its expression level is relatively low in the roots, stems, stem nodes, leaves, leaf sheaths and seeds of rice; the expression is highest in the first stage of the young panicle, then gradually decreases, and rises again in the 7th-8th stage.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. DP1 protein, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

3.

2. The gene encoding the DP1 protein of claim 1.

3. The gene according to claim 2, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

4. A biomaterial, characterized in that, It contains the DP1 protein as described in claim 1 or the gene as described in claim 2 or 3.

5. The biomaterial according to claim 4, characterized in that, The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant cells or tissues.

6. The use of the DP1 protein of claim 1, the gene of claim 2 or 3, or the biomaterial of claim 4 or 5 in the preparation of transgenic rice.

7. The use of the DP1 protein of claim 1, the gene of claim 2 or 3, or the biological material of claim 4 or 5 in at least one of the following aspects: (1) Regulating female fertility in rice; (2) To create nuclear-sterile female-sterile rice; (3) Create rice with female fertility.

8. The application according to claim 7, characterized in that, By disrupting or eliminating the expression or activity of the DP1 protein of claim 1 or the gene of claim 2 or 3 in rice, nuclear sterility-type female sterility is induced in rice. Alternatively, rice can be restored to female fertility by producing or having the expression or activity of the DP1 protein of claim 1 or the gene of claim 2 or 3.

9. The application according to claim 8, characterized in that, When nuclear sterility occurs in females, the female seed setting rate drops to below 0.5%. And / or, the nuclear sterile female infertility is a recessive nuclear sterile female infertility.

10. A method for regulating female fertility in rice, characterized in that, include: By disrupting or eliminating the expression or activity of the DP1 protein of claim 1 or the gene of claim 2 or 3 in rice, nuclear sterility-type female sterility is induced in rice. Alternatively, rice can be restored to female fertility by producing or having the expression or activity of the DP1 protein of claim 1 or the gene of claim 2 or 3.

Images