Liriodendron Pol III promoter for improving editing efficiency of CRISPR / Cas9 system and application of liriodendron Pol III promoter
By screening and optimizing the Pol III promoter of Liriodendron tulipifera, a highly efficient CRISPR/Cas9 gene editing vector was constructed, which solved the problem of low gene editing efficiency in woody plants and achieved efficient gene editing and molecular breeding effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-04-10
AI Technical Summary
The existing CRISPR/Cas9 system has low gene editing efficiency and insufficient target specificity in woody plants. It fails to effectively utilize the species-specific promoter of Liriodendron tulipifera, resulting in low gene editing efficiency and significant off-target effects.
We screened and optimized the Pol III promoters of Liriodendron tulipifera, especially the LhU3-3, LhU4, LhU6-3, LhU6-5, LhU6-6, and LhU6-7 promoters, and constructed a highly efficient CRISPR/Cas9 gene editing vector suitable for hybrid Liriodendron tulipifera. Through bioinformatics identification and experimental verification, we improved the expression efficiency and editing efficiency of sgRNA.
It significantly improved the gene editing efficiency of hybrid tulip trees, realizing efficient gene editing and molecular breeding, providing technical support for improved hybrid tulip tree varieties, and enhancing the specificity and success rate of gene editing.
Smart Images

Figure CN121825968A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to a tulip tree Pol III promoter for improving the editing efficiency of the CRISPR / Cas9 system and its application. Background Technology
[0002] The hybrid tulip tree (Liriodendron chinense × L. tulipifera) is an interspecific hybrid of the genus Liriodendron, exhibiting significant hybrid vigor, characterized by rapid growth, excellent timber properties, and strong resistance to adverse conditions, playing an important role in ecological restoration and timber production. In recent years, a stable somatic embryogenesis and genetic transformation system technology platform has been established for this species, but systematic research on gene editing technology has not yet been carried out.
[0003] The groundbreaking development of CRISPR / Cas9 gene editing technology has provided a new pathway for the targeted creation of plant mutant materials and the analysis of regulatory networks for important traits. However, the sgRNA transcription mode regulated by the Arabidopsis AtU3 / AtU6 promoter in existing vector systems generally suffers from low genome editing efficiency and insufficient target specificity in woody plants. Previous studies have shown that differences in the conservation of RNA polymerase III promoters among different species can lead to significant differences in gRNA transcription efficiency, resulting in low gene editing efficiency, significant off-target effects, and even complete failure to edit the target site. Therefore, establishing species-specific promoter systems has become a core breakthrough for improving gene editing efficiency.
[0004] As can be seen from the above, it is necessary to systematically optimize the expression regulation of sgRNA, screen out more efficient promoter elements, and provide key technical support for molecular breeding of tulip trees. Summary of the Invention
[0005] To address the aforementioned problems in the prior art, the primary technical problem solved by this application is to provide a tulip tree Pol III promoter for improving the editing efficiency of the CRISPR / Cas9 system. The secondary technical problem to be solved by this application is to provide a specific application of the aforementioned tulip tree Pol III promoter for improving the editing efficiency of the CRISPR / Cas9 system.
[0006] To solve the above-mentioned technical problems, the technical solution of this application is as follows:
[0007] A tulip tree Pol III promoter, characterized in that the tulip tree Pol III promoter is one of LhU3-3, LhU3-4, LhU6-3, LhU6-5, LhU6-6, and LhU6-7, and the nucleotide sequences of LhU3-3, LhU3-4, LhU6-3, LhU6-5, LhU6-6, and LhU6-7 are shown in SEQ ID NO.1-6 respectively.
[0008] The application of the described Liriodendron tulipifera Pol III promoter in improving the CRISPR / Cas9 gene editing efficiency of Liriodendron tulipifera.
[0009] A CRISPR / Cas9 gene editing vector for tulip trees, wherein the sgRNA promoter in the tulip tree CRISPR / Cas9 gene editing vector is the tulip tree Pol III promoter.
[0010] Recombinant cells containing the Liriodendron tulipifera CRISPR / Cas9 gene editing vector.
[0011] The application of the CRISPR / Cas9 gene editing vector for tulip trees in the identification of gene function or molecular breeding of tulip trees.
[0012] A method for CRISPR / Cas9 gene editing in tulip trees, the steps of which are as follows:
[0013] The nucleic acid sequence of the target gene site is constructed into the CRISPR / Cas9 gene editing vector of Liriodendron tulipifera as described in claim 3 to obtain a CRISPR / Cas9 gene editing recombinant plasmid; the CRISPR / Cas9 gene editing recombinant plasmid is transformed into Agrobacterium tumefaciens to infect Liriodendron tulipifera, and positive transformants are screened to achieve CRISPR / Cas9 gene editing of the target gene of Liriodendron tulipifera.
[0014] In some embodiments, the method of infecting tulip trees with Agrobacterium is specifically to infect tulip tree callus tissue.
[0015] In some embodiments, the method for screening positive transformants is gene sequencing.
[0016] In some embodiments, the method for constructing the Liriodendron tulipifera CRISPR / Cas9 gene editing vector includes: sequentially linking the nucleotide sequence of the Liriodendron tulipifera Pol III promoter with the sgRNA nucleotide sequence of the target gene to obtain a recombinant fragment; and linking the recombinant fragment with an expression vector to obtain the Liriodendron tulipifera CRISPR / Cas9 gene editing vector.
[0017] Compared with the prior art, the beneficial effects of this application are as follows:
[0018] This application obtained multiple *Liriodendron tulipifera* Pol III promoters (endogenous U3 / U6 promoters) through bioinformatics and experimental identification. Starting with vector element optimization, a highly efficient CRISPR / Cas9 editing system suitable for hybrid *Liriodendron tulipifera* was systematically constructed. Using embryogenic callus tissue from the hybrid *Liriodendron tulipifera* variety 'Nanlin-Jinsen E1' as material, and selecting the LhPDS gene as the visual reporter gene, CRISPR / Cas9 gene editing vectors containing promoter combinations from different sources were systematically constructed. Results showed that after transformation with the Cas9-LhPDS gene editing vector, both white and yellow callus tissues were generally obtained after resistance selection. Further Sanger sequencing of the target sites showed that white callus tissues were mostly from successfully edited lines, while yellow callus tissues were mostly from wild-type lines. Statistical analysis of the proportion of albino callus tissues in all transgenic lines and target amplicon sequencing analysis showed a significant positive correlation between the callus albino proportion and gene editing efficiency (R0). 2 = 0.7187, P < 0.0001). Furthermore, there is a certain degree of positive correlation between sgRNA expression level and gene editing efficiency (R0 = 0.7187, P < 0.0001). 2 = 0.3760, P < 0.0001. Among them, the editing efficiency of the endogenous Pol III promoters LhU6-3 / 5 / 6 / 7 and LhU3-3 / 4 in hybrid tulip mania varieties was the highest (69.58-76.75%), while the editing efficiency of the BpU3-7 and BpU6-2 promoters in birch was the lowest (19.23% and 6.77%), and the editing efficiency of the Arabidopsis thaliana AtU3d promoter was in the middle (40.99%). This application optimized the expression of sgRNA through a promoter selection system, built a high-efficiency CRIPSR / Cas9 gene editing system suitable for hybrid tulip mania, and successfully achieved large-fragment editing of functional genes by combining different sgRNA promoters, providing solid technical support for gene editing improvement and molecular breeding of hybrid tulip mania varieties. Attached Figure Description
[0019] Figure 1 Multiple sequence alignment, cloning verification, and CRISPR / Cas9 vector design diagrams for core elements of the LhU3 / U6 promoter: (a) Multiple sequence alignment analysis of AtU3 / U6 and LhU3 / U6 promoter USE and TATA-like box, (b) PCR amplification verification of LhU6 promoter clone, (c) PCR amplification verification of LhU3 promoter clone, (d) Single-target CRISPR / Cas9 vector structure design based on LhPDS gene with different Pol III promoters;
[0020] Figure 2Figures showing the effects of different U3 / U6 promoters on the albino callus phenotype after LhPDS gene editing and their quantitative analysis: (a) a magnified detail of the restored callus phenotype after LhPDS gene editing, (b) a schematic diagram of the differences in albino callus area induced by typical U3 / U6 promoters (AtU3d, LhU6-3, LhU6-10), and (c) a statistical comparison of the proportion of albino callus area induced by all U3 / U6 promoters.
[0021] Figure 3-1 Figure 1 shows the positive identification results of LhPDS gene-edited callus from hybrid tulip tree: (a) Comparison of callus phenotypes of successfully edited (albino) LhPDS gene and unedited (yellow) callus; (b) PCR verification of transgenic callus based on vector-specific primers (+: plasmid positive control; -: non-transgenic wild type).
[0022] Figure 3-2 Figure 1 shows the sequencing results for positive identification of LhPDS gene-edited callus in hybrid tulip tree: (c) sequencing results of LhPDS target sites in albino callus, (d) sequencing results of LhPDS target sites in yellow callus.
[0023] Figure 4 Figure showing the results of relative expression levels of sgRNA under different U3 / U6 promoters;
[0024] Figure 5 Figure 1: LhPDS gene editing efficiency mediated by sgRNA driven by different LhU3 / U6 promoters and results of multidimensional association analysis: (a) Distribution of LhPDS gene target site editing types regulated by LhU3 / U6 promoter-regulated sgRNA; (b) Statistical analysis of gene editing efficiency and the proportion of base deletion, insertion and unedited types under sgRNA driven by different LhU3 / U6 promoters; (c) Collinearity analysis of gene editing efficiency with the proportion of albino callus area and sgRNA expression level. Detailed Implementation
[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art. Alternatively, they may be carried out according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0026] Example 1
[0027] I. Materials and Methods
[0028] Plant material: embryogenic callus from the hybrid tulip tree variety 'Nanlin-Jinsen E1'.
[0029] Experimental equipment: sterile workbench, incubator, shaker, PCR instrument, electrophoresis apparatus, gel imaging system, centrifuge, constant temperature water bath, confocal microscope, sterile filter paper, petri dishes, conical flasks, pipettes, and precision weighing balance.
[0030] 1. Whole genome DNA extraction
[0031] Weigh 0.2 g of fresh hybrid tulip tree callus tissue, add two 4 mm diameter stainless steel grinding beads, and flash freeze in liquid nitrogen. Preheat CTAB lysis buffer containing β-mercaptoethanol to 65 °C, and prepare chloroform-isoamyl alcohol (24:1), pre-cooled isopropanol, 75% ethanol, and TE buffer containing RNase A.
[0032] The sample was ground into powder in liquid nitrogen, and 800 µL of preheated CTAB lysis buffer was added. After mixing, the sample was lysed in a water bath at 65 °C for 30 min, with the mixture being inverted and mixed every 10 min. After cooling, an equal volume of chloroform-isoamyl alcohol was added, and the mixture was vortexed and centrifuged at 12,000 rpm for 10 min.
[0033] Collect the supernatant, add an equal volume of pre-cooled isopropanol, mix gently, and let stand at -20℃ for 1–2 h. Centrifuge at 12000 rpm for 10 min to collect the precipitate, wash twice with 75% ethanol, and air dry.
[0034] Add 50–100 µL of TE buffer and incubate at 37°C for 2 h. DNA quality and purity are assessed using NanoDrop and agarose gel electrophoresis.
[0035] 2. Identification and cloning of endogenous U3 / U6 promoters in Liriodendron tulipifera
[0036] To obtain Pol III promoters suitable for gRNA expression in the CRISPR / Cas9 system of hybrid tulip tree, this paper conducts bioinformatics mining and identification of homologous promoters in tulip tree based on the annotated U3 and U6 snRNA gene promoter sequences in Arabidopsis thaliana.
[0037] First, the genomic location information of Arabidopsis U3 and U6 snRNA genes and their upstream 500 bp promoter sequences were downloaded from the NCBI GenBank database. Potential U3 and U6 gene loci were screened in the Liriodendron tulipifera whole genome database using the BLASTn tool. By aligning U3 / U6 sequences from Arabidopsis, the 5' upstream sequence regions of homologous genes in hybrid Liriodendron tulipifera were identified. Several high-confidence homologous fragments were selected from the alignment results, and their downstream regions were manually located to determine if they were adjacent to snRNA-like genes or other non-coding RNA sites, thus excluding functionally insignificant fragments. The approximately 300 bp upstream sequence of these candidate regions was extracted as potential promoter regions. Subsequently, bioinformatics analysis was used to predict the presence of structures similar to TATA boxes or USE (upstream sequence elements) in these candidate sequences.
[0038] After bioinformatics identification of the U3 / U6 promoter sequence, cloning was further carried out to obtain promoter elements that can be used to construct gRNA expression vectors. First, based on the identified candidate promoter sequences, specific PCR primers were designed using PrimerPremier software, ensuring that the primer binding region did not cross repetitive sequences, the GC content was controlled between 40% and 60%, and the primer length was 20–24 bp. Subsequently, according to the designed primers (Table 1), PCR amplification was performed using genomic DNA from hybrid goosefoot callus as a template, employing a high-fidelity DNA polymerase.
[0039] Table 1. Primer sequence information for LhU3 / U6 promoter cloning
[0040]
[0041] Using hybrid tulip tree DNA as a template, PCR reactions were performed according to the following configurations (Tables 2 and 3):
[0042] Table 2 LhU3 / U6 promoter cloning PCR reaction system
[0043]
[0044] Table 3. LhU3 / U6 promoter cloning PCR reaction procedure
[0045]
[0046] The target DNA fragment was purified and recovered using a DNA gel extraction kit manufactured by TSINGKE. The specific steps are as follows:
[0047] (1) Cutting of target fragment: The target gel strip was quickly cut under 365 nm UV (single exposure < 15 s), placed in a 1.5 mL EP tube and weighed.
[0048] (2) Gel dissolution: Add 300 µL Buffer GL for every 100 mg of gel, and heat at 65°C with shaking until the gel is completely dissolved into a yellow solution.
[0049] (3) Nucleic acid adsorption: After the solution is cooled to 37°C, it is transferred to the adsorption column and centrifuged at 12,000 rpm for 1 min.
[0050] (4) Impurity elution: Discard the filtrate, add 700 µL Buffer W2, centrifuge at 12000 rpm for 1 min; repeat the washing once.
[0051] (5) Drying the adsorption column: remove residual ethanol by 2 min of air separation, and then open the cap and ventilate for 5 min to dry.
[0052] (6) Nucleic acid elution and detection: Add 30–50 µL ddH2O to the center of the membrane, let stand for 2 min, centrifuge to collect the product, and perform concentration and quality detection.
[0053] The recovered DNA fragments were ligated into the TSV-007B intermediate vector according to the following steps, as shown in Table 4:
[0054] Table 4 Intermediate Carrier Connection System
[0055]
[0056] After incubating the reaction system at 25°C for 10 min, DH5α competent cell transformation was performed.
[0057] (1) Take 100 µL of competent cells thawed on ice, add 10 µL of ligation product, gently pipette to mix, and let stand in an ice bath for 25 min.
[0058] (2) Transfer the system to a 42℃ water bath for 45-60 s heat shock, and immediately put it back into an ice bath for 2 min.
[0059] (3) Add 700 µL of antibiotic-free LB liquid medium, mix well, and culture at 37°C and 200 rpm for 1 h.
[0060] (4) Take an appropriate amount of bacterial solution and spread it on LB solid medium containing ampicillin. After absorption, invert the culture dish and incubate overnight at 37°C.
[0061] After a single colony has formed, positive clones need to be identified by colony PCR. The primers (5'-3') for single-clone positive verification are as follows:
[0062] M13-pF: TGTAAAACGACGGCCAGT,
[0063] M13-pR: CAGGAAACAGCTATGACC.
[0064] The specific experimental setup and procedures are shown in Tables 5 and 6 below:
[0065] Table 5. PCR reaction system for monoclonal positive verification
[0066]
[0067] Table 6. PCR reaction procedure for monoclonal positive verification
[0068]
[0069] The length of PCR bands in the bacterial culture was examined by gel electrophoresis, and a portion of single-clone bacterial cultures were sequenced. The correctly sequenced bacterial cultures were then cultured overnight in LB broth containing ampicillin antibiotic to extract plasmids. The specific steps are as follows:
[0070] (1) Bacterial collection: Take 1-1.5 mL of bacterial solution, centrifuge at 12000 rpm for 2 min, and discard the supernatant.
[0071] (2) Cell resuspension: Add 100-200 µL of solution I and vortex until the cells are completely resuspended.
[0072] (3) Cell lysis: Add 200-400 µL of solution II, gently invert and mix 5-10 times, and let stand on ice for 2-3 minutes.
[0073] (4) Neutralization reaction: Add 300-600 µL of solution III, invert and mix 10-15 times, and let stand on ice for 5-10 minutes.
[0074] (5) Centrifugation: Centrifuge at 4℃ and 12000 rpm for 10-15 min, and transfer the supernatant to a new tube.
[0075] (6) Plasmid precipitation: Add an equal volume of isopropanol or 2 to 2.5 times the volume of anhydrous ethanol to the supernatant, mix well and let stand at room temperature for 10 to 15 min (or at -20℃ for 30 to 60 min).
[0076] (7) Precipitation washing: Centrifuge at 12000 rpm for 10-15 min, discard the supernatant, and wash the precipitate twice with 1 mL of pre-cooled 70% ethanol.
[0077] (8) DNA dissolution: After drying the precipitate, add 20-50 µL of TE buffer or sterile double-distilled water to dissolve it, and test the concentration and purity (A260 / A280 should be 1.8-2.0). If it is qualified, it can be used for subsequent experiments.
[0078] 3. Screening of LhPDS gene target sites
[0079] The website http: / / crispr.hzau.edu.cn / CRISPR2 / was used to search for all PAM sequences in the LhPDS gene sequence, as well as the 20 bases immediately upstream of the PAM sequence, as candidate target sequences.
[0080] All candidate target sequences were NGG-encoded and BLAST-aligned with the genome of hybrid tulip tree to assess their specificity, excluding all target sequences that were highly similar to multiple other sites.
[0081] Further screening was conducted on target sequences that were close to the 5' end, had a GC content of over 40%, and did not contain more than 4 consecutive T sequences.
[0082] The 3' end of the target sequence was bound to sgRNA, and its secondary structure was analyzed using the website http: / / www.unafold.org / mfold / applications / rna-folding-form-v2.php. It was ensured that there were no more than 7 consecutive base pairs to avoid inhibiting the binding of sgRNA to the chromosomal DNA target sequence, thus ultimately determining the LhPDS gene target site.
[0083] 4. Construction of single-target gene editing vectors
[0084] The gene editing vector system designed in this application has a uniform sgRNA backbone sequence, with differences only in the selection of U3 / U6 promoter elements. To achieve precise assembly of the vector backbone and regulatory elements, the first step is to design specific homologous arms for each type of promoter and sgRNA sequence. By introducing 15–20 bp homologous sequences at the 5' and 3' ends of the target fragment, respectively, the directional fusion of two DNA fragments can be achieved using overlap extension PCR technology. The primer sequence information used for adding homologous sequences to each U3 / U6 promoter and sgRNA is as follows (Table 7):
[0085] Table 7. Primer sequence information for PCR extension of U3 / U6 promoter and sgRNA fragment overlap.
[0086]
[0087] Using the U3 / U6 promoter and sgRNA fragment as DNA templates, PCR products were obtained using the primers listed above. Then, using the PCR products of each U3 / U6 promoter and sgRNA as templates, overlap extension PCR was used to ligate the promoter and sgRNA together. The universal primer sequences (5'-3') for overlap extension PCR are shown below:
[0088] Uni-Overlap-F: TAAGGCGCGCCGTAGTGCTCGACTAGTA,
[0089] Uni-Overlap-R:TAGCTCGAGAGGCGCGCCAATGATACCGACGCGT
[0090] Each PCR amplification product was recovered, followed by plasmid digestion and vector assembly. The specific reaction system and procedure are shown below (Tables 8 and 9):
[0091] Table 8 CRISPR / Cas9 vector plasmid digestion system
[0092]
[0093] Table 9 CRISPR / Cas9 vector plasmid recombination and ligation system
[0094]
[0095] The CRISPR / Cas9 vector plasmid digestion program is as follows: 37℃, 1 h; 80℃, 30 min; 4℃, ∞.
[0096] The CRISPR / Cas9 vector plasmid recombination and ligation reaction procedure is as follows: 37℃, 1 h; 4℃ ∞.
[0097] The recombinant products were transformed into DH5α Escherichia coli competent cells. Specific transformation procedures can be found in "2. Identification and Cloning of the Endogenous U3 / U6 Promoter in Liriodendron tulipifera". The following primers (5'-3') were used to verify each vector:
[0098] SP-L2-New:GTCGTGTCCACATGTTGACCGGTAA,
[0099] M13 Forward: TGTAAAACGACGGCCAGT.
[0100] After confirming the accuracy of the vector plasmid sequencing results, it was introduced into EHA105 Agrobacterium. The specific experimental procedure is as follows:
[0101] EHA105 Agrobacterium competent cells were rapidly removed from their -80°C cryogenic storage environment and thawed on ice. 5 µL of the target plasmid (approximately 1–2 µg) was added to 100 µL of Agrobacterium competent cells and mixed thoroughly. The mixture was incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, then incubated in water at 37°C for 5 min, followed by an ice bath for 5 min. 700 µL of antibiotic-free liquid LB medium was added, and the cells were incubated at 28°C and 220 rpm for 2–3 h using a shaker. The supernatant was removed by centrifugation at 6000 rpm for 1 min, and the remaining bacterial culture was resuspended by pipetting and evenly spread onto kanamycin-containing LB medium.
[0102] Invert the inoculation plate and place it in a 28°C incubator. Incubate statically for 2–3 days until single colonies are visible. Select typical colonies and inoculate them into LB broth containing the same concentration of kanamycin. Amplify the culture by shaking at 28°C and 220 rpm for 16 h. Use an appropriate amount of the bacterial culture directly as a PCR template. The primer combination and reaction parameters used should be completely consistent with the previous plasmid validation experiment.
[0103] 5. Genetic transformation of callus from hybrid tulip trees
[0104] Pre-culture of hybrid tulip tree callus: The callus was placed on 3 / 4MS solid medium containing 1 mg / mL acetylsyringone (AS) and cultured for 20-25 days until the vigorous growth period, and then used for Agrobacterium infection.
[0105] Agrobacterium culture and preparation: Agrobacterium containing the target plasmid was cultured in LB liquid medium containing kanamycin until the OD600 reached 0.7–0.9. The cells were collected by centrifugation at 6000 rpm for 8 min and resuspended in 3 / 4 MS liquid medium containing 1 mg / mL AS.
[0106] Infection treatment and co-culture: The callus tissue was broken up and flushed into an Erlenmeyer flask with Agrobacterium tumefaciens solution, and shaken at 90 rpm for 10 min. After filtration, the liquid was blotted dry with sterile cotton, and the callus tissue was transferred to 3 / 4 MS solid medium containing 1 mg / L AS and incubated in the dark at 25°C for 48 h.
[0107] Bacterial removal and positive callus screening: After co-culture, the callus tissue was rinsed three times alternately with 3 / 4 MS liquid medium containing 1000 mg / L cephalosporin and ddH2O. After drying, it was inoculated into 3 / 4 MS solid medium containing 500 mg / L cephalosporin. After 8 days, it was transferred to selection medium containing 500 mg / L cephalosporin and 85 mg / L G418, and the medium was changed every 30 days until callus formation was restored.
[0108] 6. Statistics on the area of callus recovery after whitening
[0109] To systematically quantify the albinism phenotype of callus recovery in hybrid tulip trees treated with different gene-editing vectors, this application establishes a quantitative evaluation scheme based on image analysis. ImageJ software was used for area statistical analysis of the albinism region in the callus. Callus tissues genetically transformed with each gene-editing vector were selected as samples. After recovery, high-resolution images of the same batch of transformed callus tissues were captured at the same time point under standardized light conditions, ensuring that each image included a scale bar to calibrate spatial resolution. To reduce ambient light interference, a pure black light-absorbing background was used during imaging, and camera parameters were fixed. At least three independent callus tissue samples were repeatedly photographed for each treatment group.
[0110] In the image analysis process, the original image is first imported into ImageJ software, and the spatial scale of the image is set using a scale bar to standardize the measurement units. The "Color Threshold" tool is used to perform color segmentation of the image. By adjusting the HSV color space threshold parameter, whitened regions (white) and non-whitened regions (yellow) are labeled respectively. Whitened regions are defined as the set of pixels with brightness values higher than the threshold and saturation values lower than the threshold. After region segmentation, the whitened callus area (Aw) and the total yellow-white callus area (At) are calculated separately, and the percentage of whitened area is calculated using the formula (Aw / At) × 100%.
[0111] To ensure the reliability of the experimental data, this experiment randomly selected three representative observation areas from each image for parameter measurement. The arithmetic mean of the measurements from the three areas was used as the quantitative indicator for the sample. In the data preprocessing stage, normality and homogeneity of variance tests were first performed on all exported datasets. When the data met the preconditions for parameter testing, one-way ANOVA was used to assess the statistical differences in the proportion of whitened callus area among different experimental groups to ensure the robustness of the statistical inference results.
[0112] 7. Determination of callus sgRNA expression level
[0113] This application used callus tissue from hybrid tulip trees treated with different gene-editing vectors as material. White and yellow callus tissues were mixed and homogenized before sampling. RNA extraction was performed using the MolPure® Plant RNA Kit, as follows:
[0114] Tissue lysis and RNA release: Take 100–200 mg of fresh callus tissue, flash freeze in liquid nitrogen, and grind into powder. Add 1 mL of lysis buffer LB, grind into a homogenate at room temperature, transfer, vortex to mix, and centrifuge at 12000 rpm for 10 min (4℃). Take 480 µL of supernatant, add 240 µL of pre-chilled anhydrous ethanol, and gently mix.
[0115] RNA purification and DNase treatment: Transfer the mixture to an RNA adsorption column P4, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Add 350 µL of protein removal buffer PL, let stand for 1 min, and then centrifuge for 30 s. Add 50 µL of freshly prepared DNase I working solution to the center of the column membrane and incubate at room temperature for 15 min to digest genomic DNA.
[0116] Impurity removal and RNA elution: Add 350 µL of PL and centrifuge for 30 s, then add 500 µL of PW wash buffer and centrifuge for 30 s. Repeat the washing process twice. Centrifuge the empty column for 2 min to remove residual liquid. Transfer the adsorption column to a new tube, add 30–50 µL of RNase-free H2O to cover the column membrane, let stand for 2 min, then centrifuge to collect RNA. Store at -80℃ for later use.
[0117] RNA was reverse transcribed into cDNA. This experiment used the Novozymes HiScript II 1st Strand cDNA Synthesis Kit. The specific reaction system and procedure are as follows (Table 10):
[0118] Table 10 Reverse transcription reaction system
[0119]
[0120] The reverse transcription reaction program was as follows: 25℃, 5 min; 50℃, 15 min; 85℃, 2 min.
[0121] gRNA primers were designed using Oligo7, and the differences in gRNA expression levels in callus recovery from hybridization with different vectors were examined by qPCR. This experiment used Vazyme's SupRealQ Purple Universal SYBR qPCR Master Mix reagent; the specific reaction system and procedure are as follows (Table 11):
[0122] Table 11 qPCR reaction system
[0123]
[0124] II. Experimental Results
[0125] 1. Identification and cloning of the promoter LhU3 / U6 in hybrid tulip tree varieties
[0126] This application referenced the AtU3b and AtU6-26 promoter sequences of Arabidopsis thaliana, using an E-value threshold of 0.0001. BLASTn alignment of the genome of the hybrid Liriodendron tulipifera 'Nanlin-Jinsen E1' yielded 6 candidate AtU3b homologous sequences (LhU3-1~6) and 13 candidate AtU6-26 homologous sequences (LhU6-1~13). The upstream 300 bp of each sequence was extracted as a potential promoter and structurally aligned with the Arabidopsis thaliana U3 / U6 promoter. LhU3-6, LhU6-11, and LhU6-12 lacked typical TATA-like boxes and upstream cis-acting elements (USE), failing to meet the characteristics of Pol III promoters, and were therefore excluded. Finally, 16 sequences, LhU3-1~5 and LhU6-1~10, 13, were selected for cloning. Except for LhU6-5, which was not successfully amplified, the other 15 sequences all yielded clear bands. Figure 1 ).
[0127] 2. Statistics on the proportion of callus albinism in LhPDS gene-edited hybrid tulip tree varieties
[0128] Callus restored by LhPDS gene editing in hybrid tulip tree exhibited a mixed white and yellow appearance. The area of callus albino under different vectors was statistically analyzed, with the AtU3d promoter as a control. Results showed that the albino area induced by LhU3-3, LhU6-3, LhU6-5, and LhU6-7 promoters was significantly higher than that induced by AtU3d; while the albino area induced by BpU3-7 and BpU6-2 was significantly lower than that induced by AtU3d. The LhU6-10 promoter only produced yellow callus, with no white callus observed; LhU6-13 failed to restore callus after multiple transformations. Figure 2 ).
[0129] 3. Verification of callus recovery from LhPDS gene editing using different LhU3 / U6 promoters
[0130] To verify the positive results of transgenic hybrid tulip tree callus, three white and three yellow callus fragments were randomly selected from the callus regenerated by each vector for verification. PCR results showed that all types of regenerated callus were transformed into the vector. To detect whether the LhPDS gene editing status differed between yellow and white callus, portions of yellow and white callus fragments from each promoter were randomly selected and subjected to DNA target sequence determination. The results showed that all white callus fragments were edited, while all yellow callus fragments were unedited. Figure 3-1 , Figure 3-2 ).
[0131] 4. Assay of sgRNA expression activity driven by different LhU3 / U6 promoters
[0132] This experiment used qRT-PCR to determine the expression activity of sgRNAs driven by different LhU3 and LhU6 promoters. The results showed that among the tested promoters, the LhU3-2 promoter exhibited the highest sgRNA expression activity among U3 promoter types, while the LhU6-3 promoter exhibited the highest sgRNA expression activity among U6 promoter types. Compared to AtU3d, the relative sgRNA expression levels of most LhU6 and LhU3 promoters were generally higher than those of AtU3d, while those of BpU3-7 and BpU6-2 were lower than those of AtU3d. The average sgRNA expression level of the LhU6 promoter was slightly higher than that of the LhU3 promoter. Figure 4 ).
[0133] 5. Analysis of high-throughput sequencing results
[0134] To understand the effects of different promoters on the gene editing efficiency and editing type of hybrid tulip tree callus using the CRISPR / Cas9 system, this application used 14 tulip tree LhU3 / LhU6 promoters, 2 birch promoters (BpU3-7 / BpU6-2), and the control Arabidopsis thaliana AtU3d promoter to drive sgRNA expression. The resulting edited callus was subjected to amplicon sequencing, and the positive callus from each vector was sent to 3 independent lines. In terms of editing efficiency, the AtU3d promoter callus editing efficiency was 40.99%. The editing efficiencies of LhU6-3 (76.75%), LhU6-7 (76.08%), LhU3-3 (74.58%), LhU6-5 (72.32%), LhU6-6 (71.96%), and LhU3-4 (69.58%) promoters were significantly higher than AtU3d, while the editing efficiencies of BpU3-7 (19.23%) and BpU6-2 (6.77%) promoters were significantly lower than AtU3d. Furthermore, no editing events were detected in LhU6-10, consistent with its sgRNA expression activity assay results and albino callus ratio. Figure 5 Regarding editing types, most promoter-mediated gene editing was predominantly base deletion, and all editing sites were located within 3–8 bp upstream of the PAM site. Pearson correlation analysis showed a high linear correlation between the proportion of albino callus and gene editing efficiency, indicating that the callus albino rate can be used to preliminarily assess editing efficiency. Furthermore, compared to Arabidopsis and birch promoters, the U3 / U6 promoter-driven sgRNAs from the hybrid tulip tree yielded a more diverse range of editing types. (Table 12)
[0135] Table 12 Statistical analysis of sequencing results of optimized amplicon from hybrid tulip tree sgRNA promoter
[0136]
[0137]
[0138]
[0139]
[0140] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.
Claims
1. A Liriodendron tulipifera Pol III promoter, characterized by, The Liriodendron chinense Pol III promoter is one of LhU3-3, LhU3-4, LhU6-3, LhU6-5, LhU6-6 and LhU6-7, and the nucleotide sequences of the LhU3-3, LhU3-4, LhU6-3, LhU6-5, LhU6-6 and LhU6-7 are shown in SEQ ID NO. 1-6, respectively.
2. The Liriodendron chinense Pol III promoter of claim 1 is applied to improve the efficiency of CRISPR / Cas9 gene editing of Liriodendron chinense.
3. A Liriodendron CRISPR / Cas9 gene editing vector, characterized in that, The sgRNA promoter in the CRISPR / Cas9 gene editing vector of Liriodendron chinense is the Liriodendron chinense Pol III promoter of claim 1.
4. A recombinant cell containing the CRISPR / Cas9 gene editing vector of Liriodendron chinense of claim 3.
5. The CRISPR / Cas9 gene editing vector of Liriodendron chinense of claim 3 is applied to the identification of gene function or molecular breeding of Liriodendron chinense.
6. A method of Liriodendron CRISPR / Cas9 gene editing, comprising, The steps are as follows: The nucleic acid sequence of the target site of the target gene is constructed into the CRISPR / Cas9 gene editing vector of Liriodendron chinense of claim 3 to obtain a CRISPR / Cas9 gene editing recombinant plasmid; the CRISPR / Cas9 gene editing recombinant plasmid is transformed into Agrobacterium to infect Liriodendron chinense, and positive transformants are screened to realize CRISPR / Cas9 gene editing of the target gene of Liriodendron chinense.
7. The method of Liriodendron CRISPR / Cas9 gene editing according to claim 6, wherein, The method for infecting Liriodendron chinense with Agrobacterium is specifically to infect Liriodendron chinense callus.
8. The method of Liriodendron CRISPR / Cas9 gene editing according to claim 6, wherein, The method for screening positive transformants is gene sequencing. 9.The method of claim 3, wherein the Liriodendron CRISPR / Cas9 gene editing vector is constructed by, Comprise: The nucleotide sequence of the Liriodendron chinense Pol III promoter of claim 1 is sequentially connected with the sgRNA nucleotide sequence of the target gene to obtain a recombinant fragment; the recombinant fragment is connected with an expression vector to obtain the CRISPR / Cas9 gene editing vector of Liriodendron chinense.