Application of rape BnaALaAT1 gene in cultivation of waterlogging-resistant plant varieties
By applying the BnaALaAT1 gene to rapeseed and constructing an overexpression vector for genetic transformation, the trade-off between stress resistance and yield in rapeseed breeding was solved, achieving high yield and high oil content under adverse conditions, thus breaking through the limitations of traditional breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
- Filing Date
- 2025-12-05
- Publication Date
- 2026-04-10
AI Technical Summary
In existing rapeseed breeding, there is a trade-off between stress resistance and yield. Traditional methods are difficult to maintain high yield and high quality under adverse conditions, and the stress resistance genes screened in the laboratory lose their function under field compound stress, making it difficult to achieve stable and high rapeseed yield.
By using the rapeseed BnaALaAT1 gene, an overexpression vector was constructed and genetically transformed to obtain the versatile gene BnaALaAT1, which regulates the plant's response mechanism to various adversities, enhances its survival ability, and promotes high photosynthetic efficiency and high yield.
Under both normal and adverse conditions, rapeseed transgenic BnaALaAT1 showed significantly better performance than wild-type rapeseed, with yield increases of up to 53.7% and oil content increases of 23%, breaking the bottleneck in the trade-off between stress resistance and yield and achieving synergistic optimization of stress resistance, high yield, and high oil content.
Smart Images

Figure CN121826006A_ABST
Abstract
Description
[0001] This application is a divisional application of the original application filed on December 5, 2025, with application number 202511821447X and invention title "Application of the BnaALaAT1 gene of rapeseed in the breeding of stress-resistant and high-yielding plant varieties". Technical Field
[0002] This invention relates to the field of plant genetic engineering technology, specifically to the application of the rapeseed BnaALaAT1 gene in the cultivation of waterlogging-tolerant plant varieties. Background Technology
[0003] Rapeseed is my country's largest oilseed crop, with domestically produced rapeseed oil accounting for more than 55% of total oil production from oilseed crops. Stable and high rapeseed yields are of great significance for the secure supply of edible vegetable oil.
[0004] Rapeseed's stress resistance (salt tolerance, cold tolerance, waterlogging tolerance, low nitrogen tolerance) and yield (thousand-seed weight, number of pods per plant, number of seeds per pod) are typical quantitative traits controlled by multiple genes, governed by independent yet overlapping regulatory networks, and easily interact with the environment. In traditional breeding, enhancing stress resistance often comes at the cost of yield reduction: on the one hand, rapeseed needs to consume large amounts of carbon and nitrogen resources to synthesize osmotic regulators such as proline and betaine when responding to adversity, crowding out the allocation of resources during the reproductive growth stage; on the other hand, most stress-related genes (such as stress-response transcription factors) may interfere with developmental pathways such as flowering regulation and photosynthetic product translocation, leading to a decrease in seed setting rate. In addition, stress-resistant genes screened under laboratory conditions often show functional failure under combined field stress (such as low temperature + waterlogging, salt stress + low nitrogen), further exacerbating the difficulty of synergistic improvement of rapeseed's stress resistance and high yield. For example, Chinese patent (CN106434740B) discloses the application of the rapeseed BnbHLH60 gene in increasing seed weight. Overexpression of this gene in Arabidopsis thaliana revealed significant increases in grain length, width, and weight in the transgenic lines, with the increase in grain length exceeding that in width. This increase was primarily achieved through increased cell number, with minimal impact on the number of grains per horn, ensuring a higher final yield. While this patent improves yield through gene overexpression, it fails to address the gene's impact on rapeseed stress resistance or consider the potential trade-off between stress resistance and yield. If this gene increases yield while simultaneously reducing rapeseed stress resistance, then in actual production, yield instability due to environmental stress may occur.
[0005] In recent years, research in crop molecular biology has confirmed that "multi-talented genes" can break the "trade-off effect" between stress resistance and yield by integrating multiple physiological processes and coordinating resource allocation, providing new ideas for rapeseed improvement. Drawing on the research logic of genes such as wheat ERECTA (simultaneously improving drought resistance and seed setting rate) and rice OsDREB1C (synergistically regulating photosynthesis, nitrogen use, and yield), the focus in rapeseed has shifted to exploring two types of "multi-talented genes": one type consists of core genes regulating signaling pathways, which balance stress response and yield formation by simultaneously activating stress resistance and growth pathways; the other type consists of key genes involved in metabolism, which enhance stress resistance and promote grain development by optimizing sugar transport, ion balance, or amino acid synthesis. By utilizing these multi-talented genes, it is hoped that new rapeseed varieties that can maintain high yields under adverse conditions can be bred, providing genetic resources and technological support for the sustainable development of the rapeseed industry. Summary of the Invention
[0006] The main objective of this invention is to propose the application of the rapeseed BnaALaAT1 gene in the breeding of waterlogging-tolerant plant varieties. The aim is to provide a gene that can improve the resistance to various stresses, increase photosynthetic efficiency, and enhance yield and quality in rapeseed varieties. The target gene BnaALaAT1 was obtained through multi-omics analysis. After constructing an overexpression vector and performing genetic transformation, phenotypic examinations of transgenic lines and wild-type plants confirmed that the gene possesses multiple resistances (salt tolerance, low nitrogen tolerance, cold tolerance, and waterlogging tolerance), high photosynthetic efficiency, high yield, and high oil content.
[0007] To achieve the above objectives, this invention proposes the application of the rapeseed BnaALaAT1 gene in any of the following: (1) Application in the cultivation of salt-tolerant plant varieties; (2) Application in the cultivation of low-nitrogen tolerant plant varieties; (3) Application in the cultivation of cold-resistant plant varieties; (4) Application in the cultivation of waterlogged-tolerant plant varieties; (5) Application in promoting high light efficiency in plants; (6) Application in promoting high plant yield; The nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.1.
[0008] Preferably, the plant is rapeseed.
[0009] This invention also proposes the application of the BnaALaAT1 gene, as described above, in promoting high oil content in rapeseed.
[0010] The gene cloned in this invention encodes alanine transaminase (AlaAT), an enzyme widely distributed in the plant kingdom. It is a core hub connecting carbon and nitrogen metabolism in plants, crucial for plant growth, development, and environmental adaptation. AlaAT is present in almost all higher plants and distributed in various tissues and organs, such as leaves, roots, flowers, and developing seeds. Its core biochemical function is to catalyze the reversible transamination reaction between alanine and α-ketoglutarate, producing pyruvate and glutamate. This reaction is critical because the four substances it produces are all core intermediates in plant metabolism: pyruvate is a key molecule in carbohydrate metabolism, while glutamate is central to nitrogen assimilation and amino acid synthesis. Therefore, AlaAT acts as a bridge, coordinating the flow of the carbon skeleton and the distribution and reuse of nitrogen; by producing glutamate, AlaAT provides a nitrogen source for the synthesis of other amino acids and nitrogen-containing compounds, making it a key enzyme for the efficient use of nitrogen in plants. Alanine transaminase, through its core catalytic function, is deeply involved in multiple physiological processes from seed development to overall growth. In-depth research on its function is of great significance for guiding agricultural practices (such as cultivating nitrogen-efficient crops and rational fertilization).
[0011] Preferably, the amino acid sequence of the protein encoded by the rapeseed BnaALaAT1 gene is shown in SEQ ID NO.2.
[0012] The present invention also proposes the use of an expression vector comprising the BnaALaAT1 gene as described above in any of the following: (1) Application in the cultivation of salt-tolerant plant varieties; (2) Application in the cultivation of low-nitrogen tolerant plant varieties; (3) Application in the cultivation of cold-resistant plant varieties; (4) Application in the cultivation of waterlogged-tolerant plant varieties; (5) Application in promoting high light efficiency in plants; (6) Application in promoting high plant yield; The nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.1.
[0013] The present invention also proposes the use of a host cell comprising the expression vector described above in any of the following: (1) Application in the cultivation of salt-tolerant plant varieties; (2) Application in the cultivation of low-nitrogen tolerant plant varieties; (3) Application in the cultivation of cold-resistant plant varieties; (4) Application in the cultivation of waterlogged-tolerant plant varieties; (5) Application in promoting high light efficiency in plants; (6) Application in promoting high plant yield; The nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.1.
[0014] The present invention also proposes the use of a transgenic plant cell, tissue or organ comprising the BnaALaAT1 gene as described above in any of the following: (1) Application in the cultivation of salt-tolerant plant varieties; (2) Application in the cultivation of low-nitrogen tolerant plant varieties; (3) Application in the cultivation of cold-resistant plant varieties; (4) Application in the cultivation of waterlogged-tolerant plant varieties; (5) Application in promoting high light efficiency in plants; (6) Application in promoting high plant yield; The nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.1.
[0015] The present invention also proposes a primer pair for specifically amplifying the rapeseed BnaALaAT1 gene as described above, the sequences of which are shown in SEQ ID NO.5 and SEQ ID NO.6, or in SEQ ID NO.7 and SEQ ID NO.8.
[0016] The present invention also proposes the application of the primer pair as described above in any of the following: (1) Application in the cultivation of salt-tolerant plant varieties; (2) Application in the cultivation of low-nitrogen tolerant plant varieties; (3) Application in the cultivation of cold-resistant plant varieties; (4) Application in the cultivation of waterlogged-tolerant plant varieties; (5) Application in promoting high light efficiency in plants; (6) Application in promoting high plant yield; The sequences of the primer pairs are shown in SEQ ID NO.5 and SEQ ID NO.6, or in SEQ ID NO.7 and SEQ ID NO.8.
[0017] This invention also proposes a method for cultivating salt-tolerant, low-nitrogen-tolerant, cold-tolerant, or waterlogging-tolerant plant varieties, comprising the following steps: constructing an expression vector carrying the gene BnaALaAT1, introducing the expression vector into Agrobacterium, obtaining T0 generation containing the gene BnaALaAT1 through Agrobacterium transformation of plants, and obtaining pure lines transformed with BnaALaAT1 through three consecutive generations of screening; wherein the expression vector is pCAMBIA1301-BnaALaAT1.
[0018] This invention also proposes a method for promoting high light efficiency, high yield, or high oil content in plants, comprising the following steps: constructing an expression vector carrying the gene BnaALaAT1, introducing the expression vector into Agrobacterium, transforming plants with Agrobacterium to obtain T0 generation containing the gene BnaALaAT1, and obtaining pure lines transgenic with BnaALaAT1 through three consecutive generations of screening.
[0019] This invention also proposes an application of the rapeseed BnaALaAT1 gene as described above in plant breeding. By overexpressing the rapeseed BnaALaAT1 gene as described above, transgenic plants with improved salt tolerance, low nitrogen tolerance, cold tolerance, and waterlogging tolerance, as well as high light efficiency and high yield can be obtained.
[0020] Preferably, the plant is a plant of the genus Brassica or Arabidopsis.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention cloned the versatile gene BnaALaAT1 from rapeseed, constructed pure-line plants by transfecting them into rapeseed, and conducted phenotypic studies under various conditions. The experimental results showed that the rapeseed transgenic with the BnaALaAT1 gene had significantly better growth than the wild type under both normal conditions and various adverse conditions (waterlogging, salinity, cold, and low nitrogen), which fully demonstrates that this gene can enhance the plant's survival ability under various adverse conditions by regulating the plant's response mechanism to various adverse conditions, providing a key guarantee for the stable growth of plants under various adverse conditions. Compared with the wild type, the transgenic plants not only significantly increased yield, with a maximum increase of 53.7%, but also significantly increased oil content, with a maximum increase of 23%. This breaks through the traditional breeding bottleneck of "enhanced stress resistance often accompanied by a decrease in yield or quality", and achieves synergistic optimization of stress resistance, high yield, and high oil content, providing a brand-new gene solution for rapeseed production to balance yield and quality under adverse conditions.
[0022] (2) The discovery and application of the versatile gene BnaALaAT1 in this invention provides a clear functional gene target for improving crop waterlogging tolerance. By constructing an expression vector containing this gene and combining it with mature technologies such as Agrobacterium-mediated transformation, it can be stably introduced into target plants to obtain pure-line transgenic plants. The operation process is clear, controllable, and highly reproducible. The application of this gene resource not only shortens the breeding cycle of stress-resistant, high-yield, and high-oil-content varieties, but also simultaneously improves the stress resistance and yield traits of crops, breaking through the limitations of relying on natural variation in traditional breeding. It provides an efficient and precise technical path for cultivating new high-yield and high-oil-content crop varieties with strong stress resistance and wide adaptability. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This figure shows the results of the relative expression levels of the BnaALaAT1 gene in wild-type and BnaALaAT1 transgenic rapeseed lines of this invention.
[0025] Figure 2 This is a diagram showing the growth status of the wild-type and BnaALaAT1 transgenic rapeseed lines under normal conditions during the germination period.
[0026] Figure 3 This is a statistical result of the root length (a) and stem length (b) of the wild-type ZS9 and BnaALaAT1 transgenic lines during the germination period.
[0027] Figure 4 Figure (a) shows the growth status of the wild-type ZS9 and BnaALaAT1 transgenic lines of this invention under normal conditions when hydroponically cultured to the five-leaf stage. Figure (b) is a top view; Figure (c) is a plan view; Figure (d) shows the leaf anatomy of the wild-type and overexpression lines at the five-leaf stage.
[0028] Figure 5 Figure 1 shows the results of photosynthetic-related index measurements of the wild-type ZS9 and BnaALaAT1 transgenic lines under normal conditions during hydroponics to the five-leaf stage. Figure 2 shows the net photosynthetic rate of the wild-type ZS9 and BnaALaAT1 transgenic lines. Figure 3 shows the transpiration rate of the wild-type ZS9 and BnaALaAT1 transgenic lines. Figure 4 shows the intercellular CO2 concentration of the wild-type ZS9 and BnaALaAT1 transgenic lines. Figure 5 shows the stomatal conductance of the wild-type ZS9 and BnaALaAT1 transgenic lines. Figure 6 shows the SPAD of the wild-type ZS9 and BnaALaAT1 transgenic lines.
[0029] Figure 6 This is a cytological observation of the leaves of the wild-type ZS9 and BnaALaAT1 transgenic lines of this invention.
[0030] Figure 7 This is a growth diagram of the wild-type ZS9 and BnaALaAT1 transgenic lines during the flowering period of this invention.
[0031] Figure 8 This is a graph showing the oil content determination of the BnaALaAT1 overexpression strain and the wild type in this invention.
[0032] Figure 9 This is a graph showing the results of the fresh weight root-to-shoot ratio analysis of the wild-type ZS9 and BnaALaAT1 transgenic lines under low nitrogen conditions.
[0033] Figure 10 The figures show the phenotypic analysis results of the wild-type ZS9 and BnaALaAT1 transgenic lines under simulated waterlogging conditions. Figure (a) shows the survival rate of each line after 30 hours of flooding; Figure (b) shows the relative conductivity of each line under flooding stress; and Figure (c) shows the growth status of each line after 30 hours of flooding.
[0034] Figure 11 This figure shows the phenotypic analysis results of the wild-type ZS9 and BnaALaAT1 transgenic lines under simulated salt damage conditions.
[0035] Figure 12 Figure 1 shows the phenotypic analysis results of the wild-type ZS9 and BnaALaAT1 transgenic lines under low temperature. Figure 2 shows the germination test of the transgenic materials and wild-type transgenic materials under low temperature stress in the dark. The upper left is the wild-type ZS9, the upper right is the overexpression line AT1, the lower left is the low temperature resistant material C18, and the lower right is the low temperature sensitive material ZS6. Figure 3 shows the soil germination test of the transgenic materials and wild-type transgenic materials under low temperature stress.
[0036] Figure 13 Figure 1 shows the photosynthetic index measurement results of wild-type ZS9 and BnaALaAT1 transgenic lines at the five-leaf stage under low temperature. Figure 2 shows the net photosynthetic rate of different lines; Figure 3 shows the stomatal conductance of different lines; Figure 4 shows the intercellular CO2 concentration of different lines; and Figure 5 shows the transpiration rate of different lines.
[0037] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation
[0038] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0039] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.
[0040] Example 1: Cloning of the rapeseed multi-talent gene BnaALaAT1 Using ZS9 as material, total RNA was extracted using a plant total RNA mini-extraction kit (TransGold, ER501), and the first strand of cDNA was synthesized by reverse transcription using a cDNA kit (AT311). The gene fragment was amplified. The PCR reaction system was as follows: 10 µL Green TaqMix, 0.5 µL upstream primer (5'– CTGGTTTTGTGATTGGGCACC–3', SEQ ID NO.5), 0.5 µL downstream primer (5'– GCTTAACATATGCTCTCACACT–3', SEQ ID NO.6), 1 µL cDNA, 8 µL ddH2O, and a total volume of 20 µL. The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 5 min. The PCR products were recovered using a gel extraction kit (Omega, D2500), and then ligated into the pCE3 Blunt Vector to obtain the recombinant plasmid pCE3 Blunt Vector-BnaALaAT1. This plasmid was transformed into competent *E. coli* cells, and colonies were selected for PCR amplification. The target band was detected by agarose gel electrophoresis and then sequenced. The nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.1, with a molecular weight of 1877 bp, and its encoded amino acid sequence is shown in SEQ ID NO.2.
[0041] Example 2: Construction of an expression vector for the rapeseed multi-talent gene BnaALaAT1 Based on the target fragment and the pCAMBIA1301 vector, suitable homologous recombination primers were designed (F: 5'– acgggggacgagctcggtaccATGCGGAGATTCGTTATTGGC–3', SEQ ID NO.7; R: 5'– catgtcgactctagaggatccTTAGTTGCGGAACTCATCCATG–3', SEQ ID NO.8). Using ZS9 cDNA as a template, Green Taq Mix was used for amplification. The PCR products were separated and recovered by agarose gel electrophoresis, and the homologous recombination fragment of the BnaALaAT1 gene was extracted.
[0042] DNA from the plant overexpression vector pCAMBIA1301-35S plasmid was extracted using an Omega plasmid extraction kit (catalog number: D6943). The extracted plasmid was double-digested with BamHI and KpnI restriction enzymes. The digestion system consisted of 2 µL BamHI, 2 µL KpnI, 10×Fly Cut Buffer, 2 µg plasmid, and ddH2O to a total volume of 40 µL. The digestion was carried out at 37 °C for 2 h, and the target fragment was recovered and purified.
[0043] Next, the purified and recovered vector and target fragment were ligated using the ClonExpress II One Step Cloning Kit (Novizan, C112). The ligation system consisted of vector pCAMBIA1301-35S-NOS, target fragment 3.5 µL, 5×CE II Buffer 4 µL, Exnase II 2 µL, and ddH2O to a total volume of 20 µL. The mixture was incubated at 37°C for 30 min and then immediately transferred to ice for cooling, yielding the recombinant plasmid pCAMBIA1301-BnaALaAT1. Electrophoresis was performed using the upstream primer for the BnaALaAT1 gene and the downstream sequencing primer for the vector (F: 5'–ATGCGGAGATTCGTTATTGGC–3', SEQ ID NO.3; R: 5'–gcaatgaaactgatgcattg–3', SEQ ID NO.4). The ligated recombinant plasmid pCAMBIA1301-BnaALaAT1 was transformed into E. coli DH5α competent cells, colonies were selected for PCR amplification, and the target band was detected by agarose gel electrophoresis before being expanded into culture.
[0044] Example 3: Agrobacterium-mediated transformation and culture method in rapeseed The overexpression vector pCAMBIA1301 containing the BnaALaAT1 gene was transformed into competent Agrobacterium GV3101 to prepare Agrobacterium infection solution. Rapeseed inflorescences were then infected using the flower-dipping method. The infected plants were then covered with plastic film and cultured in the dark for 24 h before being transferred to a greenhouse for conventional cultivation. Once the rapeseed matured, seeds were harvested individually. The harvested rapeseed seeds were sterilized by low-temperature treatment at 4℃ and then sown in 1 / 2 MS solid medium containing the antibiotic Kan (50 μg / ml) to screen for positive seedlings. These positive seedlings were then transplanted into a culture medium (vermiculite: nutrient soil in a 1:1 volume ratio). After the seedlings grew, DNA was extracted from plant leaves and verified by PCR using the upstream and downstream primers for the BnaALaAT1 gene from Example 1, obtaining representative positive lines AT1~AT12. This genetic transformation experiment of infected rapeseed was commissioned to Wuhan Boyuan Biotechnology Co., Ltd., and the genetic transformation process and positive identification followed the company's experimental methods (https: / / plant.biorun.com / single / 20).
[0045] Example 4: Validation of expression levels in transgenic plants When the positive strains AT1~AT12 and wild-type ZS9 reached the three-leaf stage, approximately 0.1g of RNA was extracted from the second-to-last unfolded leaf. After reverse transcription using a uniform amount, qRT-PCR was performed. A 2 -ΔΔCt Data calculations were performed using the method described above. The results of comparing the overexpression levels of each strain with the wild type are as follows: Figure 1 As shown.
[0046] Example 5: Germination Period Growth Experiment Germination growth experiments were conducted using wild-type ZS9 and three lines: AT1, AT3, and AT9. A suitable amount of uniformly plump seeds were dispersed in petri dishes containing 1% agar medium and placed in a light incubator at 25°C for 16 hours of light followed by 8 hours of darkness for 5 days. Growth status, root length, and stem length were then statistically analyzed. Results are as follows: Figure 2 and Figure 3 As shown, the germination growth rates of transgenic lines AT1 and AT3 were significantly higher than those of the wild type. At 5 days, the stem length of AT1 was 1.79 times that of the wild type, and the root length was 1.23 times that of the wild type. The stem length of AT3 was 1.51 times that of the wild type, and the root length was 1.24 times that of the wild type. The growth rate of AT9 was close to that of the wild type, with a stem length of 1.44 times that of the wild type and a root length of 1.13 times that of the wild type.
[0047] Example 6 Seedling growth experiment Thirty seeds each of AT1 and wild-type ZS9 were placed on moist filter paper and cultured at 25°C for 16 hours under light / 8 hours in darkness for 7 days. Afterward, they were transplanted into hydroponics (the hydroponic nutrient solution formula was based on the normal nitrogen supply conditions in Table 1). Phenotypic analysis was conducted when the plants reached the five-leaf stage. The roots were then placed in water and completely separated. A WinRHIZO root scanner was used to scan and analyze the roots. Phenotypic results are as follows: Figure 4 As shown in Table 2, the number of leaves in the transgenic line AT1 (6.66 ± 0.33) increased by 33.2% compared to ZS9 (5.00 ± 0.00), while its SPAD value (15.33 ± 1.01) was significantly higher than that of ZS9 (8.60 ± 0.72), with an increase of 78.3%, indicating that AT1 has a stronger ability to accumulate photosynthetic pigments. Regarding root architecture, the taproot length of AT1 (23.17 ± 1.67 cm) increased by 21.8%, and the total root length (855.0 ± 84.1 cm) increased by 28.7%. Simultaneously, its root complexity significantly increased—the number of branches (7989.6 ± 552.8) increased by 16.4%, and the number of crossings (1325.0 ± 155.0) surged by 87.5%.
[0048] Table 1 Hoagland Nutrient Solution Formula (1 / 2 Concentration) Chemical reagents Normal nitrogen supply (μmol / L) Nitrogen deficiency (μmol / L) Chemical reagents Normal nitrogen supply (μmol / L) Nitrogen deficiency (μmol / L) Ca(NO3)2·4H2O 2500 125 CaCl2 - 2375 KNO3 2500 125 KCL - 2375 NH4NO3 1000 50 MnCl2.4H2O 4.5 4.5 KHPO4 500 500 <![CDATA[ZnSO4·7H2O]]> 0.3 0.3 <![CDATA[MgSO4·H2O]]> 1000 1000 <![CDATA[CuSO4·5H2O]]> 0.16 0.16 EDTA-Fe 80 80 <![CDATA[H3BO3]]> 20 20 <![CDATA[K2SO4]]> 250 250 <![CDATA[(NH4)6Mo7O 24 ·4H2O2]]> 0.16 0.16 Table 2. Phenotypic differences between wild-type ZS9 and transgenic lines at the five-leaf stage. index Number of leaves SPAD value Main root length (cm) Total root length (cm) Number of branches Cross number ZS9 5.00 ± 0.00 8.60 ± 0.72 19.02 ± 0.27 664.2 ± 56.0 6865.6 ± 536.9 706.6 ± 37.4 AT1 6.66 ± 0.33 15.33 ± 1.01 23.17 ± 1.67 855.0 ± 84.1 7989.6 ± 552.8 1325.0 ± 155.0 Significance of difference ↑ 33.3%** ↑ 78.2%* ↑ 21.8%* ↑ 28.7%* ↑ 16.4%* ↑ 87.5%** To investigate whether the BnaALaAT1 gene affects leaf photosynthetic efficiency, photosynthetic-related indicators were measured in wild-type and transgenic lines, and the results were obtained. Figure 5 A Li6800 photosynthesis meter (equipped with an independent leaf chamber for direct measurement of physiological indicators such as net photosynthetic rate, transpiration rate, SPAD value, stomatal conductance, and intercellular CO2 concentration in rapeseed experimental materials) was used. Figure 5The results showed that the SPAD values of the overexpression line AT1 at all leaf positions were higher than those of the wild type, with the second-to-last leaf being 66% higher and the third-to-last leaf being 78% higher. The overexpression lines showed significantly increased net photosynthetic rate, transpiration rate, and stomatal conductance compared to the wild type. The transgenic lines showed a 20.7%-28.5% increase in net photosynthetic rate, a 19%-88% increase in transpiration rate, and a 15%-117% increase in stomatal conductance. The intercellular CO2 concentration showed no significant difference from the wild type, but was 9.9% higher. These results indicate that overexpression of BnaALaAT1 can significantly increase chlorophyll content in rapeseed leaves, thereby increasing net photosynthetic rate, stomatal conductance, transpiration rate, and intercellular CO2 concentration. Leaves were collected and fixed in FAA solution (50% ethanol, 5% acetic acid, 10% formaldehyde). They were then prepared for paraffin embedding and sectioning. The cross-section was stained with toluidine blue (1% toluidine blue and 2% borate) and observed under an Olympus BX51 microscope equipped with a CCD camera. Results are as follows: Figure 6 As shown, the transgenic lines have significantly increased leaf thickness. The palisade tissue of wild-type leaves consists of 1-2 layers of loose short cells, while the palisade tissue of transgenic lines develops into 3-4 layers of tightly arranged long columnar cells. The chloroplast enrichment area is significantly expanded, and the spongy tissue is thickened.
[0049] Example 7: Investigation of agronomic traits at maturity of different genotype lines Each genotype line was cultivated and managed normally in an indoor growing room until maturity, and morphological indicators of each line were examined. Plant type comparisons are as follows: Figure 7As shown in Table 3, the data for this study were significantly improved compared to the wild type (ZS9). The transgenic plants showed a significant increase in the number of effective branches, the number of siliques, and the number of seeds per silique. Specifically, in terms of branch number, AT1 and AT3 increased by approximately 34.9% and 45.0% respectively compared to the wild type. The transgenic lines AT1 and AT3 (9.00±1.00 and 9.67±1.15 branches respectively) showed an average increase of approximately 40.0% compared to the wild type ZS9 (6.67±0.58 branches). Regarding the number of siliques, AT1 and AT3 increased by 44.5% and 65.4% respectively compared to the wild type. The AT1 and AT3 (53.00±7.81 and 60.67±10.02 siliques respectively) showed an average increase of approximately 55.0% compared to ZS9 (36.67±4.93 siliques). In terms of the number of seeds per silique, AT1 and AT3 increased by 30.6% and 38.3% respectively compared to the wild type. The AT1 and AT3 (14.80±0.35 and 15.67±1.15 seeds respectively) showed an average increase compared to ZS9 (11.33±0.58 siliques). The average yield per seed increased by approximately 34.5% (0.81 seeds). In terms of yield per plant, AT1 and AT3 (2.14±0.23 g / plant and 2.49±0.25 g / plant, respectively) showed an average increase of approximately 42.90% compared to ZS9 (1.62±0.17 g / plant). Specifically, AT1 showed a 32.10% increase over ZS9, and AT3 a 53.70% increase, demonstrating a significant yield advantage. Near-infrared spectroscopy was used to determine the seed oil content, and the results are as follows... Figure 8 As shown, the wild-type ZS9 had an oil content of 35.13%, while the transgenic line AT1 had an oil content of 43.32%, which was 23% higher than that of the wild-type.
[0050] Table 3. Investigation of yield-related traits in wild-type and transgenic lines index ZS9 (Wild Type) AT1 (GMO) AT3 (GMO) Number of branches (per plant) 6.67 ± 0.58 9.00 ± 1.00 9.67 ± 1.15 Number of siliques (seeds / plant) 36.67 ± 4.93 53.00 ± 7.81 60.67 ± 10.02 Number of grains per corner (grains / corner) 11.33 ± 0.81 14.80 ± 0.35 15.67 ± 1.15 Yield (g / plant) 1.62±0.17 2.14±0.23 2.49±0.25 Example 8: Experiments with different nitrogen concentrations Thirty seeds each of wild-type ZS9 and transgenic line AT1 were selected and cultured on moist filter paper at 25℃ for 16 h light / 8 h darkness for 7 days before being transplanted into hydroponics. The hydroponic solution was prepared according to Table 1. Data were collected after 22 days of hydroponics. The results showed that ( Figure 9 The root length of the overexpressing material was significantly higher than that of the wild control group under both normal and nitrogen-deficient conditions, with increases ranging from 33% to 47%. Under normal nitrogen conditions, the root-to-shoot ratio was 0.25 for ZS9 and 0.30 for AT1. Under nitrogen-deficient conditions, it was 0.38 for ZS9 and 0.68 for AT1. Under normal conditions, the root-to-shoot ratio of the overexpressing line AT1 was 20% higher than that of the wild type, and under nitrogen-deficient conditions, it was 79% higher. These results indicate that overexpression of the BnaALaAT1 gene significantly promotes root development in Brassica napus, primarily by promoting taproot elongation and lateral root development, and increasing the root-to-shoot ratio.
[0051] Example 9: Stain Resistance Test 300 uniform seeds from each of the wild-type ZS9 and transgenic lines AT1, AT3, and AT9 were dispersed in petri dishes pre-filled with moistened filter paper and placed in a light incubator at 25°C for 16 h of light and 8 h of darkness for approximately 2 days. Once the radicles reached 3-5 mm in length, a 30 h water immersion experiment and conductivity measurement were performed. (Conductivity measurement was conducted using a DDS-307A conductivity meter. The meter was turned on beforehand, the electrodes were cleaned, and conductivity and temperature were calibrated. The conductivity of the first leachate was measured and recorded as M1. Centrifuge tubes were incubated at 95°C for 30 min, and the conductivity of the leachate was measured and recorded as M2. The relative conductivity (M) was calculated using the following formula: M = M1 / M2). Each treatment consisted of 25 seeds, repeated three times. After 30 h of water immersion, the seeds were rinsed three times with pure water and then placed on moistened filter paper for 5 days to recover. Survival rates were recorded, and relevant indicators were measured. The results are shown below. Figure 10 As shown, by Figure 10 As shown in (a) and (c), the survival rate of the transgenic lines was significantly higher than that of the control. The conductivity results are as follows: Figure 10 As shown in (b), the relative electrical conductivity of the three transgenic lines was significantly lower than that of the wild type, suggesting that overexpression of BnaALaAT1 can improve the waterlogging tolerance of rapeseed by enhancing cell stability under flooding stress.
[0052] Example 10 Salt Tolerance Identification Test Prepare 100 mL of 214 mM solution. Take 8 mL and place it in a petri dish lined with clean filter paper. Take 25 uniform seeds from each of the wild-type ZS9 and transgenic line AT1 and place them in the petri dish. Seal the dish with sealing film and incubate at 25℃ for 5 days under 16 h light / 8 h dark conditions. Germination is considered complete when the radicle elongates to 2 mm. Calculate the germination rate. Results are as follows: Figure 11 As shown, ZS9 could not germinate normally under 214 mM NaCl treatment, while AT1 germination rate reached 100%. This indicates that overexpression of BnaALaAT1 can significantly improve salt tolerance during the germination period of rapeseed.
[0053] Example 11 Cold Resistance Identification Test Germination period: Different strains such as low-temperature resistant material C18, low-temperature sensitive material ZS6, wild-type ZS9 and overexpression line AT1 were selected. 25 uniform and plump seeds were scattered in petri dishes filled with moistened filter paper and placed in a low-temperature incubator at 4℃ in the dark for germination test. Germination was considered to have occurred when the radicle extended to 2 mm. The germination rate was counted at 9 am every day.
[0054] Each line was replicated three times, with 6 seeds per replicate. The seeds were sown in nutrient soil and placed in a low-temperature incubator at 8°C for 16 hours under light and 4°C for 8 hours in darkness. Germination was defined as when both cotyledons were fully expanded. Germination rate was recorded at 9:00 AM each day.
[0055] The results are as follows Figure 12 As shown, at 20 days, all seeds of C18 and the highly expressed line AT1 had germinated, and the growth status of AT1 was significantly better than that of C18, while only a small number of seeds of the low-temperature sensitive material ZS6 and wild-type ZS9 had germinated.
[0056] Its photosynthetic indices were measured at the three-leaf stage (specific method as described in Example 6), and the results are as follows: Figure 13 As shown, the net photosynthetic rate of the overexpressing lines increased by 31.4%-67.2% compared to the wild type; the transpiration rate increased by 15%-76% compared to the wild type. This indicates that the overexpression of BnaALaAT1 can still maintain the net photosynthetic rate advantage under low temperature stress.
[0057] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.
Claims
1. Application of the rapeseed BnaALaAT1 gene in the breeding of waterlogging-tolerant plant varieties, wherein the nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the rapeseed BnaALaAT1 gene is shown in SEQ ID NO.
2.
3. The application of an expression vector comprising the BnaALaAT1 gene as described in claim 1 in the cultivation of waterlogging-tolerant plant varieties, wherein the nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.
1.
4. The use of a host cell comprising the expression vector as described in claim 3 in the cultivation of waterlogging-tolerant plant varieties, wherein the nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.
1.
5. The use of a transgenic plant cell, tissue or organ comprising the BnaALaAT1 gene as described in claim 1 in the cultivation of waterlogging-tolerant plant varieties, wherein the nucleotide sequence of the BnaALaAT1 gene is shown in SEQ ID NO.
1.
6. The application of a primer pair in the cultivation of waterlogging-tolerant plant varieties, wherein the sequences of the primer pair are shown in SEQ ID NO.5 and SEQ ID NO.6, or in SEQ ID NO.7 and SEQ ID NO.
8.
7. A method for cultivating waterlogging-tolerant plant varieties, characterized in that, Includes the following steps: An expression vector carrying the gene BnaALaAT1 was constructed, and the expression vector was introduced into Agrobacterium. Plants were transformed by Agrobacterium to obtain T0 generation containing the gene BnaALaAT1. Pure lines transfected with BnaALaAT1 were obtained through three consecutive generations of screening. The expression vector was pCAMBIA1301BnaALaAT1.
8. An application of the rapeseed BnaALaAT1 gene as described in claim 1 in plant breeding, characterized in that, By overexpressing the rapeseed BnaALaAT1 gene as described in claim 1, waterlogging-tolerant transgenic plants were obtained.
Citation Information
Patent Citations
Application of the rapeseed BnbHLH60 gene in increasing rapeseed yield
CN106434740B