Construction method of artificial promoter of saccharomyces cerevisiae

By inserting LexA protein-affinity DNA elements into the Saccharomyces cerevisiae promoter backbone and recruiting multiple transcription factors, an artificial promoter for Saccharomyces cerevisiae was constructed, solving the problem of discontinuous regulation of enzyme expression levels and achieving more efficient regulation of transcription capacity and intensity.

CN121826019APending Publication Date: 2026-04-10ZHONGBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-15
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing Saccharomyces cerevisiae promoters exhibit significant intensity jumps and poor continuity in regulating enzyme expression levels, making it difficult to meet the needs of complex metabolic networks in synthetic biology. Furthermore, artificially designed promoters cannot flexibly and precisely adjust their intensity.

Method used

Artificial promoters for Saccharomyces cerevisiae were constructed by inserting LexA protein-affinity DNA elements upstream of the TATA frame of the promoter backbone to recruit subunits of RNA polymerase II and various transcriptional regulatory factors, forming single-factor or multi-factor recruitment promoters, thereby improving transcriptional capacity and strength continuity.

Benefits of technology

This achieves enhanced promoter transcriptional capacity and continuous improvement in strength, meeting the regulatory needs of complex metabolic pathways in synthetic biology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of artificial promoter construction, in particular to a method for constructing a saccharomyces cerevisiae artificial promoter. The invention discloses a construction method of a novel artificial promoter of saccharomyces cerevisiae. The artificial promoter of the saccharomyces cerevisiae provides a feasible method for constructing the promoter with higher transcriptional ability and higher continuity in the saccharomyces cerevisiae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of artificial promoter construction technology, and in particular to a method for constructing an artificial promoter of Saccharomyces cerevisiae. Background Technology

[0002] In the process of synthesizing natural products using microbial cell factories, regulating enzyme expression levels through different promoters to increase product yield is one of the important strategies in microbial catalytic synthesis. Taking the model strain *Saccharomyces cerevisiae* as an example, expression regulation at the gene transcription level generally employs endogenous natural promoters of varying strengths, including inducible promoters such as the GAL promoter (a promoter in the lactose synthesis pathway, galactose-dependent) and the CUP promoter (copper ion-dependent); and constitutive promoters such as TDH3p, FBA1p, PGK1p, and CYC1p (most of which originate from the glycolysis pathway, do not require induction from other substances, and remain constantly activated in the cell). Although these promoters can stably guide gene expression in yeast and can form a gradient arrangement within a certain range of strength, they still have significant shortcomings in precisely controlling enzyme expression. For example, the strength jumps between each promoter are large, the continuity is poor, the range of promoter strength needs to be improved, and the promoter strength is insufficient. When encountering complex metabolic networks or other challenges, they cannot adequately meet the current needs of cell factories in gene expression regulation for synthesizing natural products. With the development of synthetic biology, in addition to the natural promoters widely used in cell factory construction, researchers at home and abroad have also begun to study some artificially designed promoters. These include randomly mutating natural promoters to derive promoters of different strengths, inserting transcription factor binding sequences or upstream activation sequences (UAS) for gene transcription into the natural promoter backbone, altering the affinity of histones near the promoter for DNA, and modifying the 5'UTR region of a gene to prolong the half-life of mRNA. However, some of these modifications are irrational designs (random mutations), while others recruit single regulatory factors, such as regulating the UAS region (which, besides recruiting only a single transcription factor at each site, involves a very limited range of regulatory factors, requiring the transcription factor to contain a specific DNA-binding region, while polymerase subunits or transcription factors that assist transcription are not included in this range) or indirectly altering promoter strength from a non-DNA level (changing histones). These various shortcomings mean that the modified artificial promoters cannot flexibly and precisely adjust their strength according to needs, nor can they maximize their influence (promote or restrict) on transcription strength, thus having significant limitations. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for constructing an artificial promoter of Saccharomyces cerevisiae.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0005] In a first aspect, the present invention provides a method for constructing an artificial promoter of Saccharomyces cerevisiae, including a single-factor recruitment promoter and / or a multi-factor recruitment promoter;

[0006] The method for constructing the single-factor recruitment promoter includes the following steps:

[0007] A DNA element with affinity for the LexA protein is inserted at the recruitment site upstream of the TATA box in the promoter backbone to construct the promoter to be screened.

[0008] The first expression cassette of the promoter to be screened is used to obtain the promoter plasmid;

[0009] The recruited transcription regulatory factors are ligated into the second expression cassette to obtain a transcription regulatory plasmid;

[0010] The promoter plasmid to be screened and the transcription regulatory plasmid were introduced into a yeast chassis strain, cultured, and the artificial promoter that meets the conditions was obtained based on the expression results.

[0011] The first expression box may be the same as or different from the second expression box.

[0012] In some specific embodiments of the present invention, the promoter skeleton includes GAL1, GAL7, GAL10, GAL2, TDH3, TEF1, TPI1, GPM1, FBA1, PDC1, ENO2, PYK1, TEF2, PGK1, HXT7, TDH2, ADH1, or PGI1.

[0013] In some specific embodiments of the present invention, the promoter skeleton includes GAL1, GAL7, GAL10, GAL2, TDH3 or TEF1.

[0014] In some specific embodiments of the present invention, the recruitment sites include 1bp to 300bp.

[0015] In some specific embodiments of the present invention, the recruitment sites include 50 bp, 80 bp, 130 bp and / or 190 bp.

[0016] In some specific embodiments of the present invention, the recruited transcriptional regulatory factors include subunits of RNA polymerase II, Spt15, Rad3, Taf1, Cdc73, Paf1, Sin4, Srb4, Gal11, Rgr1, Rox3, Soh1, Rtt102, Snf5, Arp7, Fun30, Hpr1, Ino2, Met4, Gcn4, or Msn1.

[0017] In some specific embodiments of the present invention, the subunits of the RNA polymerase II include RPB1, RPB2, RPB3, RPB4, RPB5, RPB6, RPB7, RPB8, RPB9, RPB10, RPB11, or RPB12.

[0018] In some specific embodiments of the present invention, the yeast chassis strain includes one or more of the following: *Schizosaccharomyces pombe*, *Pichia pastoris*, *Y. lipolytica*, *R. glutinis*, *C. albicans*, *C. tropicalis*, *T. utilis*, or *S. roseus*.

[0019] In some specific embodiments of the present invention, the first expression cassette includes the expression cassette TDH2t-(2×Bsa1)-RFP-FBA1t on the Saccharomyces cerevisiae PRS425K vector;

[0020] The second expression cassette includes the expression cassette FBA1t-TDH3p-LexA-(2×Bsa1)-PGK1t on the Saccharomyces cerevisiae vector PRS414K;

[0021] The yeast chassis strain includes the CENPK-1D yeast chassis strain.

[0022] In some specific embodiments of the present invention, the recruitment site includes 130 bp upstream of the TATA frame of the GAL1 promoter, and the recruited transcriptional regulator includes Hpr1.

[0023] In some specific embodiments of the present invention, the multi-factor recruitment promoter further includes tandem protein fusion of the DNA binding domain of the LexA protein with GBD and SH3 to obtain LexA-(linker1)-GBD-(linker2)-SH3;

[0024] The LexA-(linker1)-GBD-(linker2)-SH3 was inserted into the expression cassette FBA1t-TDH3p-PGK1t and integrated into the delta15 site of the genome to obtain the yeast chassis strain ZB_GXJ02: CENPK-1D, delta15: FBA1t-TDH3p-LexA-GBD-SH3-PGK1t;

[0025] The recruited transcriptional regulators are linked to GBD ligands and SH3 ligands via linkers, with the GBD ligands and SH3 ligands positioned at the C-terminus of the recruited transcriptional regulators.

[0026] The recruited transcriptional regulatory factors were inserted into expression cassettes containing GBD ligands and expression cassettes containing SH3 ligands, respectively, to obtain corresponding plasmids. Fragment 1 and fragment 2 were excised and collected, and assembled into a linearized vector to obtain plasmids containing the recruited transcriptional regulatory factors, GBD ligands, and SH3 ligands.

[0027] The promoter plasmid to be screened and the plasmid containing the recruited transcriptional regulatory factor, GBD ligand and SH3 ligand were introduced into the yeast chassis strain ZB_GXJ02, cultured, and the qualified artificial promoter was obtained according to the expression results.

[0028] In some specific embodiments of the present invention, the expression cassette containing the GBD ligand includes the PRS425K-TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t plasmid;

[0029] The expression cassette containing the SH3 ligand includes the PRS425K-FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t plasmid;

[0030] Fragment 1 includes TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t;

[0031] Fragment 2 includes FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t;

[0032] The plasmid containing the recruited transcription regulator, GBD ligand, and SH3 ligand includes the PRS414K-TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t plasmid.

[0033] In some specific embodiments of the present invention, the recruited transcriptional regulatory factors include Ino2 and Paf1.

[0034] Secondly, the present invention also provides artificial promoters, plasmids and / or strains obtained by the construction method described above.

[0035] Thirdly, the present invention also provides applications of artificial promoters in improving transcriptional capacity, enhancing promoter strength continuity, and / or satisfying the regulation of complex metabolic pathways in synthetic biology.

[0036] This invention provides a method for constructing artificial promoters of *Saccharomyces cerevisiae*, comprising the following steps: (1) constructing a series of *Saccharomyces cerevisiae* single transcription factors to recruit artificial promoters and measuring the strength of all promoters; (2) constructing a series of *Saccharomyces cerevisiae* multi transcription factors to recruit artificial promoters and measuring the strength of all promoters. This invention utilizes synthetic biology methods to establish a series of artificial promoters for *Saccharomyces cerevisiae*, which on the one hand enhances the promoter transcription capacity to a greater extent; on the other hand, it can improve the continuity of promoter strength to a greater extent, better meeting the needs of complex metabolic pathway regulation in synthetic biology. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0038] Figure 1 Schematic diagram of single-factor recruitment promoters and multi-factor recruitment promoters;

[0039] Figure 2 This diagram illustrates the construction of the RFP expression module.

[0040] Figure 3 Diagram showing the construction of the single-factor recruitment module;

[0041] Figure 4 A diagram showing the modular structure of a single-factor recruitment promoter;

[0042] Figure 5 Diagram showing the construction of the Lex-GBD-SH3 module in the multifactor recruitment promoter;

[0043] Figure 6 Diagram showing the construction of the multi-factor recruitment module in the multi-factor recruitment promoter;

[0044] Figure 7 A diagram showing the modular structure of a multi-factor recruitment promoter;

[0045] Figure 8 The single-factor recruitment promoter expresses RFP, and its fluorescence intensity characterizes the promoter strength;

[0046] Figure 9 The study compares the mRNA levels and 7-dehydrocholesterol production of several single-factor and multi-factor recruiting promoters when expressing RFP or DHCR24. Detailed Implementation

[0047] This invention discloses a method for constructing an artificial promoter for *Saccharomyces cerevisiae*. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0048] This study aims to establish a novel artificially designed promoter based on previous promoter research. By combining an artificially designed composite protein module mediated by a protein scaffold with the DNA sequence inserted into the promoter, various transcription initiation complexes that directly control gene transcription, including RNA polymerases and transcription factors, or transcription activators responsible for enhancing transcription, are recruited. This will not only greatly enhance the transcriptional capacity but also improve the continuity of the transcribed gene, better meeting the application needs of complex metabolic pathways in synthetic biology.

[0049] Table 1. List of strains in the chassis

[0050]

[0051] Rpb10: QHB11804 https: / / www.ncbi.nlm.nih.gov / protein / QHB11804

[0052] Spt15: QHB08225 https: / / www.ncbi.nlm.nih.gov / protein / QHB08225.1

[0053] Rad3: QHB08249 https: / / www.ncbi.nlm.nih.gov / protein / QHB08249.1

[0054] Taf1: QHB08917 https: / / www.ncbi.nlm.nih.gov / protein / QHB08917.1

[0055] Cdc73, QHB10554 https: / / www.ncbi.nlm.nih.gov / protein / QHB10554.1

[0056] Paf1, KAJ1541025 https: / / www.ncbi.nlm.nih.gov / protein / KAJ1541025.1

[0057] Sin4, CAA96140 https: / / www.ncbi.nlm.nih.gov / protein / CAA96140.1

[0058] Srb4, AAA02632 https: / / www.ncbi.nlm.nih.gov / protein / AAA02632.1

[0059] Gal11, CAA99056 https: / / www.ncbi.nlm.nih.gov / protein / CAA99056.1

[0060] Rgr1, CAA97628 https: / / www.ncbi.nlm.nih.gov / protein / CAA97628.1

[0061] Rox3, CAA84915 https: / / www.ncbi.nlm.nih.gov / protein / CAA84915.1

[0062] Soh1, AAA35066 https: / / www.ncbi.nlm.nih.gov / protein / AAA35066.1

[0063] Rtt102, QHB08918 https: / / www.ncbi.nlm.nih.gov / protein / QHB08918.1

[0064] Snf5, CAA53652 https: / / www.ncbi.nlm.nih.gov / protein / CAA53652.1

[0065] Arp7, QHB12289 https: / / www.ncbi.nlm.nih.gov / protein / QHB12289.1

[0066] Fun30 QHB06628 https: / / www.ncbi.nlm.nih.gov / protein / QHB06628.1

[0067] Hpr1, QHB07599 https: / / www.ncbi.nlm.nih.gov / protein / QHB07599.1

[0068] Ino2, QHB07586 https: / / www.ncbi.nlm.nih.gov / protein / QHB07586.1

[0069] Met4, SGD:S000005047 https: / / www.yeastgenome.org / locus / S000005047

[0070] Gcn4, QHB08060 https: / / www.ncbi.nlm.nih.gov / protein / QHB08060.1

[0071] Msn1 CAA99135 https: / / www.ncbi.nlm.nih.gov / protein / CAA99135.1

[0072] DNA elements that are affinity for LexA protein: as shown in SEQ ID No. 1

[0073] Gtactgtatgtacatacagtacaactgtatatacacccaggg

[0074] The DNA-binding domain of the LexA protein: as shown in SEQ ID No. 2.

[0075] P1: As shown in SEQ ID No. 3

[0076] acggattagaagccgccgagcgggcgacagccctccgacggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaattaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttattgtactgtatgtacatacagtacaactgtatatacacccagggtctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatggaaaagctgcataaccactttaactaatactttcaacattttcagtttgtattacttcttattcaaatgtcataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaactata

[0077] P2: As shown in SEQ ID No.4

[0078] acggattagaagccgccgagcgggcgacagccctccgacggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaattaacgaatcaaattaacaaccataggagtactgtatgtacatacagtacaactgtatatacacccagggtgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatggaaaagctgcataaccactttaactaatactttcaacattttcagtttgtattacttcttattcaaatgtcataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaactata

[0079] P3: As shown in SEQ ID No.5

[0080] acggattagaagccgccgagcgggcgacagccctccgacggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaagtactgtatgtacatacagtacaactgtatatacacccagggcctggccccacaaaccttcaaattaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatggaaaagctgcataaccactttaactaatactttcaacattttcagtttgtattacttcttattcaaatgtcataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaactata

[0081] P4: As shown in SEQ ID No.6 [[ID=,5]]

[0082] Acggattagaagccgccgagcgggcgacagccctccgacggaagactctcctccgtgcgtcctcgtcttcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccgagtac tgtatgtacatacagtacaactgtatatacacccagggaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaacctggccccacaaaccttcaaattaa cgaatcaaattaacaaccataggatgataatgcgattagtttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatggaaaagctgcat aaccactttaactaatactttcaacattttcagtttgtattacttcttattcaaatgtcataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaactata

[0083] The DHCR24 gene was synthesized by the company and its codons were optimized to adapt to the Saccharomyces cerevisiae host, as shown in SEQ ID No. 7.

[0084]

[0085] The raw materials and reagents used in the method for constructing the artificial promoter of Saccharomyces cerevisiae provided by this invention can all be purchased from the market.

[0086] The present invention will be further illustrated below with reference to the embodiments:

[0087] Example 1: Design and Construction of a Single-Factor Recruitment Promoter

[0088] The method for designing and constructing an artificial promoter for recruiting single transcription factors in Saccharomyces cerevisiae according to the present invention is as follows:

[0089] 1. Obtaining endogenous functional gene elements

[0090] The following components were introduced as recruitment factors for the artificial promoter: RNA polymerase II (Pol II) subunits / universal transcription factors (GTFs), including Rpb10, Spt15, Rad3, and Taf1; components of the Paf1 complex, including Cdc7 and Paf1; subunits of the RNA Pol II mediator complex, including Sin4, Srb4, Gal11, Rgr1, Rox3, and Soh1; components of SWI / SNF and other chromatin remodeling-related proteins, including Rtt102, Snf5, Arp7, Fun30, and Hpr1; and factors related to metabolic and stress responses, including Ino2, Met4, Gcn4, and Msn1.

[0091] The genes encoding the transcription factors mentioned above, as well as other related elements, were obtained by PCR on the chromosome of Saccharomyces cerevisiae or through gene synthesis.

[0092] 2. Design and construction of single-factor recruitment promoters

[0093] To enhance the transcriptional function of artificially designed promoters, this study first selected the GAL1 promoter, one of the strongest natural promoters in *Saccharomyces cerevisiae*, as the backbone for modification. Using the DNA-binding domain of the Gal4 protein to bind with transcriptional regulatory factors can construct a single-transcription factor artificial promoter. However, considering that the GAL1 promoter is naturally regulated by the Gal4 protein and that a DNA element naturally binds to the Gal4 protein exists on the GAL1 promoter, the DNA-binding domain of LexA was fused with a transcriptional regulatory protein to guide this protein to regulate the modified promoter. Since transcription initiation requires RNA polymerase to bind to the upstream of the promoter's TATA frame, the positional barrier of artificially introduced transcriptional regulatory factors on RNA polymerase binding to the promoter must be considered when designing artificial promoters. Therefore, this study designed to insert DNA elements compatible with the LexA protein at 50 bp, 80 bp, 130 bp, and 190 bp upstream of the GAL1 promoter's TATA frame, respectively, resulting in P1, P2, P3, and P4. To investigate the effects of different transcription factors on gene transcription intensity, this study selected the following transcription factors for experiments: Rpb10, Spt15, Rad3, Taf1, Cdc73, Paf1, Sin4, Srb4, Gal11, Rgr1, Rox3, Soh1, Rtt102, Snf5, Arp7, Fun30, Hpr1, Ino2, Met4, Gcn4, and Msn1. The ORF frames of these proteins were linked into the expression cassette FBA1t-TDH3p-LexA-(2×Bsa1)-PGK1t on the Saccharomyces cerevisiae vector PRS414K, resulting in the plasmid PRS414K-FBA1t-TDH3p-LexA-linker-TF-PGK1t, where TF represents different transcription regulatory factors. To characterize the artificial promoter, red fluorescent protein (RFP) was selected as the reporter protein. The promoter Pn was ligated into the expression cassette TDH2t-(2×Bsa1)-RFP-FBA1t on the Saccharomyces cerevisiae PRS425K vector (Pn is the modified GAL1 promoter with the LexA specific DNA sequence inserted earlier), resulting in the plasmid PRS425K-TDH2t-Pn-RFP-FBA1t.

[0094] The constructed plasmids PRS414K-FBA1t-TDH3p-LexA-linker-TF-PGK1t and PRS425K-TDH2t-Pn-RFP-FBA1t were screened by colony PCR, and the plasmids were extracted and verified by single and double enzyme digestion and sequencing to ensure that the target fragment was correctly ligated and that no mutations occurred in the base sequence.

[0095] 3. Construct a Saccharomyces cerevisiae strain that expresses red fluorescent protein using a single transcription factor promoter.

[0096] First, plasmids PRS414K-FBA1t-TDH3p-LexA-linker-TF-PGK1t and PRS425K-TDH2t-Pn-RFP-FBA1t were introduced into CENPK-1D yeast substrate strains using the lithium acetate method. After transformation, the transformants were screened using SD-TRP-LEU-TRP solid plates (synthetic yeast nitrogen source YNB 6.7 g / L, glucose 20 g / L, mixed amino acid powder lacking tryptophan, leucine, histidine and uracil 2 g / L, 2% agar powder). The transformed strains were streaked and purified, and the yeast genome was extracted for PCR verification. The correctly verified recombinant strains were preserved as glycerol strains and named ZB_Sc001A01, ZB_Sc001A02, ZB_Sc001A03...ZB_Sc001A22, respectively.

[0097] in:

[0098] ZB_Sc001A01: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Rpb10-PGK1t, PRS425K-TDH2t-P1-RFP-FBA1t;

[0099] ZB_Sc001A02: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Spt15-PGK1t, PRS425K-TDH2t-P1-RFP-FBA1t;

[0100] ZB_Sc001A03: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Rad3-PGK1t, PRS425K-TDH2t-P1-RFP-FBA1t;

[0101] ZB_Sc001A04: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker-Taf1-PGK1t, PRS425K-TDH2t-P1-RFP-FBA1t;

[0102] ZB_Sc001A05: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Cdc73-PGK1t, PRS425K-TDH2t-P1-RFP-FBA1t;

[0103] ZB_Sc001A06: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Paf1 -PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0104] ZB_Sc001A07: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Sin4-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0105] ZB_Sc001A08: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Srb4-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0106] ZB_Sc001A09: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Gal11-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0107] ZB_Sc001A10: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Rgr1-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0108] ZB_Sc001A11: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Rox3-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0109] ZB_Sc001A12: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Soh1-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0110] ZB_Sc001A13: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Rtt102-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0111] ZB_Sc001A14: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Snf5-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0112] ZB_Sc001A15: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Arp7 -PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0113] ZB_Sc001A16: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Fun30-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0114] ZB_Sc001A17: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Hpr1-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0115] ZB_Sc001A18: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Ino2-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0116] ZB_Sc001A19: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Met4-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0117] ZB_Sc001A20: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Gcn4-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t;

[0118] ZB_Sc001A21: CENPK-1D, PRS414K-FBA1t-TDH3p-LexA-linker- Msn1-PGK1t,PRS425K-TDH2t-P1-RFP-FBA1t。

[0119] When the modified GAL1 promoter was replaced with P2, P3, and P4 respectively, strains ZB_Sc001B01-ZB_Sc001B21; ZB_Sc001C01-ZB_Sc001C21; and ZB_Sc001D01-ZB_Sc001D21 were obtained.

[0120] Control strain ZB_Sc001000: PRS414K, PRS425K-TDH2t-GAL1p-RFP-FBA1t;

[0121] ZB_Sc001A00: PRS414K, PRS425K-TDH2t-P1-RFP-FBA1t;

[0122] ZB_Sc001B00: PRS414K, PRS425K-TDH2t-P2-RFP-FBA1t;

[0123] ZB_Sc001C00: PRS414K, PRS425K-TDH2t-P3-RFP-FBA1t;

[0124] ZB_Sc001D00: PRS414K, PRS425K-TDH2t-P4-RFP-FBA1t;

[0125] 4. Compare the transcriptional capacity of different single-factor recruitment promoters.

[0126] Experimental materials: Control strains ZB_Sc001000, ZB_Sc001A00, ZB_Sc001B00, ZB_Sc001C00, ZB_Sc001D00 and experimental groups ZB_Sc001A01-ZB_Sc001A21; ZB_Sc001B01-ZB_Sc001B21; ZB_Sc001C01-ZB_Sc001C21; ZB_Sc001D01-ZB_Sc001D21.

[0127] Test method:

[0128] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract;

[0129] Fermentation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract.

[0130] The above-mentioned strains were inoculated into 5 mL of seed culture medium and cultured at 30 °C and 220 rpm for 14–16 h, with the initial cell concentration OD100 as the final concentration. 600=0.2 was inoculated into 2 mL of culture medium and cultured in deep-well plates at 30 °C and 220 rpm. 20 g / L galactose was added at 20 h and 40 h, and the cell density OD was monitored during the culture process and at 48 h. 600 and RFP fluorescence intensity.

[0131] Experimental Results: D-galactose in the culture medium acted as an inducer, responsible for initiating transcription of the modified GAL1 promoter. Initially, the presence of glucose in the medium inhibited GAL promoter transcription; as culture progressed, glucose was rapidly consumed, and when glucose was depleted, the glucose inhibition effect was relieved, allowing D-galactose to initiate transcription of the GAL promoter (including both the original and modified GAL promoters), thereby expressing RFP. Figure 8 Based on the RFP fluorescence intensity of strains ZB_Sc001A01-ZB_Sc001A21; ZB_Sc001B01-ZB_Sc001B21; ZB_Sc001C01-ZB_Sc001C21; and ZB_Sc001D01-ZB_Sc001D21, different artificial promoters exhibited different transcriptional abilities when the recruitment sites or the recruited transcription factors were different. Among them, when the recruitment site was 130 bp upstream of the TATA frame and the recruited transcription factor was Hpr1, the promoter strength was the strongest, reaching 2.05 times that of the original GAL1 promoter.

[0132] Example 2: Design and Construction of Multi-Transcription Factor Recruitment Promoters

[0133] 1. Obtaining exogenous functional gene elements

[0134] The DHCR24 gene underwent codon optimization to adapt to the Saccharomyces cerevisiae host and was synthesized by the company.

[0135] 2. Design and construction of multi-factor recruitment promoters

[0136] This applicant incorporated an intermediate mediator that facilitates the proximity of multiple transcription factors to the promoter backbone. First, the transcription factors under investigation were fused with GBD and SH3 ligands, respectively, via a protein linker with the ligands positioned at the C-terminus of the transcription factor. At this point, each transcription factor could spontaneously bind to the GBD and SH3 receptor proteins in the cell, guided by the ligands. We further utilized the characteristic of the LexA protein's DNA-binding domain to bind to specific DNA sequences by tandemly fusing the LexA protein's DNA-binding domain with GBD and SH3. Then, as the LexA DNA-binding domain bound to the modified GAL1 promoter (with DNA sequences that can bind to LexA inserted at different positions upstream of the TATA frame), and the GBD and SH3 ligands bound to the LexA-GBD-SH3 fusion protein, the ligand-fused transcription factors were pulled upstream of the GAL1 promoter TATA frame, synergistically influencing the transcriptional strength of the promoter. Similar to the single-transcription factor recruitment experiment design, a red fluorescent protein was selected as the reporter gene.

[0137] 3. Construction of multi-factor recruitment promoters

[0138] The expression module design consists of three parts:

[0139] Step 1: Construct gene expression cassettes TDH2t-GAL1p-(Bsa1)linker-GBD ligand-FBA1t and FBA1t-GAL7p-(Bsa1)linker-SH3 ligand-PGK1t. Different transcription factors were inserted into the restriction sites of these gene expression cassettes to obtain the plasmids PRS425K-TDH2t-GAL1p--transcription factor 1-linker-GBD ligand-FBA1t and PRS425K-FBA1t-GAL7p--transcription factor 2-linker-SH3 ligand-PGK1t. The expression modules of these two plasmids were excised to obtain fragment 1 and fragment 2: TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t and FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t. Simultaneously, the assembly vector PRS414K-TDH2t-(Bsa1)-PGK1t was constructed, and both assembly vectors were linearized using the restriction enzyme Bsa1. Fragment 1 and fragment 2 were assembled into this linearized vector to obtain the plasmid PRS414K-TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t.

[0140] Step 2: Express LexA-(linker1)-GBD-(linker2)-SH3 by inserting it into the expression cassette FBA1t-TDH3p-PGK1t and integrating it into the delta15 site of the genome, resulting in the chassis ZB_GXJ02: CENPK-1D,delta15:FBA1t-TDH3p-LexA-GBD-SH3-PGK1t.

[0141] Step 3: The plasmid PRS425K-TDH2t-P3-RFP-FBA1t obtained in Example 1 and the plasmid PRS414K-TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t obtained in Step 1 were introduced into the yeast chassis ZB_GXJ02 obtained in Step 2, resulting in strains ZB_Sc001E01, ZB_Sc001E02...ZB_Sc001E30. As shown in Table 1, the first to sixth rows are the Saccharomyces cerevisiae strains ZB_Sc001E01-E05, ZB_Sc001E06-E10, ZB_Sc001E11-E15, ZB_Sc001E16-20, ZB_Sc001E21-25, and ZB_Sc001E26-30 that were constructed to express red fluorescent protein using a single transcription factor promoter.

[0142] 4. Compare the transcriptional capacity of different multi-factor recruitment promoters.

[0143] Experimental materials: Strains ZB_Sc001E01, ZB_Sc001E02...ZB_Sc001E30

[0144] Experimental method: The culture experiment was conducted in deep-well plates using SC-LEU-TRP liquid medium. Galactose was added at 20 h and 40 h, respectively. After incubation for more than 48 hours, the fluorescence intensity of the red fluorescent protein was measured using a fluorescence spectrophotometer. This procedure was exactly the same as in Example 1.

[0145] Experimental results: D-galactose in the fermentation medium acted as an inducer, responsible for initiating transcription of the GAL1 and GAL10 promoters. Initially, the transcription of the GAL promoter was inhibited by glucose in the presence of glucose in the medium; as fermentation progressed, glucose was rapidly consumed, and when glucose was depleted, the glucose inhibition effect was relieved, D-galactose initiated transcription of the GAL promoter, and RFP expression was initiated.

[0146] As shown in Table 1, the RFP fluorescence intensity of strains ZB_Sc001E01, ZB_Sc001E02...ZB_Sc001E30 revealed different transcriptional capacities when recruited by different multi-factor artificial promoters, and when the combinations or sequences of recruited transcription factors varied. The promoter strength was significantly higher than the initial GAL1 promoter, reaching its peak at 2.51 times that of the original GAL1 promoter, when Ino2 and Paf1 were recruited. (Although the average absolute promoter strength was higher when Sin4 and Rtt102 were recruited, there was no significant difference compared to the initial GAL1 promoter (P>0.05), so they are not included in this analysis.)

[0147] Table 2. RFP fluorescence intensity of multi-transcription factor recruitment promoters

[0148]

[0149] Example 3: Comparison of mRNA levels when expressing RFP using single and multiple transcription factor recruitment artificial promoters, and comparison of 7-dehydrocholesterol production when expressing the DHCR24 gene.

[0150] 1. Obtaining exogenous gene elements and optimizing the construction of 7-dehydrocholesterol-producing strains

[0151] The DHCR24 gene was synthesized by the company and its codons were optimized to adapt to the Saccharomyces cerevisiae host. This gene is a key gene in the synthesis of 7-dehydrocholesterol. Similar to the expression module construction in Examples 1 and 2, only the RFP gene was replaced with the DHCR24 gene. The yeast chassis ZB_GXJ01 is a high-yielding 7-dehydrocholesterol strain from our laboratory. The strain obtained is as follows:

[0152] ZB_Sc001F0: ZB_GXJ01, PRS425K-TDH2t-GAL1p-DHCR24-FBA1t, PRS414K;

[0153] ZB_Sc001F1: ZB_GXJ01, PRS425K-TDH2t-P3-DHCR24-FBA1t,

[0154] PRS414K-FBA1t-TDH3p-LexA-linker-RTT102-PGK1t;

[0155] ZB_Sc001F2: ZB_GXJ01, PRS425K-TDH2t-P3- DHCR24-FBA1t,

[0156] PRS414K-FBA1t-TDH3p-LexA-linker-INO2-PGK1t,;

[0157] ZB_Sc001F3: ZB_GXJ01, delta15:∷FBA1t-TDH3p-LexA-GBD-SH3-PGK1t, PRS425K-TDH2t-P3-DHCR24-FBA1t; PRS414K-TDH2t-GAL1p-RTT102-GBD ligand-FBA1t-GAL7p-PAF1-SH3 ligand-PGK1t

[0158] ZB_Sc001F4: ZB_GXJ01, delta15: FBA1t-TDH3p-LexA-GBD-SH3-PGK1t, PRS425K-TDH2t-P3-DHCR24-FBA1t; PRS414K-TDH2t-GAL1p-INO2-GBD ligand-FBA1t-GAL7p-PAF1-SH3 ligand-PGK1t

[0159] 2. Compare the mRNA levels of strains ZB_Sc001000, ZB_Sc001C13, ZB_Sc001C18, ZB_Sc001E29, and ZB_Sc001E08 when expressing RFP, and the 7-dehydrocholesterol production of strains ZB_Sc001F0, ZB_Sc001F1, ZB_Sc001F2, ZB_Sc001F3, and ZB_Sc001F4.

[0160] 3. Experimental materials: Control strain ZB_Sc001000, test strains ZB_Sc001C13, ZB_Sc001C18, ZB_Sc001E29, ZB_Sc001E08; control strain ZB_Sc001F0, test strains ZB_Sc001F1, ZB_Sc001F2, ZB_Sc001F3, ZB_Sc001F4

[0161] Test method: exactly the same as in Example 1.

[0162] Table 3

[0163]

[0164] Table 4

[0165]

[0166] Table 5

[0167]

[0168] Table 6

[0169]

[0170] Experimental Results: In strains ZB_Sc001000, ZB_Sc001C13, ZB_Sc001C18, ZB_Sc001E29, and ZB_Sc001E08, after expressing RFP using an artificial promoter, the mRNA level trends in different strains were basically the same as the RFP fluorescence intensity trends obtained in Examples 1 and 2. Among them, strains ZB_Sc001E02 and ZB_Sc001E08 had the highest RFP mRNA levels. The 7-dehydrocholesterol production in strains ZB_Sc001F0, ZB_Sc001F1, ZB_Sc001F2, ZB_Sc001F3, and ZB_Sc001F4 showed basically the same trends in RFP intensity and mRNA levels as the above strains, with strains ZB_Sc001F3 and ZB_Sc001F4 exhibiting the highest 7-dehydrocholesterol production. The above experiments demonstrate that artificial promoters have proven their superior transcriptional efficiency compared to endogenous GAL1 promoters in terms of protein, mRNA, and natural product yield.

[0171] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing an artificial promoter for *Saccharomyces cerevisiae*, characterized in that, Including single-factor recruitment promoters and / or multi-factor recruitment promoters; The method for constructing the single-factor recruitment promoter includes the following steps: A DNA element with affinity for the LexA protein is inserted at the recruitment site upstream of the TATA box in the promoter backbone to construct the promoter to be screened. The promoter to be screened is ligated into the first expression cassette to obtain the promoter plasmid; The recruited transcription regulatory factors are ligated into the second expression cassette to obtain a transcription regulatory plasmid; The promoter plasmid to be screened and the transcription regulatory plasmid were introduced into a yeast chassis strain, cultured, and the artificial promoter that meets the conditions was obtained based on the expression results. The first expression box may be the same as or different from the second expression box.

2. The construction method as described in claim 1, characterized in that, The promoter skeleton includes GAL1, GAL7, GAL10, GAL2, TDH3, TEF1, TPI1, GPM1, FBA1, PDC1, ENO2, PYK1, TEF2, PGK1, HXT7, TDH2, ADH1, or PGI1.

3. The construction method as described in claim 1 or 2, characterized in that, The promoter skeleton includes GAL1, GAL7, GAL10, GAL2, TDH3, or TEF1.

4. The construction method according to any one of claims 1 to 3, characterized in that, The recruitment sites range from 1bp to 300bp.

5. The construction method according to any one of claims 1 to 4, characterized in that, The recruitment sites include 50 bp, 80 bp, 130 bp and / or 190 bp.

6. The construction method as described in claim 1 or 2, characterized in that, The recruited transcriptional regulators include subunits of RNA polymerase II, Spt15, Rad3, Taf1, Cdc73, Paf1, Sin4, Srb4, Gal11, Rgr1, Rox3, Soh1, Rtt102, Snf5, Arp7, Fun30, Hpr1, Ino2, Met4, Gcn4, or Msn1.

7. The construction method as described in claim 6, characterized in that, The subunits of the RNA polymerase II include RPB1, RPB2, RPB3, RPB4, RPB5, RPB6, RPB7, RPB8, RPB9, RPB10, RPB11, or RPB12.

8. The construction method according to any one of claims 1 to 7, characterized in that, The yeast chassis strains include one or more of the following: Schizosaccharomyces pombe, Pichia pastoris, Y. lipolytica, R. glutinis, C. albicans, C. tropicalis, T. utilis, or S. roseus.

9. The construction method according to any one of claims 1 to 8, characterized in that, The first expression cassette includes the expression cassette TDH2t-(2×Bsa1)-RFP-FBA1t on the Saccharomyces cerevisiae PRS425K vector; The second expression cassette includes the expression cassette FBA1t-TDH3p-LexA-(2×Bsa1)-PGK1t on the Saccharomyces cerevisiae vector PRS414K; The yeast chassis strain includes the CENPK-1D yeast chassis strain.

10. The construction method according to any one of claims 1 to 9, characterized in that, The recruitment site includes 130 bp upstream of the TATA frame of the GAL1 promoter, and the recruited transcriptional regulator includes Hpr1.

11. The construction method according to any one of claims 1 to 10, characterized in that, The multi-factor recruitment promoter also includes tandem protein fusion of the DNA-binding domain of the LexA protein with GBD and SH3 to obtain LexA-(linker1)-GBD-(linker2)-SH3; The LexA-(linker1)-GBD-(linker2)-SH3 was inserted into the expression cassette FBA1t-TDH3p-PGK1t and integrated into the delta15 site of the genome to obtain the yeast chassis strain ZB_GXJ02: CENPK-1D, delta15: FBA1t-TDH3p-LexA-GBD-SH3-PGK1t; The recruited transcriptional regulators are linked to GBD ligands and SH3 ligands via linkers, with the GBD ligands and SH3 ligands positioned at the C-terminus of the recruited transcriptional regulators. The recruited transcriptional regulatory factors were inserted into expression cassettes containing GBD ligands and expression cassettes containing SH3 ligands, respectively, to obtain corresponding plasmids. Fragment 1 and fragment 2 were excised and collected, and assembled into a linearized vector to obtain plasmids containing the recruited transcriptional regulatory factors, GBD ligands, and SH3 ligands. The promoter plasmid to be screened and the plasmid containing the recruited transcriptional regulatory factor, GBD ligand and SH3 ligand were introduced into the yeast chassis strain ZB_GXJ02, cultured, and the qualified artificial promoter was obtained according to the expression results.

12. The construction method as described in claim 11, characterized in that, The expression cassette containing the GBD ligand includes the PRS425K-TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t plasmid. The expression cassette containing the SH3 ligand includes the PRS425K-FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t plasmid; Fragment 1 includes TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t; Fragment 2 includes FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t; The plasmid containing the recruited transcription regulator, GBD ligand, and SH3 ligand includes the PRS414K-TDH2t-GAL1p-transcription factor 1-linker-GBD ligand-FBA1t-GAL7p-transcription factor 2-linker-SH3 ligand-PGK1t plasmid.

13. The construction method as described in claim 11 or 12, characterized in that, The recruited transcriptional regulators include Ino2 and Paf1.

14. Artificial promoters, plasmids, and / or strains obtained by the construction method according to any one of claims 1 to 13.

15. The application of the artificial promoter as described in claim 14 in improving transcriptional capacity, enhancing promoter strength continuity, and / or satisfying the regulation of complex metabolic pathways in synthetic biology.