Application of downstream transcription factor ONAC131 of SL signal channel in antiviral property of plants
By screening and validating the downstream transcription factor ONAC131 of the SL signaling pathway, promoting its interaction with MID1, and constructing a recombinant vector to overexpress ONAC131, the problem of rice virus disease control was solved, the antiviral ability of rice was improved, and high-yield and high-quality breeding was promoted.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-04-10
AI Technical Summary
Rice viral diseases, especially rice straw dwarf virus (RGSV), are difficult to control. The downstream response factors of SL in existing technologies are not clear, which affects the yield and virus resistance of rice.
By screening and validating the downstream transcription factor ONAC131 of the SL signaling pathway, it was found that it interacts with MID1 and promotes the transcriptional activation of RDR1 and RDR6. A recombinant vector was constructed to overexpress ONAC131, which enhanced the virus resistance of rice.
It significantly improved rice resistance to RGSV, enhanced the activity of the RNAi antiviral pathway, and promoted the breeding of high-yielding, highly resistant, and high-quality rice varieties.
Smart Images

Figure CN121826040A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ONAC131, a downstream transcription factor of the SL signaling pathway, in plant antiviral activity. Background Technology
[0002] Strigolactones (SLs) are a class of carotenoid-derived plant signaling molecules. As a novel plant hormone, they not only regulate plant morphology by inhibiting lateral bud growth and branching, but also play an important role in plant resistance regulation. The biosynthesis of SLs involves the sequential conversion of all-trans-β-carotene to carlactone (CL) via carotenoid isomerase D27, carotenoid cleavage dioxygenase 7 (CCD7), and carotenoid cleavage dioxygenase 8 (CCD8). CCD7 and CCD8 are derived from... D17 and D10 The SL signaling pathway mainly includes three classes of proteins: the first class is D14, a member of the α / β hydrolase protein family, a key receptor protein for SL, possessing the dual functions of sensing SL signals and hydrolyzing SL; the second class is the F-box protein D3. As a core factor of the SCF (Skp1-Cullin-F-box protein) complex, D3 mediates substrate protein degradation through ubiquitination; the third class is the D53 / SMXL protein family, which are repressors of the SL pathway and negatively regulate SL signal transduction. Although research on the SL synthesis and signaling pathways in rice is relatively systematic, the downstream response factors of SL remain unclear, and their key components in resistance regulation have not been fully elucidated.
[0003] Rice (Oryza sativa L.) is an important crop for ensuring food security and sustainable agricultural development in my country. However, it is susceptible to various diseases and pests during cultivation, especially rice viral diseases. Rice viral diseases are characterized by long incubation periods, rapid spread, and difficulty in control. Among them, rice grassy stunt virus (RGSV) causes particularly severe losses. RGSV is transmitted by the brown planthopper via a persistent proliferative vector. After infection, it causes severe stunting of the plant, a sharp increase in the number of tillers, yellowing, narrowing, and stiffening of leaves, and mottling symptoms on new leaves. Sometimes, a large number of irregular dark brown lesions also form on the leaves. Infected rice grains are mostly shriveled, or even fail to head, seriously damaging rice yield.
[0004] RNA-mediated gene silencing (RNAi) is a major pathway for rice antiviral activity. Previous studies have shown that the transcription factor MID1 is a core factor regulating the transcription of key RNAi factors RDR1 and RDR6, and that MID1's regulation of RDR1 and RDR6 depends on the SL signaling pathway, but the regulatory mechanism remains unclear. This invention involves transcriptome sequencing of multiple SL synthesis or signaling mutants and rice materials treated with the SL analog rac-GR24, followed by systematic integration and analysis of multiple datasets, leading to the identification of the SL downstream response factor ONAC131. Research indicates that ONAC131 interacts with MID1 and acts as a coordinating transcription factor to regulate the expression of RDR1 and RDR6, thereby promoting the activation of the rice antiviral RNAi pathway. The discovery of ONAC131 not only supplements the downstream regulatory framework of SL but also provides a new, directly usable target for molecular breeding of rice antiviral varieties using the SL-RNAi pathway, contributing to the accelerated breeding of high-yielding, highly resistant, and high-quality rice varieties. Summary of the Invention
[0005] Based on the above, the purpose of this invention is to propose the application of the SL signaling pathway downstream transcription factor ONAC131 in plant antiviral activity.
[0006] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides the use of transcription factor ONAC131 and its encoding gene in any of the following: (1) Application in positive regulation of rice virus resistance; (2) Application in the preparation of products that positively regulate rice virus resistance; (3) Application in antiviral rice breeding; (4) Application in the cultivation of virus-resistant rice; The amino acid sequence of the transcription factor ONAC131 is shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the transcription factor ONAC131 is shown in SEQ ID NO.1.
[0007] Furthermore, the rice includes japonica rice, indica rice, tropical indica rice, tropical japonica rice, indica-japonica hybrid rice, intermediate varieties, and other cultivated rice subspecies.
[0008] Furthermore, the transcription factor ONAC131 enhances the virus resistance of rice by promoting the transcriptional activation of RDR1 and / or RDR6 by the transcription factor MID1. MID1 is the encoding product of LOC_Os05g37060, with its nucleotide sequence shown in SEQ ID NO.3 and its encoded protein sequence shown in SEQ ID NO.4.
[0009] Furthermore, the virus includes rice straw dwarf virus (RGSV).
[0010] In a second aspect, the present invention provides a recombinant vector containing the transcription factor ONAC131 encoding gene and a host bacterium containing the recombinant vector for use in any of the following: (1) Application in positive regulation of rice virus resistance; (2) Application in the preparation of products that positively regulate rice virus resistance; (3) Application in antiviral rice breeding; (4) Application in the cultivation of virus-resistant rice; The nucleotide sequence of the gene encoding the transcription factor ONAC131 is shown in SEQ ID NO.1.
[0011] Furthermore, the rice includes japonica rice, indica rice, tropical indica rice, tropical japonica rice, indica-japonica hybrid rice, intermediate varieties, and other cultivated rice subspecies.
[0012] Furthermore, the virus includes rice straw dwarf virus.
[0013] In a third aspect, the present invention proposes a breeding method for enhancing the virus resistance of rice, comprising: (1) Construct an expression vector containing the transcription factor ONAC131 encoding gene, the nucleotide sequence of which is shown in SEQ ID NO.1; (2) Introduce the carrier into rice; (3) Obtain transgenic rice overexpressing ONAC131; use the rice to enhance the activity of the antiviral RNAi pathway and increase resistance to the virus RGSV.
[0014] Compared with the prior art, the present invention has the following significant advantages: This invention experimentally demonstrates that overexpression of ONAC131 in rice significantly increases the expression levels of RDR1 and RDR6 compared to wild-type rice ZH11, exhibiting higher RGSV resistance. Furthermore, ONAC131 knockout rice materials are more sensitive to RGSV infection compared to wild-type rice ZH11, indicating that ONAC131 overexpression enhances rice virus resistance. This invention confirms that ONAC131 positively regulates viral resistance in rice, and that the transcription factor ONAC131 and its encoding gene are of great significance for breeding virus-resistant (e.g., RGSV) rice varieties. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments will be briefly introduced below.
[0016] Figure 1 The transcriptome analysis results of SL analogue treatment and SL pathway-related mutants show the 12 SL downstream response candidate factors screened.
[0017] Figure 2 The interaction between ONAC131 and MID1 was verified using yeast two-hybrid (Y2H), BiFC, and pull-down assays.
[0018] Figure 3 The expression level of ONAC131 after rac-GR24 treatment and in SL pathway-related mutants.
[0019] Figure 4 As a dual-luciferase reporter, the system validated that MID1's regulation of RDR1 and RDR6 depends on ONAC131.
[0020] Figure 5 To identify the resistance of ONAC131 knockout mutants and related genetic materials to RGSV. Detailed Implementation
[0021] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be particularly noted that the following embodiments are for illustrative purposes only and do not limit the scope of the invention. Similarly, the following embodiments are only some, not all, embodiments of the present invention, and all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0022] Example 1: Screening of downstream candidate genes of SL SL biosynthesis or signaling pathway-related mutants d10 ,d14 , d53-1D And wild-type rice NIP ( Oryza sativa ssp. japonica cv. Nipponbare was used as the test material. Simultaneously, NIP plants were subjected to SL analogue treatment. rac -GR24 treatment and DMSO control treatment. All materials were used for transcriptome sequencing (RNA-seq) analysis, with sequencing work commissioned to Wuhan BGI Genomics Technology Service Co., Ltd. Bioinformatics alignment and expression level analysis were performed on the sequencing data, first screening for... d10 , d14 and d53-1D Genes with significantly lower NIP values in mutants were used to obtain candidate genes downregulated when SL signaling is blocked; simultaneously, screening for genes with NIP values in mutants was conducted. rac Genes whose expression significantly increased after GR24 treatment were used to identify candidate genes upregulated during SL signal enhancement. Intersection analysis of the two gene groups was then performed to narrow down the candidate pool. For example... Figure 1 As shown, through data overlay, 12 downstream SL response genes that simultaneously satisfy the characteristics of "SL signal blockade downregulation" and "SL-induced upregulation" were finally obtained. These 12 genes include: LOC_Os12g03040 (ONAC131), LOC_Os12g05290, LOC_Os11g29990, LOC_Os09g14870, LOC_Os09g14860, LOC_Os07g08160, LOC_Os07g08150, LOC_Os05g11320, LOC_Os05g05980, LOC_Os04g53300, LOC_Os02g30100, and LOC_Os01g71840.
[0023] The gene information related to the above-mentioned numbers can be found on the RGI website (https: / / riceome.hzau.edu.cn / dev / ).
[0024] Example 2: Screening for SL downstream genes interacting with MID1 Using cDNA from rice variety NIP as a template, the coding sequences of 12 downstream candidate genes of SL obtained in Example 1 and MID1 were amplified using primers containing attB1 / 2 adapters: pDONR221-LOC_Os12g03040-F:ggggacaagtttgtacaaaaaagcaggcttcATGCCGAGCAGCGGCGGCGC; pDONR221-LOC_Os12g03040-R: ggggaccactttgtacaagaaagctgggtcCTACTGCATCTGCAGATGAT; pDONR221-LOC_Os12g05290-F:ggggacaagtttgtacaaaaaagcaggcttcATGGTGAACACCGAGGGTACTG; pDONR221-LOC_Os12g05290-R:ggggaccactttgtacaagaaagctgggtcTCAAGATGGGCAAAAGATATCAATC; pDONR221-LOC_Os11g29990-F:ggggacaagttgtacaaaaaagcaggcttcATGGCTGTGAAATGGGCGCTAG; pDONR221-LOC_Os11g29990-R:ggggaccactttgtacaagaaagctgggtcTCAGTCATGCATGGAATCTATTG; pDONR221-LOC_Os09g14870-F:ggggacaagttgtacaaaaaagcaggcttcATGCAACCTGTGAGGATTCAG; pDONR221-LOC_Os09g14870-R:ggggaccactttgtacaagaaagctgggtcCTAGGTGTCAGATATCAAGAATG; pDONR221-LOC_Os09g14860-F:ggggacaagtttgtacaaaaaagcaggcttcATGGCCCCTCGCAACCCGAAC; pDONR221-LOC_Os09g14860-R:ggggaccactttgtacaagaaagctgggtcCTAAGCCATAGTGGCGCTGGG: pDONR221-LOC_Os07g08160-F:ggggacaagtttgtacaaaaaagcaggcttcATGGCGGCCGCTACCATGGCG; pDONR221-LOC_Os07g08160-R:ggggaccactttgtacaagaaagctgggtcTTAGACGTTGACGAAGGGCGAG; pDONR221-LOC_Os07g08150-F:ggggacaagttgtacaaaaaagcaggcttcATGGCGGTTGCTACCATGGCG; pDONR221-LOC_Os07g08150-R:ggggaccactttgtacaagaaagctgggtcTTAGACGTTGACGAGCGGCGAG; pDONR221-LOC_Os05g11320-F:ggggacaagtttgtacaaaaaagcaggcttcATGTCGGACAAGTGCGGCAAC; pDONR221-LOC_Os05g11320-R:ggggaccactttgtacaagaaagctgggtcTCACTTGCCGCAGTTGCAGCC; pDONR221-LOC_Os05g05980-F:ggggacaagttgtacaaaaaagcaggcttcATGTCGCCGAAGTTCGGCGATG; pDONR221-LOC_Os05g05980-R:ggggaccactttgtacaagaaagctgggtcTTAAGGCAGAGTGCAGAAGAG; pDONR221-LOC_Os04g53300-F:ggggacaagtttgtacaaaaaagcaggcttcATGGAGAGCATCAACGTAGCAC; pDONR221-LOC_Os04g53300-R:ggggaccactttgtacaagaaagctgggtcTCACTTAGCGTAGCCGATGCT; pDONR221-LOC_Os02g30100-F:ggggacaagtttgtacaaaaaagcaggcttcATGGCCGTCGACGCGATGTTC; pDONR221-LOC_Os02g30100-R:ggggaccactttgtacaagaaagctgggtcCTAAATCTTCGTAAGAAGATCAACCA; pDONR221-LOC_Os01g71840-F:ggggacaagtttgtacaaaaaagcaggcttcATGGTGAACACCGAGGGTACTG; pDONR221-LOC_Os01g71840-R:ggggaccactttgtacaagaaagctgggtcTCATCAACTGGATCACCTGACTGT; pDONR221-F: ggggacaagtttgtacaaaaaagcaggcttcATGGCGTTCTACCTCGGCAG; pDONR221-R: ggggaccactttgtacaagaaagctgggtcTCATGGGGCAGTGATGTCGT; Utilizing Gateway® BP Clonase™ II Enzyme Using the Mix kit, the amplified products were ligated to intermediate vector 221 via homologous recombination to obtain vectors LOC_Os12g03040-221, LOC_Os12g05290-221, LOC_Os11g29990-221, LOC_Os09g14870-221, LOC_Os09g14860-221, LOC_Os07g08160-221, LOC_Os07g08150-221, LOC_Os05g11320-221, LOC_Os05g05980-221, LOC_Os04g53300-221, LOC_Os02g30100-221, LOC_Os01g71840-221, and MID1-221. The intermediate carrier is processed Mlu After I enzyme digestion, the 12 candidate gene products were recovered and then ligated into the bait vector (BD) of the yeast two-hybrid system via homologous recombination using the Gateway® LR Clonase™ II Enzyme Mix kit. MID1The coding sequence was ligated into the activation vector (AD) to obtain the final vectors BD-LOC_Os12g03040, BD-LOC_Os12g05290, BD-LOC_Os11g29990, BD-LOC_Os09g14870, BD-LOC_Os09g14860, BD-LOC_Os07g08160, BD-LOC_Os07g08150, BD-LOC_Os05g11320, BD-LOC_Os05g05980, BD-LOC_Os04g53300, BD-LOC_Os02g30100, BD-LOC_Os01g71840, and the AD-MID1 vector. These vectors were then transformed into yeast two-hybrid strains to detect protein-protein interactions between the candidate protein and MID1. The experimental results are as follows: Figure 2 As shown, among the 12 candidate genes, only LOC_Os12g03040-221 (ONAC131) showed a positive interaction signal with MID1, while the other candidate genes did not show significant interaction. The interaction between ONAC131 and MID1 was further verified using bimolecular fluorescence complementation (BiFC) and pull-down assays. These results collectively indicate that ONAC131 is a downstream SL response factor that can interact with MID1.
[0025] To verify whether ONAC131 is regulated by SL signal, primers: OsONAC131-F: CATGACCATGAGGCTGGACGACTG were used; OsONAC131-R: CAGGAGGTTGTTGAGAGGAAGAG; Detection of NIP, SL biosynthetic or signaling mutants respectively d10 , d14 , d53 - 1D and through rac - GR24-treated and DMSO-treated rice materials ONAC13 The expression of 1, the result is as follows Figure 3 As shown, in d10 , d14 , d53 - 1D In mutants, ONAC131 The expression levels of these proteins were significantly lower than those of wild-type rice NIP; rac -GR24 treatment conditions ONAC131 The expression level was significantly upregulated. These results indicate that... ONAC131 The expression of is positively regulated by SL signaling, further supporting its characteristic as a downstream response factor of SL.
[0026] Example 3: ONAC131 in MID1 induction RDR1 / RDR6 Functional verification during the process (1) Designed for knockout via the website http: / / skl.scau.edu.cn / home / ONAC131 The primers for the CRISPR / Cas9 system are: UF: CTCCGTTTTACCTGTGGAATCG; gRNA-R: CGGAGGAAAATTCCATCCAC; ONAC131-U3T1: 5'-TCTTGTCAACTCCGACGAGCTgccacggatcatctgc-3'; ONAC131-gRT1: 5'-GCTCGTCGGAGTTGACAAGAgttttagagctagaaat-3'; ONAC131-U3T2: 5'-CACAGGCACATCAGCTAACACggcagccaagccagca-3'; ONAC131-gRT2: 5'-TGTTAGCTGATGTGCCTGTGgttttagagctagaaat-3'; B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG; BL: AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC; (2) Using the intermediate vectors U3 and U6 as templates, the target gRNA expression cassette sequence was obtained by two rounds of PCR amplification using three pairs of primers: UF / ONAC131-U3T1, ONAC131-gRT1 / gRNA-R, and B1' / BL.
[0027] (3) The expression cassette sequence and the Cas9 vector were processed by restriction endonuclease. Bsa I is digested and then ligated using T4 ligase.
[0028] (4) The ligation product was transferred into Escherichia coli strain DH5α, coated with a medium containing kanamycin resistance to obtain transformants, the plasmid of the transformants was extracted, and the positive transformants with correct sequencing were the final recombinant vectors, named CRISPR-ONAC131.
[0029] (5) The CRISPR-ONAC131 vector was sent to Wuhan Boyuan Biotechnology Co., Ltd. for genetic transformation to obtain ONAC131 knockout rice materials. onac131 .
[0030] (6) The biological significance of the interaction between ONAC131 and MID1 was verified using a dual-luciferase reporter system. Details are as follows: Using rice NIP cDNA as a template, primers were used: RDR1pro:LUC-F:ccccctcgaggtcgacTCCTCTCTCCGTGGCCGCGA; RDR1pro:LUC-R:tagaactagtggatccGGGATTCGAGGACGAGGAGT; RDR6pro:LUC-F:ccccctcgaggtcgacATTCGCATGAGGGATAACCT; RDR6pro:LUC-R:tagaactagtggatccGGACGGGTGCGAACTGTGTG; Amplification RDR1 and RDR6 The promoter sequences were obtained and cloned into dual-luciferase reporter vectors to construct... RDR1 pro:LUC and RDR6 pro:LUC promoter report system. Simultaneously, the 35S:Flag-MID1 expression vector was obtained by fusion according to the method of Example 2, and 35S:Flag-MID1 and RDR1 pro:LUC RDR6 pro:LUC reporter vector co-transformed into wild-type ZH11 ( Oryza sativa ssp. japonica cv. Zhonghua11) Rice protoplasts and ONAC131 knockout materials onac131 In protoplasts. The activity of the reporter gene was measured using a dual-luciferase reporter system. Results are as follows: Figure 4 As shown, in wild-type ZH11 protoplasts, MID1 can significantly improve... RDR1 and RDR6 Promoter activity; while onac131 In protoplasts, MID1 pairs RDR1 and RDR6 The activation effect of MID1 was significantly weakened or disappeared, and the above results indicate that MID1 has a significant effect on... RDR1 and RDR6 The regulation depends on ONAC131.
[0031] Example 4: ONAC131 enhances the silencing of virus-resistant genes in rice Using primers Actinpro:Flag-ONAC131-F: cgacgacaggggatccATGCCGAGCAGCGGCGGCGC; Actinpro:Flag-ONAC131-R: aaagcagggcatgcctgcagCTACTGCATCTGCAGATGAT; Amplification was performed using the ONAC131-221 vector as a template to obtain bands. BamH I and Pst I restriction enzyme cleavage site linker ONAC131 PCR products, and fused to the target cell via homologous recombination. BamH I and Pst The Flag-ONAC131 vector was obtained by digesting the pCAMBIA2300-Actin-N-2×Flag vector with double enzyme I. The primers Actinpro:Flag-MID1-F were then used: cgacgacaggggatccATGGCGTTCTACCTCGGCAG; Actinpro:Flag-MID1-R:aaagcagggcatgcctgcagTCATGGGGCAGTGATGTCGT; The Flag-MID1 vector was obtained using the same method. Genetic transformation was performed by Wuhan Boyuan Biotechnology Co., Ltd. ONAC131 The expression vector was introduced into wild-type rice (ZH11) to obtain ONAC131 Overexpression materials ( MID1 CE); introduce the MID1 overexpression vector. onac131 Obtain from knocking out materials MID1 CE / onac131 Rice. Using primers OsRDR1-F:ATTCCGCCTCGTATGGTGAC; OsRDR1-R: TGCCTTGAGGTCTTCCTTATCC; OsRDR6-F: GGACTACTCCCCACCTGAAGC; OsRDR6-R:GAAGTCCACGGCAGTTGCTGCTAGC; Detected by real-time quantitative PCR (RT-qPCR) RDR1 and RDR6 In ZH11, MID1 CE, onac131 as well as MID1 CE / onac131 Expression levels in transgenic rice, results as follows Figure 5 As shown in B, RDR1 and RDR6 exist MID1 The expression levels in CE were significantly higher than those in the control ZH11, but MID1 CE / onac131 middle RDR1 and RDR6 expression level and onac131 The results were largely consistent, with no significant difference from the control ZH11, indicating that MID1 had a significant effect on the control. RDR1 and RDR6 Regulation depends on ONAC131. The above rice materials were inoculated with RGSV, and phenotypic observations and virus accumulation tests were performed. The results are as follows: Figure 5 A, C display MID1 CE showed significant resistance to RGSV, while onac131 and MID1 CE / onac131 Rice materials were more sensitive to RGSV infection than wild-type rice ZH11. This was confirmed by RT-qPCR (…). Figure 5 B) and Western blot ( Figure 5 C) Detection found onac131 and MID1 CE / onac131 The expression levels of RDR1 and RDR6 in rice were significantly lower than those in wild-type rice ZH11, while MID1 The expression levels of RDR1 and RDR6 in CE were significantly higher than those in ZH11. This indicates that ONAC131 is regulated by MID1. RDR1 and RDR6 ONAC131 is an essential factor, and its absence reduces the activation of the SL–MID1 pathway in RNAi antiviral activity. This further demonstrates that ONAC131 is a key node in the SL signaling pathway involved in rice antiviral responses and an important functional factor connecting SL and RNA-mediated gene silencing.
[0032] The above description is only a part of the embodiments of the present invention and does not limit the scope of protection of the present invention. Any equivalent device or equivalent process transformation made based on the content of the present invention specification and drawings, or direct or indirect application in other related technical fields, are similarly included within the patent protection scope of the present invention.
Claims
1. The application of transcription factor ONAC131 and its encoding gene in any of the following: (1) Application in positive regulation of rice virus resistance; (2) Application in the preparation of products that positively regulate rice virus resistance; (3) Application in antiviral rice breeding; (4) Application in the cultivation of virus-resistant rice; in, The amino acid sequence of the transcription factor ONAC131 is shown in SEQ ID NO.2, and the nucleotide sequence of the gene encoding the transcription factor ONAC131 is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The rice varieties include japonica rice, indica rice, tropical indica rice, tropical japonica rice, indica-japonica hybrid rice, intermediate varieties, and other cultivated rice subspecies.
3. The application according to claim 1, characterized in that, The transcription factor ONAC131 enhances the virus resistance of rice by promoting the transcriptional activation of RDR1 and / or RDR6 by the transcription factor MID1.
4. The application according to claim 1, characterized in that, The virus includes rice straw dwarf virus.
5. The application of recombinant vectors containing the transcription factor ONAC131 encoding gene and host bacteria containing such recombinant vectors in any of the following: (1) Application in positive regulation of rice virus resistance; (2) Application in the preparation of products that positively regulate rice virus resistance; (3) Application in antiviral rice breeding; (4) Application in the cultivation of virus-resistant rice; in, The nucleotide sequence of the gene encoding the transcription factor ONAC131 is shown in SEQ ID NO.
1.
6. The application according to claim 5, characterized in that, The rice varieties include japonica rice, indica rice, tropical indica rice, tropical japonica rice, indica-japonica hybrid rice, intermediate varieties, and other cultivated rice subspecies.
7. The application according to claim 5, characterized in that, The virus includes rice straw dwarf virus.
8. A breeding method for enhancing the virus resistance of rice, characterized in that, include: (1) Construct an expression vector containing the transcription factor ONAC131 encoding gene, the nucleotide sequence of which is shown in SEQ ID NO.1; (2) Introduce the carrier into rice; (3) Obtain transgenic rice overexpressing ONAC131.