Application of GhOST1 related biological product in regulation and control of plant agronomic traits and / or plant breeding

Abstract

The invention belongs to the technical field of plant biology, and particularly relates to application of a GhOST1 related biological product in regulation of plant agronomic traits and / or plant breeding, and GhOST1 refers to any one of the following: an amino acid sequence shown as SEQ ID No.1; the N terminal or / and C terminal of the SEQ ID No.1 is / are connected with a tag protein to obtain an amino acid sequence; based on SEQ ID No.1, amino acid residues are substituted, deleted and / or added, and an amino acid sequence which has more than 90% of sequence identity with SEQ ID No.1 and has the same function with SEQ ID No.1 is obtained. According to the invention, the cotton GhOST1 gene is cloned, an overexpression plant and a gene editing plant are constructed, functional verification is carried out on the GhOST1, and it is clear that the GhOST1 can change the drought resistance and yield of cotton. The invention provides an excellent genetic material for drought-resistant breeding of cotton, and has a great value for exploring a signal regulation network of cotton under an adverse situation.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant biotechnology, and particularly relates to application of a GhOST1-related biological product in regulation of plant agronomic traits and / or plant breeding. BACKGROUND

[0002] In agricultural production, drought often leads to large-scale reduction or even death of crops. Cotton is an important economic crop in China, but due to factors such as cotton-grain competition and increasing labor costs, the cotton planting area in China is gradually shifting to the water resource-deficient inland areas of the northwest. At present, the cotton planting area in this region accounts for nearly 85% of the total in China, and the total yield accounts for more than 92% of the total in China. However, cotton planting is facing the water resource dilemma of "rare rainfall and strong evaporation".

[0003] At present, the improvement of drought resistance of cotton mainly relies on traditional breeding and field screening, which has a long cycle, low efficiency, and is difficult to accurately regulate target traits. In the aspect of molecular breeding, although some genes related to stress response have been identified, there is still a lack of key gene targets that have been functionally verified and can be explicitly used for drought resistance improvement in cotton and supporting application technologies. The existing technology has not provided a molecular tool and application scheme that can be effectively used for cotton drought resistance regulation and breeding promotion, which restricts the efficiency and accuracy of cotton stress tolerance breeding. SUMMARY

[0004] The application provides application of a GhOST1-related biological product in regulation of plant agronomic traits and / or plant breeding, which solves the problem of lack of molecular tools for simultaneous improvement of drought resistance and yield traits of cotton in the prior art.

[0005] The technical scheme adopted by the application is as follows: The application provides a kind of GhOST1 Application of a related biological product in regulation of plant agronomic traits and / or plant breeding, wherein the GhOST1 refers to any one of the following: A: the amino acid sequence shown in SEQ ID No. 1; B: the amino acid sequence obtained by connecting a tag protein to the N terminus or / and C terminus of SEQ ID No. 1; C: the amino acid sequence obtained by substitution, deletion and / or addition of amino acid residues based on SEQ ID No. 1, which has more than 90% sequence identity with SEQ ID No. 1 and the same function.

[0006] Preferably, the tag protein refers to a polypeptide or protein expressed by fusing it with a target protein using in vitro DNA recombination technology, in order to facilitate the expression, detection, tracing, or purification of the target protein. The tag protein includes at least one of the following: Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and SUMO tag; the 90% or more sequence identity can be at least 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0007] Identity refers to the similarity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value can then be obtained.

[0008] Preferably, the biological product is any one of the following: a) A nucleic acid molecule encoding GhOST1; b) An expression cassette containing the nucleic acid molecule described in a); c) A recombinant vector containing the nucleic acid molecule described in a) or a recombinant vector containing the expression cassette described in b); d) A recombinant microorganism containing the nucleic acid molecule described in a), a recombinant microorganism containing the expression cassette described in b), or a recombinant microorganism containing the recombinant vector described in c); e) A transgenic plant cell line containing the nucleic acid molecule described in a), a transgenic plant cell line containing the expression cassette described in b), or a transgenic plant cell line containing the recombinant vector described in c); f) A transgenic plant tissue containing the nucleic acid molecule described in a), a transgenic plant tissue containing the expression cassette described in b), or a transgenic plant tissue containing the recombinant vector described in c); g) A transgenic plant organ containing the nucleic acid molecule described in a), a transgenic plant organ containing the expression cassette described in b), or a transgenic plant organ containing the recombinant vector described in c); h) A transgenic plant organ containing the nucleic acid molecule described in a); The following are considered as transgenic plants containing the nucleic acid molecules described in b), transgenic plants containing the expression cassette described in b), or transgenic plants containing the recombinant vector described in c); i) tissue cultures produced from regenerative cells of the transgenic plants described in h); j) protoplasts produced from the tissue cultures described in i); k) recombinant vectors that enhance GhOST1 expression, enhance GhOST1 activity, or increase GhOST1 content; l) recombinant microorganisms that enhance GhOST1 expression, enhance GhOST1 activity, or increase GhOST1 content; m) recombinant vectors that inhibit GhOST1 expression, inhibit GhOST1 activity, or decrease GhOST1 content; n) recombinant microorganisms that inhibit GhOST1 expression, inhibit GhOST1 activity, or decrease GhOST1 content.

[0009] Preferably, the recombinant microorganism is any one of yeast, bacteria, algae, and fungi; for example, the bacteria may be Agrobacterium GV3101; the transgenic plant organ is any one of the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant; the tissue culture is derived from any one of the roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0010] Preferably, the nucleic acid molecule is DNA or RNA; the DNA includes any one of cDNA, genomic DNA, and recombinant DNA; the RNA includes any one of mRNA and hnRNA.

[0011] The expression cassette refers to DNA capable of expressing the protein GhOST1 in host cells, and this DNA may include not only the promoter but also... GhOST1 The promoter of gene transcription may also include a terminator. GhOST1 A transcription terminator; furthermore, the expression cassette may also include an enhancer sequence.

[0012] Promoters that can be used in this invention include, but are not limited to: GhOST1 Promoters can be categorized into intrinsic promoters, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter leucine aminopeptidase from tomato; the chemically induced promoter from tobacco (pathogenesis-related 1); the tomato protease inhibitor II promoter or LAP promoter; heat shock promoters; tetracycline-inducible promoters; seed-specific promoters, such as the millet seed-specific promoter pF128; and promoters specific to seed storage proteins. They can be used alone or in combination with other plant promoters.

[0013] Suitable transcription terminators include, but are not limited to: GhOST1 The terminator of the gene itself, the terminator of Agrobacterium carmine synthase, the terminator of cauliflower mosaic virus CaMV 35S, the terminator of tml, the terminator of pea rbcS E9, and the terminator of carmine and octopine synthase.

[0014] Recombinant vectors containing the GhOST1 gene or the GhOST1 gene expression cassette can be constructed using existing plant expression vectors. The plant expression vector can be a Gateway system vector or a binary expression vector, such as pMDC32, super1300, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb.

[0015] use GhOST1 When constructing recombinant vectors, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter or the ubiquitin gene promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0016] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants to encode enzymes or luminescent compounds that produce color changes, such as GUS genes and luciferase genes; antibiotic resistance markers, such as gentamicin markers and kanamycin markers; or chemical reagent resistance marker genes, such as herbicide resistance genes.

[0017] In a specific embodiment of the present invention, the recombinant vector described in k) can be pCAMBIA2300- GhOST1 .

[0018] In a specific embodiment of the present invention, the recombinant vector in c) can be 35S:: GhOST1 -GFP recombinant vector, the 35S:: GhOST1 The -GFP recombinant vector is obtained by replacing the DNA fragment between the BamHI and StuI restriction sites of pHBT with the DNA fragment shown in positions 1 to 1089 of SEQ ID No. 2, while keeping the other sequences of pHBT unchanged.

[0019] In a specific embodiment of the present invention, the recombinant vector described in m) is the gene editing vector P7N-TRNA. The P7N-TRNA is a recombinant vector obtained by replacing the DNA fragment between the BsaI restriction sites of the P7N-TRNA vector with the DNA molecule shown in SEQ ID No. 15, while keeping the other sequences of the P7N-TRNA vector unchanged.

[0020] Preferably, the agronomic traits refer to stress resistance and / or yield; plant breeding refers to any one of the following: ① breeding transgenic plants with enhanced stress resistance; ② preparing products for breeding transgenic plants with enhanced stress resistance; ③ breeding gene-edited plants with reduced stress resistance; ④ preparing products for breeding gene-edited plants with reduced stress resistance.

[0021] In plant breeding, the specific application can be: hybridizing plants containing GhOST1 or related biological products with other plants to carry out plant breeding.

[0022] Preferably, the stress resistance refers to drought resistance.

[0023] Preferably, the plant is any one of the following: I: monocotyledonous plant; II: dicotyledonous plant; III: cruciferous plant; IV: gossy plant; V: cotton.

[0024] The present invention also provides a method for cultivating transgenic plants with enhanced stress resistance: including increasing the expression level of the gene for protein GhOST1, the activity of protein GhOST1, and / or the content of protein GhOST1 in the target plant to obtain a transgenic plant; compared with the target plant, the transgenic plant has enhanced stress resistance.

[0025] In the above method, increasing the expression level of the GhOST1 gene, the activity of the GhOST1 protein, and / or the content of the GhOST1 protein in the target plant means overexpressing the GhOST1 protein in the target plant.

[0026] The overexpression method involves introducing the gene for the protein GhOST1 into the target plant; specifically, the nucleotide sequence of the gene for the protein GhOST1 is the DNA fragment shown in positions 1 to 1089 of SEQ ID No. 2.

[0027] The above-mentioned introduction of the GhOST1 protein gene into the target plant can be achieved by using the gene of this invention. GhOST1 The plant expression vector of this invention was introduced into the target plant. The vector carried the gene of this invention. GhOST1 Plant expression vectors can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and then the transformed plant cells or tissues can be cultured into plants.

[0028] The present invention also provides a method for cultivating gene-edited plants with reduced stress resistance, comprising inhibiting the expression level of the gene for protein GhOST1, the activity of protein GhOST1, and / or the content of protein GhOST1 in the target plant, to obtain gene-edited plants; compared with the target plant, the gene-edited plants have reduced stress resistance.

[0029] In the above method, the expression level, activity, and / or content of the gene inhibiting GhOST1 protein in the target plant are determined by introducing the gene that inhibits GhOST1 into the target plant. GhOST1 Vectors for gene expression.

[0030] Compared with the prior art, the beneficial effects of the present invention are: This invention provides GhOST1The application of related biological products in regulating plant agronomic traits and / or plant breeding, wherein GhOST1 refers to any one of the following: A: the amino acid sequence shown in SEQ ID No. 1; B: the amino acid sequence obtained by attaching a tag protein to the N-terminus and / or C-terminus of SEQ ID No. 1; C: an amino acid sequence with more than 90% sequence identity and function identical to SEQ ID No. 1, obtained by substituting, deleting, and / or adding amino acid residues based on SEQ ID No. 1. This invention clones cotton. GhOST1 Genes, and constructed using transgenic technology. GhOST1 Transgenic cotton plants overexpressing the gene and constructing a gene using CRISPR gene editing technology GhOST1 Edit the plants, based on the above plants' effects GhOST1 Functional verification was performed, clarifying that the gene was... GhOST1 Enhancing or suppressing expression in cotton can alter its drought resistance and yield. These results are beneficial for a deeper study of the response mechanisms of cotton to abiotic stress signals such as drought, laying a solid molecular foundation for effectively improving cotton drought resistance, providing excellent genetic materials for cotton drought-resistant breeding, and having significant value for exploring the signal regulatory network of cotton under stress. Attached Figure Description

[0031] Figure 1 for GhOST1 Agarose gel electrophoresis image of the full-length PCR product of the gene.

[0032] Figure 2 pCAMBIA2300- GhOST1 Schematic diagram of the recombinant overexpression vector.

[0033] Figure 3 35S:: GhOST1-GFP Schematic diagram of the recombinant carrier structure.

[0034] Figure 4 Subcellular localization map of GhOST1 protein.

[0035] Figure 5 For His- GhOST1 Schematic diagram of recombinant plasmid structure.

[0036] Figure 6 Image of His-GhOST1 protein stained with Coomassie Brilliant Blue.

[0037] Figure 7 For the transfer GhOST1 Agarose gel electrophoresis image of a PCR-positive cotton plant.

[0038] Figure 8 For the transfer GhOST1Protein abundance plot of Westren blot analysis of genetically modified cotton plants.

[0039] Figure 9 Image showing the editing type detection of cotton plants edited with the CRISPR-GhOST1 gene.

[0040] Figure 10 For overexpression GhOST1 Phenotypic diagram of drought resistance in cotton plants based on genes.

[0041] Figure 11 For overexpression GhOST1 A graph showing the photosynthetic rate of a cotton plant.

[0042] Figure 12 For overexpression GhOST1 A graph showing the chlorophyll content of cotton plants based on genes.

[0043] Figure 13 For overexpression GhOST1 Thermal infrared imaging analysis of cotton plants with genetic information.

[0044] Figure 14 For overexpression GhOST1 A graph showing the rate of water loss in cotton plants with specific genes.

[0045] Figure 15 For overexpression GhOST1 A diagram illustrating the effect of genes on stomatal opening and closing in cotton plants. The left image shows representative images of different treatments; the right image shows the statistical results from the left image.

[0046] Figure 16 For CRISPR- GhOST1 Drought phenotype of gene-edited cotton plants.

[0047] Figure 17 For CRISPR- GhOST1 A graph showing the SPAD value of leaves from gene-edited cotton plants.

[0048] Figure 18 For CRISPR- GhOST1 A graph showing the rate of water loss in gene-edited cotton plants.

[0049] Figure 19 For CRISPR- GhOST1 The effect of treatment on stomatal opening and closing in cotton plants is shown in the diagram. The left image shows representative pictures of different treatments; the right image shows the statistical results of the left image.

[0050] Figure 20 This is a graph showing the field boll dry weight measurement per hectare for transgenic cotton plants. Detailed Implementation

[0051] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0052] The inventive concept of this invention is as follows: Abscisic acid (ABA) is an important hormone for responding to abiotic stress, and its function and signaling pathways in plant responses to various abiotic stresses have been extensively studied. Open stomata 1 (OPEN STOMATA 1) is a core regulator of the plant ABA signaling pathway. In model plants, it regulates stomatal closure and stress gene expression by phosphorylating downstream substrates, and has become a key candidate gene for improving crop stress resistance. However, current research on OST1 mainly focuses on model plant systems such as Arabidopsis thaliana. In cotton, the specific functional mechanism of this gene and its role in cotton yield remain unclear. Existing technologies have neither elucidated the functional characteristics of cotton OST1 in a polyploid background nor provided specific application methods for breeding drought-resistant cotton varieties, severely limiting its potential application in the genetic improvement of cotton stress resistance.

[0053] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0054] Example 1 GhOST1 The applications of related biological products in regulating plant agronomic traits and / or plant breeding are as follows: 1. Discovery and cloning of GhOST1 protein and its encoding gene.

[0055] 1.1 Discovery of GhOST1 protein and its encoding gene.

[0056] A novel protein was obtained by screening drought-related genes in the VIGS cDNA library and searching a cotton database. This protein was named GhOST1, and its amino acid sequence, as shown in SEQ ID No. 1, consists of 363 amino acid residues. The gene encoding GhOST1 was named... GhOST1 Genes, the ones mentioned GhOST1 The open reading frame of the gene, as shown in SEQ ID No.2, consists of 1092 nucleotides.

[0057] SEQ ID No. 1: MDRSALTVGPGMDMPIMHDSDRYELVKDIGSGNFGVARLMRDKQTEELVAVKYIERGEKIDENVQREIINHRSLRHPNIVRFKEVILTPTHLAIVMEYASGGELFERICNAGRFSEDEARFFFQQLISGVSYCHAMQVCHRDLKLENTLLDGSPAPRLKICDFGYSKSSVLHSQPKSTVGTPAYIAPEVLLKKEYDGKIADVWSCGVTLYVMLVGAYPFEDPEDPKNFHKTIHRILNVQYSIPDYVHISPECRHLISRIFVADPSKRISIPEIRNHEWFLKNLPADLMDENTMNNQFEEADQPMQSVDEIMQIISEATIPAANTNSLNHYLTGSLDIDDDMEEDLDSDPELDIDSSGEIIYAM。

[0058] SEQ ID No.2:

[0059] 1.2 GhOST1 Gene cloning.

[0060] RNA was extracted from cotton leaves using the Adley kit, and first-strand cDNA was synthesized using the M-MLV reverse transcription kit. The resulting first-strand cDNA was used as a template for amplification. GhOST1 Full-length gene. According to... GhOST1 The gene sequence was used to design two specific primers, upstream primer F1 and downstream primer R1, for PCR amplification to obtain the PCR product. The sequences of upstream primer F1 and downstream primer R1 are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. The amplification was performed using Novizan's Planta® Max Super-Fidelity DNA Polymerase kit. GhOST1 Full-length gene.

[0061] The 50 μL PCR reaction system includes: 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP Mix (10 mM), 2 μL of cDNA, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 2 μL of upstream primer, 2 μL of downstream primer, and 17 μL of ddH2O.

[0062] The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 40 s, 35 cycles; 72℃ for 5 min.

[0063] The PCR products were electrophoresed on a 1.5% agarose gel. (See attached image.) Figure 1 After electrophoresis, the target band was cut under UV light and recovered using an agarose gel DNA recovery kit. The purified fragment was then ligated into the pCAMBIA2300 vector to obtain pCAMBIA2300- GhOST1 The recombinant overexpression vector, its structure is shown in [link to diagram]. Figure 2 .

[0064] Preparation of pCAMBIA2300- GhOST1 When recombining the overexpression vector, the 10 μL recombination reaction system is as follows: (The text abruptly ends here, so the translation stops as well.) GhOST11 μL of gene fragment, 3 μL of pCAMBIA2300, 2 μL of 5×CEII Buffer, 1 μL of Exnase® II, and ddH2O were added to a final volume of 10 μL. Ligation was performed at 37°C for 30 min. 5 μL of the ligation product was then transformed into *E. coli* DH5α using the heat shock method. Positive clones were screened on LB agar plates containing 50 mg / L kanamycin. Five clones were selected and sequenced to obtain the desired full-length gene CDS. GhOST1 Gene. Sequencing results showed that the gene sequence was 1092 bp in length, encoding a complete ORF reading frame of 363 amino acids.

[0065] Upstream primer F1, SEQ ID No. 3: 5'-ctccccttgctccgtggatccATGGATCGATCAGCACTTACAGTG-3'.

[0066] Downstream primer R1, SEQ ID No. 4: 5'-aacgtcgtatgggtaaggcctCATTGCATATATTATCTCTCCACTACTATCA-3'.

[0067] 2. Characterization of GhOST1 protein.

[0068] 2.1 Subcellular localization of GhOST1.

[0069] (1) Preparation of recombinant vectors for subcellular localization.

[0070] Subcellular localization of GhOST1 protein was studied using cotton protoplasts. Based on the expression vector... pHBT-GFP Multiple cloning sites and GhOST1 Designing amplification of the coding region sequence of the gene GhOST1 Forward and reverse primers for the entire coding region of the gene were obtained. 35S::GhOST1-GFP Recombinant vector. The specific method is as follows: using the above-obtained... GhOST1 Using the gene as a template, PCR amplification was performed using upstream primer F2 and downstream primer R2 to obtain a sample containing... GhOST1 The product of gene and vector homologous arms; vector digestion using BamHI and StUI enzymes. pHBT-GFP The PCR-purified product was recovered and purified to obtain a vector framework; the purified PCR product was then ligated with the vector framework to obtain... 35S::GhOST1-GFP The recombinant vector, its structural diagram is as follows: Figure 3 As shown. The above process is: to... pHBT-GFP The DNA fragment between the BamHI and StUI restriction sites was replaced with the DNA fragment from SEQ ID No. 2. GhOST1 After the gene, and maintain pHBT-GFPThe recombinant vector was obtained by keeping the other sequences unchanged.

[0071] Upstream primer F2, SEQ ID No. 3: 5'-ctccccttgctccgt ggatcc ATGGATCGATCAGCACTTACAGTG-3', the underlined part is the BamHI restriction site.

[0072] Downstream primer R2, SEQ ID No. 5: 5'-ctcgcccttgctcac aggcct CATTGCATATATTATCTCTCCACTACTATCA-3', the underlined part is the StuI restriction site.

[0073] (2) Methods for separating and transforming cotton protoplasts.

[0074] Cotton protoplast isolation: Cellulase R10 and Macerozyme R10 were purchased from Onozuka, and other reagents were purchased from Sigma-Aldrich.

[0075] 10mL enzymatic hydrolysate: 1.5% Cellulase R10, 0.4% Macerozyme R10, 0.4M mannitol, 20mM MCl, 20mM MES pH5.7, 2% sucrose, 10mM CaCl2.

[0076] WI solution: 20mM KCl, 0.5M mannitol, 4mM MES, pH 5.7.

[0077] W5 solution: 125mM CaCl2, 154mM NaCl, 5mM KCl, 2mM MES, pH 5.7.

[0078] MMg solution: 0.4M mannitol, 15mM MgCl2, 4mM MES, pH 5.7.

[0079] 40% (w / v) PEG conversion solution: 0.2M mannitol, 100mM CaCl2, 4g PEG4000.

[0080] The lower epidermis of the cotton cotyledons was removed using the "sandwich method." The tender cotton cotyledons were then cut into strips approximately 1 mm wide and 1 cm long with a blade. The strips were quickly transferred and immersed in the enzymatic hydrolysis solution, kept in the dark under vacuum for 2 hours, and then allowed to stand in the dark for 3 hours for enzymatic hydrolysis. An equal volume of W5 solution was added, and the solution was filtered through a 200-mesh nylon membrane to remove any undigested residue. This was followed by a second filtration through a 400-mesh cell sieve. The filtrate was the cotton protoplasts. The protoplasts were centrifuged at 700 rpm for 2 minutes, and the supernatant was discarded. The protoplasts were resuspended in W5 solution and centrifuged at 700 rpm for 2 minutes, the supernatant was discarded, and the protoplasts were resuspended again in W5 solution and placed on ice for 30 minutes. The W5 solution was removed, and the protoplasts were resuspended in MMg solution, adjusting the final protoplast concentration to approximately 2 × 10⁻⁶. 5 Cells / mL are used for conversion.

[0081] Pipe 100 μL of protoplasts into a 2 mL round-bottom centrifuge tube and add 5 μL of [unclear text - possibly a typo, should be 5 μL] 35S::GhOST1-GFP The recombinant plasmid and 5 μL of NLS-RFP nuclear localization marker plasmid containing red fluorescent protein RFP were gently tapped to mix. 110 μL of 40% PEG solution was added to the centrifuge tube, and the tube was quickly and gently tapped to mix. The mixture was incubated at room temperature for 5 min. The reaction was terminated by adding 800 μL of W5 solution to the centrifuge tube. The mixture was centrifuged at 700 rpm for 2 min, the supernatant was discarded, and the protoplasts were resuspended in WI solution. The protoplasts were transferred to a culture plate and incubated at room temperature under low light for 10 h. The mixture was centrifuged at 700 rpm for 2 min, the WI solution was removed, and 110 μL of WI solution was added to the plate, gently tapping to mix.

[0082] A small amount of protoplasts was aspirated from a pipette tip with the tip cut off and dropped onto a glass slide. The expression of GFP and RFP was then observed under a laser confocal microscope.

[0083] The results showed that GFP green fluorescence signals were observed in the nucleus, cytoplasm, and chloroplasts of cotton protoplasts, while RFP red fluorescence signals were observed in the nucleus, with overlap between the two. GFP green fluorescence signals were also observed in chloroplasts, overlapping with the chloroplast autofluorescence signal. Therefore, GhOST1 is localized in the cytoplasm, nucleus, and chloroplasts. See the results below. Figure 4 .

[0084] 2.2 Purification of GhOST1 protein.

[0085] Based on the above-mentioned GhOST1 Using the gene as a template, PCR amplification was performed using upstream primer F3 and downstream primer R3 to obtain a sample containing... GhOST1 The product of the gene and vector homologous arms; the vector was digested with NdeI and XhoI enzymes. pET28a The purified product yields a gene fragment and a linear vector; the gene fragment and linear vector are then ligated to obtain His.-GhOST1 Recombinant plasmid, see Figure 5 That is: to pET28a The DNA fragment between the NdeI and XhoI restriction sites was replaced with the DNA fragment from SEQ ID No. 2. GhOST1 Genes and maintain pET28a The recombinant plasmid was obtained by keeping the other sequences unchanged.

[0086] Upstream primer F3, SEQ ID No. 6: 5'-gtgccgcgcggcagc catatg ATGGATCGATCAGCACTTACAGTG-3'.

[0087] Downstream primer R3, SEQ ID No. 7: 5'-gtggtggtggtggtg ctcgag CATTGCATATATTATCTCTCCACTACTATCA-3'.

[0088] The recombinant plasmid was transformed into E. coli using the heat shock transformation method. BL21 After overnight incubation at 37°C, positive single clones were picked and inoculated into 4 mL of LB liquid medium containing antibiotics, and incubated overnight at 37°C and 200 rpm. The bacterial culture was then inoculated into 100 mL of LB liquid medium containing antibiotics and incubated at 37°C and 200 rpm until OD (Organic Depth) was reached. 600 The concentration should be between 0.5 and 1.0. Transfer the bacterial culture to a shaker at 16°C, cool it down after about 15 minutes, add IPTG to a final concentration of 0.2 mM, and induce overnight at 16°C and 120 rpm.

[0089] Collect the bacterial culture in a 50 mL round-bottom tube, centrifuge at 4000 rpm for 15 min at 4°C, discard the supernatant and collect the bacterial cells. Add 10 mL of protein lysis buffer to resuspend the bacterial cells, add lysin to a final concentration of 100 µg / mL, mix well, and incubate on ice for 15 min. Transfer the round-bottom tube to an ice box to facilitate heat conduction during sonication. Set the sonication program to: 30% power, 10 min, with 5-second intervals of sonication followed by 5-second intervals. Adjust the sonication time according to whether the lysed bacterial culture becomes clear. Centrifuge at 12000 rpm for 20 min at 4°C. Transfer the supernatant to a clean 15 mL centrifuge tube, add 100 μL of Ni-NTA agrose equilibrated with protein lysis buffer, add 1% Triton X-100 and 10 mM imidazole to a final concentration, mix well, and incubate at 4°C in a rotary incubator for 3 h.

[0090] After incubation, centrifuge at 4000 rpm for 2 min, discard the supernatant, and wash the beads three times with lysis buffer. Collect the beads by centrifugation and transfer to a clean 1.5 mL EP tube. Add an appropriate amount of elution buffer containing 250 mM imidazole, and elute at room temperature for 15 min or at 4°C for 3 h. After elution, centrifuge and transfer the supernatant to a clean 1.5 mL EP tube. Take 5 μL for protein electrophoresis and Coomassie Brilliant Blue staining. See [link to sample]. Figure 6 The remaining purified protein was added to a final concentration of 15% glycerol, mixed well, and then aliquoted into centrifuge tubes and stored at -80°C.

[0091] 3. Construction of genetically modified cotton.

[0092] 3.1 Construction of transgenic overexpression plants.

[0093] The pCAMBIA2300 obtained above- GhOST1 The recombinant overexpression vector was introduced into the recipient material HM-1 via Agrobacterium-mediated genetic transformation, ultimately yielding the overexpressing plant OE-. GhOST1 The Agrobacterium-mediated genetic transformation method is as follows:

[0094] (1) Preparation of sterile vaccines.

[0095] Select healthy, plump cotton seeds, remove the seed coat, and surface disinfect with 0.1% HgCl2 for 10 minutes, shaking several times during the process. Then wash them four times with sterile distilled water, inoculate them onto a sterile seedling culture medium for germination, and after 1 day, support the seedlings, remove the seed coat, insert the radicle into the sterile seedling culture medium to promote rapid growth, and incubate them in the dark at 28℃ for 6 days to obtain sterile seedlings for Agrobacterium infection.

[0096] (2) Preparation and infection of explants.

[0097] Using sterile seedling hypocotyls as explants, they were cut into 0.8cm segments; explants containing pCAMBIA2300- were stored. GhOST1 The bacterial culture of Agrobacterium was prepared in MGL liquid medium, and the hypocotyl of the sterile seedling was placed in it for 8 minutes. The bacterial culture on the surface of the hypocotyl segment was then blotted dry with sterile filter paper and dried appropriately. The hypocotyl segment was then inoculated onto a co-culture medium lined with filter paper and co-cultured at 22°C for 3 days.

[0098] (3) Screening, culturing and differentiating into embryos.

[0099] Screening culture: After co-culture is completed, hypocotyl segments are inoculated onto screening medium and cultured in a light-illuminated culture room. Subculture is performed every 4 weeks until embryogenic callus is obtained.

[0100] Embryogenic callus differentiation into embryos: Embryogenic callus tissue was subcultured onto differentiation medium to induce the production of cotyledonary embryos. Subculture was repeated every 4 weeks until cotyledonary embryos were obtained.

[0101] (4) Differentiation into seedlings and transplantation of regenerated seedlings.

[0102] Differentiation into seedlings: Transfer the cotyledon embryo to the seedling culture medium, gently insert the radicle downwards into the culture medium, and it will usually differentiate into a seedling in about 4 weeks; if the roots of the seedling are brown, remove the brown roots and subculture the seedling onto the seedling culture medium.

[0103] Transplanting of regenerated seedlings: After the root system of the regenerated plants is strong, wash off the culture medium with tap water, then harden the seedlings with tap water or nutrient solution for 4 days. After that, transplant them into nutrient pots containing nutrient soil. The nutrient soil needs to be well-aerated and fertile.

[0104] The culture medium formulation used to construct transgenic overexpression plants is as follows: Aseptic seedling culture medium: 1 / 2 MS + 1.5% Glucose + 0.25% Phytagel, pH 6.30.

[0105] MSB: MS + inositol (100 mg / L) + glycine (2 mg / L) + nicotinic acid (0.5 mg / L) + pyridoxine hydrochloride (0.5 mg / L) + thiamine hydrochloride (0.1 mg / L).

[0106] Co-culture medium: MSB + 2,4-D 0.1 mg / L + KT 0.1 mg / L + MgCl2·6H2O 0.3 g / L + 3% Glucose + 0.25% Phytagel pH 5.85.

[0107] Screening medium: MSB + 2,4-D 0.1 mg / L + KT 0.1 mg / L + MgCl2·6H2O 0.3 g / L + 3% Glucose + Cef 400 mg / L + Kan 50 mg / L + 0.25% Phytagel pH 5.85.

[0108] Differentiation medium: MSB (NH4NO3-free, 2XKNO3-free) + IBA 0.5 mg / L + KT 0.15 mg / L + 3% Glucose + Gln 1.0 g / L + Asn 0.5 g / L + 0.25% Phytagel pH 5.90.

[0109] Seedling culture medium: 1 / 2 MSB + Gln 0.5 g / L + Asn 0.25 g / L + 1.5% Glucose + 0.25% Phytagel pH 5.90.

[0110] MGL medium: Tryptic peptone 5g / L + NaCl 5g / L + MgSO4·7H2O 0.1g / L + KH2PO4 0.25g / L + Mannitol 5g / L + Glycine 1.0g / L pH 5.60.

[0111] DNA was extracted from transgenic cotton tissue using the CTAB method, based on GhOST1 PCR primers F4 and R4 were designed based on the gene sequence, with an expected fragment size of 549 bp. PCR results showed that the exogenous gene was successfully introduced into the cotton receptor HM-1. Figure 7 Proteins were extracted from functional leaf tissues of stably inherited transgenic progeny, boiled at 95℃ for 10 min, and GhOST1 protein was detected by SDS-PAGE. Western blotting using Anti-HA was used to analyze the GhOST1 protein content in transgenic cotton plants overexpressing the gene. Results showed that overexpression... GhOST1 Transgenic cotton plants showed significant enrichment of the GhOST1 protein band, see Figure 8 That is, overexpression was obtained through the above method. GhOST1 Plants that overexpress the gene are denoted as OE- GhOST1 .

[0112] F4, SEQ ID No. 8: 5'-CCACTGACGTAAGGGATGACG-3'.

[0113] R4, SEQ ID No. 9: 5'-CATCACAATAGCCAAATGGGTTGG-3'.

[0114] 3.2 Construction of gene-edited plants.

[0115] (1) CRISPR- GhOST1 Target site design and vector construction.

[0116] Based on the above-mentioned GhOST1Two CRISPR target sites (OST1-T1 and OST1-T2) were designed based on the gene's corresponding genomic sequence to improve gene targeting efficiency. Target site PCR amplification primers (T1s, T2as, and inf-T2as) were designed based on these target sites. These primers were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. After primer synthesis, PCR amplification was performed to obtain fragments containing the target sites. The PCR fragments were cloned into the final CRISPR expression vector P7N-TRNA using recombinase from Nanjing Novizan Biotechnology Co., Ltd. The constructed CRISPR vector was electroporated into *E. coli* TOP10, and positive clones were screened by colony PCR. One positive clone was selected from the CRISPR vector for sequencing. The above process involves replacing the DNA fragment between the BsaI restriction sites of P7N-TRNA with the sequence of SEQ ID No. 15 while maintaining the other sequences of P7N-TRNA unchanged to obtain the recombinant plasmid.

[0117] OST1-T1, SEQ ID No. 10: 5'-GTATATCGAGAGAGGTGAGA-3'.

[0118] OST1-T2, SEQ ID No. 11: 5'-CGTTTGAAGATTTGTGACTT-3'.

[0119] PCR amplification primers constructed from the vector: T1s, SEQ ID No. 12: 5'-CGATTCCCGGCTGGTGCAGTATATCGAGAGAGGTGAGAGTTTTAGAGCTAGAAATA-3'.

[0120] T2as, SEQ ID No. 13: 5'-TTCTAGCTCTAAAACAAGTCACAAATCTTCAAACGTGCACCAGCCGGGAAT-3' inf-T2as, SEQ ID No. 14: 5'-TTCTAGCTCTAAAACAAGTCACAAATCTTCAAACG-3'.

[0121] SEQ ID No. 15: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGTATATCGAGAGAGGTGAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCACGTTTGAAGATTTGTGACTT.

[0122] Gene-editing vectors were introduced into the cotton recipient plant HM-1 via Agrobacterium-mediated genetic transformation, ultimately obtaining the gene-edited line CRISPR-GhOST1. The transformation process was consistent with that of the overexpression plants described above. DNA was extracted from the transformed plants using the CTAB method. GhOST1 Sequences near two gene editing sites were amplified by PCR and sequenced for comparison analysis to detect the editing status of the target sites.

[0123] The results showed that CRISPR-GhOST1 contained a base deletion compared to the wild-type plant. Sequencing alignment revealed a 7bp deletion at the target site. Figure 9 This invention achieves this through CRISPR / Cas9 technology. GhOST1 The gene-edited plant CRISPR-GhOST1.

[0124] 4. Overexpression GhOST1 Stress phenotype of transgenic plants.

[0125] 4.1 Overexpression GhOST1 Genetically modified cotton plants are drought resistant The overexpression obtained by the present invention GhOST1 When cotton plants with the gene and HM-1 control plants were subjected to drought stress, overexpression was found. GhOST1 Compared with the HM-1 receptor control plants, the genetically modified cotton plants were more tolerant to drought stress. Figure 10 The drought stress condition of this invention refers to: after the soil is saturated with water, watering is stopped, and the soil dries naturally until the plants show signs of wilting.

[0126] 4.2 Overexpression GhOST1 Determination of photosynthetic rate in cotton plants based on genes.

[0127] overexpression GhOST1After drought stress treatment, the second true leaves of cotton plants (both gene-modified and HM-1 control plants) were collected, and overexpression was measured using a LI-6400 portable photosynthesis measurement system. GhOST1 The photosynthetic rate indices of the gene-modified cotton plants and the receptor HM-1 control plants were analyzed. Results showed that under drought stress, overexpression... GhOST1 Compared with the HM-1 receptor control plants, the genetically modified cotton plants had a higher photosynthetic rate, see... Figure 11 .

[0128] 4.3 Overexpression GhOST1 Determination of chlorophyll content in cotton plants using genetic methods.

[0129] overexpression GhOST1 After drought stress treatment, the second true leaves of the overexpressing cotton plants and the HM-1 control plants were cut off. 0.1g of the leaves were weighed and cut into thin strips 1mm wide and 1cm long with a blade. The strips were added to 95% ethanol solution and extracted in the dark until the leaves were completely decolorized. The absorbance values ​​at 663nm and 645nm were measured using a spectrophotometer.

[0130] The results showed that overexpression was observed under drought stress. GhOST1 Compared with the HM-1 receptor control plants, the genetically modified cotton plants had a higher chlorophyll content, see [link to relevant documentation]. Figure 12 .

[0131] 5. Overexpression GhOST1 The effects of drought stress on stomatal opening and closing in cotton leaves.

[0132] 5.1 Overexpression GhOST1 Thermal infrared results of genetically modified plants.

[0133] overexpression GhOST1 Genetically modified cotton plants and HM-1 receptor control plants were subjected to drought stress treatment, and the surface temperature of the plant leaves was recorded in real time using a vario CAM HD infrared camera. The results showed that under drought stress, overexpression of HM-1... GhOST1 The genetically modified cotton plants exhibited higher leaf temperatures than the HM-1 control plants. Higher leaf temperatures were associated with less transpiration and water loss, indicating overexpression. GhOST1 Genetically modified cotton plants exhibited slightly less transpiration than the HM-1 control plants, see [link to relevant documentation]. Figure 13 .

[0134] 5.2 Overexpression GhOST1 Determination of water loss rate in genetically modified plants.

[0135] overexpression GhOST1Genetically modified cotton plants and HM-1 receptor control plants underwent in vitro dehydration treatment. Leaves were collected from the plants, and their fresh weight was weighed at different time points to detect changes in the rate of water loss. Results are shown below. Figure 14 Overexpression was found GhOST1 Genetically modified cotton plants lost water at a lower rate than the HM-1 control plants.

[0136] 5.3 Overexpression GhOST1 The effect on the opening and closing of stomata on cotton leaves.

[0137] Select overexpression GhOST1 Second true leaves of the genetically modified cotton plant and the recipient HM-1 control plant were collected. The epidermis of the underside of the leaves from the same part of each plant was carefully removed with tweezers and soaked in MES-KOH buffer for 3 hours. The plants were then placed in a light incubator to ensure complete stomata opening. Next, 100 μM ABA was added to the MES-KOH buffer, and the plants were treated in a light incubator for 3 hours. Chloroplasts were removed from the epidermis with a brush, and the leaves were placed on a glass slide. A coverslip was placed on the slide, and excess water was absorbed with absorbent paper while gently pressing with the thumb. The stomatal opening of the different treated materials was recorded under a 20x objective lens. The procedure was performed as quickly as possible. Stomatal opening was measured using ImageJ software. The results showed that overexpression... GhOST1 It promoted ABA-induced stomatal closure, see Figure 15 .

[0138] MES-KOH buffer formulation: 10 mM MES-KOH, 10 mM KCl, 0.05 mM CaCl2 6. CRISPR- GhOST1 Stress phenotypes in gene-edited plants.

[0139] 6.1 CRISPR- GhOST1 Gene-edited plants are sensitive to drought stress.

[0140] The CRISPR- obtained above GhOST1 Seeds of gene-edited cotton plants and recipient HM-1 control plants were soaked for 12 hours and then planted in nutrient soil. After germination, seedlings were regularly irrigated with modified Hoagland nutrient solution and cultured in a light-controlled incubator. Drought treatment was applied at the two-leaf stage until the cotton seedlings exhibited a drought phenotype, during which observation and photographic recording were performed. It was found that CRISPR-GhOST1 gene-edited cotton plants were more sensitive to drought stress than recipient HM-1 control plants. Figure 16 .

[0141] 6.2, CRISPR- GhOST1 SPAD value determination of leaves of gene-edited plants For the second true leaf of the aforementioned cotton seedlings, a SPAD-502Plus chlorophyll meter (KONICAminOLTA, Japan) was used. At least 10 points were randomly selected on each leaf, avoiding the veins, for measurement. The average value was calculated using the instrument's built-in AVERAGE function and recorded as the SPAD value for that leaf. The results showed that CRISPR- GhOST1 Gene-edited cotton plants had lower chlorophyll content compared to the recipient HM-1 control plants, see [link to relevant documentation]. Figure 17 .

[0142] 7. CRISPR- GhOST1 The effects of drought stress on stomatal opening and closing in cotton leaves.

[0143] 7.1 CRISPR- GhOST1 Determination of water loss rate in gene-edited plants.

[0144] CRISPR- GhOST1 Gene-edited cotton plants and HM-1 control plants were subjected to in vitro dehydration treatment. The aboveground parts of the plants were collected, and their fresh weight was measured at different time points. Changes in the water loss rate were analyzed, revealing that CRISPR- GhOST1 Gene-edited plants lost water at a higher rate than HM-1 control plants. Figure 18 .

[0145] 7.2, CRISPR- GhOST1 The effect on the opening and closing of stomata on cotton leaves.

[0146] Select CRISPR- GhOST1 Second true leaves of gene-edited cotton plants and recipient HM-1 control plants were collected. The epidermis of the underside of leaves from the same part of different plants was carefully removed with tweezers and soaked in MES-KOH buffer for 3 hours. The plants were then placed in a light incubator to ensure complete stomata opening. Next, 100 μM ABA was added to the MES-KOH buffer and the plants were treated in a light incubator for 3 hours. Chloroplasts were removed from the epidermis with a brush, and the leaves were placed on a glass slide. A coverslip was placed on the slide, and excess water was absorbed with absorbent paper while gently pressing with the thumb. The stomatal opening of the different treated materials was recorded under a 20x objective lens. The procedure was performed as quickly as possible. Stomatal opening was measured using ImageJ software. The results showed that CRISPR- GhOST1 The stomata of gene-edited plants are insensitive to ABA, see Figure 19 .

[0147] 8. Determination of theoretical yield of genetically modified cotton.

[0148] The overexpression obtained by this invention GhOST1 Genetically modified cotton plants, CRISPR- GhOST1Gene-edited cotton plants were artificially sown with the recipient variety HM-1, with two seeds per hole and a plant spacing of 20cm × 76cm; field water control management was implemented: a control group and a normal water supply area (300m²) were established. 3 / mu), water control zone (100m) 3 (per mu), with separate sampling for each plot. Record the number of bolls per plant, the dry weight of bolls per plant, and calculate the total dry weight of bolls per hectare.

[0149] The results showed that under drought stress, overexpression GhOST1 Genetically modified cotton plants had a higher boll dry weight compared to the recipient HM-1 control plants. (CRISPR-) GhOST1 Gene-edited cotton plants had lower boll dry weight compared to the recipient HM-1 control plants, see [link to relevant documentation]. Figure 20 .

[0150] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0151] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of GhOST1-related biological products in regulating plant agronomic traits and / or plant breeding, characterized in that, GhOST1 refers to any one of the following: A: The amino acid sequence shown in SEQ ID No. 1; B: The amino acid sequence obtained by linking the tag protein to the N-terminus and / or C-terminus of SEQ ID No. 1; C: An amino acid sequence that has more than 90% sequence identity and function identical to SEQ ID No. 1, obtained by substituting, deleting and / or adding amino acid residues based on SEQ ID No.

1.

2. The application as described in claim 1, characterized in that, The tagged protein includes at least one of the following: Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and SUMO tag; The above 90% sequence identity can be at least 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

3. The application as described in claim 1, characterized in that, The biological product is any one of the following: a) Nucleic acid molecules encoding GhOST1; b) An expression cassette containing the nucleic acid molecule described in a); c) A recombinant vector containing the nucleic acid molecule described in a) or a recombinant vector containing the expression cassette described in b); d) Recombinant microorganisms containing the nucleic acid molecules described in a), recombinant microorganisms containing the expression cassette described in b), or recombinant microorganisms containing the recombinant vector described in c); e) A transgenic plant cell line containing the nucleic acid molecule described in a), a transgenic plant cell line containing the expression cassette described in b), or a transgenic plant cell line containing the recombinant vector described in c); f) Transgenic plant tissue containing the nucleic acid molecule described in a), transgenic plant tissue containing the expression cassette described in b), or transgenic plant tissue containing the recombinant vector described in c); g) A transgenic plant organ containing the nucleic acid molecule described in a), a transgenic plant organ containing the expression cassette described in b), or a transgenic plant organ containing the recombinant vector described in c); h) Transgenic plants containing the nucleic acid molecule described in a), transgenic plants containing the expression cassette described in b), or transgenic plants containing the recombinant vector described in c); i) Tissue cultures produced from the regenerative cells of the transgenic plants described in h); j) Protoplasts produced from the tissue culture described in i); k) Recombinant vectors that enhance GhOST1 expression, recombinant vectors that enhance GhOST1 activity, or recombinant vectors that increase GhOST1 content; l) Recombinant microorganisms that enhance GhOST1 expression, recombinant microorganisms that enhance GhOST1 activity, or recombinant microorganisms that increase GhOST1 content; m) Recombinant vectors that inhibit GhOST1 expression, recombinant vectors that inhibit GhOST1 activity, or recombinant vectors that reduce GhOST1 content; n) Recombinant microorganisms that inhibit GhOST1 expression, recombinant microorganisms that inhibit GhOST1 activity, or recombinant microorganisms that reduce GhOST1 content.

4. The application as described in claim 3, characterized in that, The recombinant microorganism is any one of yeast, bacteria, algae, and fungi; The genetically modified plant organ is any one of the following: root, stem, leaf, flower, fruit, and seed of the genetically modified plant; The tissue culture is derived from any one of the following: root, stem, leaf, flower, fruit, seed, pollen, embryo, and anther.

5. The application as described in claim 3, characterized in that, The nucleic acid molecule is DNA or RNA; The DNA includes any one of cDNA, genomic DNA, and recombinant DNA; The RNA includes either mRNA or hnRNA.

6. The application as described in claim 1, characterized in that, The agronomic traits refer to stress resistance and / or yield; Plant breeding refers to any one of the following: ① Cultivate transgenic plants with enhanced stress resistance; ②Prepare products for cultivating transgenic plants with enhanced stress resistance; ③ Cultivate gene-edited plants with reduced stress resistance; ④ Prepare products for cultivating gene-edited plants with reduced stress resistance.

7. The application as described in claim 6, characterized in that, The aforementioned resilience refers to drought resistance.

8. The application as described in claim 1, characterized in that, The plant is any one of the following: Ⅰ: Monocotyledons; II: Dicotyledonous plants; III: Cruciferous plants; IV: Plants of the genus *Gossypium*; V: Cotton.

Images