Infective pseudo-ginseng virus A cloning vector
By constructing the Panax notoginseng A virus cloning vectors pCB301-PnVA and pPnVA-GFP, the problem of low detection efficiency of Panax notoginseng virus was solved, and efficient infection and virus expression in Panax notoginseng and Nicotiana benthamiana were achieved, providing a key tool for studying virus interaction mechanisms and prevention and control strategies.
Patent Information
- Application Number
- CN202610016758.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-07
- Publication Date
- 2026-04-10
AI Technical Summary
The lack of rapid and efficient methods for detecting Panax notoginseng viruses in existing technologies makes infected plants susceptible to cross-infection during harvesting, storage, and planting, leading to an increase in the incidence of Panax notoginseng virus diseases and seriously affecting the sustainable development of the Panax notoginseng industry.
Infectious Panax notoginseng A virus cloning vectors pCB301-PnVA and pPnVA-GFP were constructed and transformed into Panax notoginseng and Nicotiana benthamiana leaves via Agrobacterium-mediated transformation. The replication and accumulation of the virus in the plants were detected by GFP fluorescent protein, achieving efficient expression and induction of viral symptoms.
The successful establishment of systemic infection in Panax notoginseng and Nicotiana benthamiana enabled convenient genetic manipulation of the viral genome, providing an intuitive means of monitoring viral distribution and movement, and laying the foundation for in-depth research on host interaction mechanisms and disease control.
Smart Images

Figure CN121826053A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant virus and genetic engineering technology, specifically, it relates to an infectious PnVA virus cloning vector. Background Technology
[0002] Panax notoginseng is a precious traditional Chinese medicine. Its roots, stems, leaves, and flowers can all be used medicinally, primarily for treating injuries from falls and blows, and for stopping bleeding and dispersing blood stasis. Panax notoginseng has a long growth cycle, is sensitive to light, and prefers warm, humid environments. During cultivation, it is highly susceptible to pests and diseases (Li JB, Bao YL, Wang ZR, Yang Q, Cui XM. Research progress in diseases of...). Panax notoginseng [J]. Physiological and Molecular Plant Pathology, 2022, 121:101878.). Currently, there is no rapid and efficient method for detecting Panax notoginseng virus in production. Infected plants and normal seedlings are highly susceptible to cross-infection during harvesting, storage, and planting, leading to a continuous increase in the incidence of Panax notoginseng virus disease. In Panax notoginseng plantations in Wenshan Prefecture, Yunnan Province, the prevalence of virus disease has reached as high as 60%. Viral infection usually leads to symptoms such as stunted plants, thinner rhizomes, and smaller leaves. The average fresh weight of infected plants decreases by about 50%, which seriously affects the sustainable development of the Panax notoginseng industry (Ma Ni, Wang Yong, Liu Yunzhi, Sun Yuqin, Chen Yujun. Study on the impact of Panax notoginseng virus disease on the yield and quality of Panax notoginseng [J]. Modern Agricultural Science and Technology, 2015, (14): 110-111.).
[0003] Sanqi A virus ( Panax notoginseng virus A PnVA is a double-stranded RNA (dsRNA) virus isolated from Panax notoginseng leaves exhibiting yellowing and shriveling symptoms (GenBank accession no. KT388111). The virus genome is 5003 bp in length and contains two open reading frames (ORF1 and ORF2). ORF1 (located at 78-2357 nt) encodes an 85.7 kDa capsid protein (CP), whose amino acid sequence is similar to that of Black Raspberry Virus F (PnVA) of the Totiviridae family. Black raspberry virus F The outer shell protein shows the highest homology. ORF2 (located at 2471-4939 nt) encodes a 94.32 kDa protein, which is similar to proteins from the entire genus ORF2 (…). Totivirus The RNA replicase (RdRp) of the representative species members showed the highest similarity. Based on phylogenetic analysis, PnVA was identified as belonging to the family Totiviridae. Totivirusa new member of the genus Tobamovirus and named Panax ginseng virus A (PnVA) (Guo LF, Yang X, Wu W, Tan GL, Fang S, Zhang SG, Li F. Identification and molecular characterization of Panax notoginseng virus A , which may represent an undescribed novel species of the genus Totivirus , family Totiviridae [J]. Archives of Virology, 2016, 161(3): 731-4.).
[0004] Virus infectious clone is a recombinant DNA molecule containing the complete genome of a virus, which is constructed in vitro. It can initiate the replication of viral genome and the assembly of viral particles in host cells, and further produce infectious progeny virus and trigger typical disease symptoms (Zhang L, Jelkmann W. Construction of full-length infectious cDNA clones of apple chlorotic leaf spot virus and their agroinoculation to woody plants by a novel method of vacuum infiltration[J]. Plant Disease, 2017, 101(12): 2110-2115.). In 1984, the first plant virus infectious clone, the alfalfa mosaic virus (AMV), was constructed (Baul CM, Edwards AC, Gatehouse LN, Gilchrist BM, Brooke JM, Edwards GM. Construction of full-length cDNA infectious clones of Brome mosaic virus, BMV) were successfully constructed, which laid the foundation for the construction of many plant virus infectious clones later (Li XQ, Li Y, Chen SY, Wang JG. Construction of stable infectious full-length and eGFP-tagged cDNA clones of Mirabilis crinkle mosaic virus via In-Fusion cloning [J]. Virus Research, 2020, 286: 198039.). As an important tool for reverse genetic manipulation of viral genomes, plant virus infectious clones have strongly promoted the in-depth study of virus-host interaction, virus life cycle and pathogenic mechanism. On this basis, the construction of virus expression vectors carrying reporter genes (such as green fluorescent protein GFP) can directly track the infection and accumulation process of viruses in plants (Feng CW, Guo X, Gu TX, Hua YH, Zhuang XJ, Zhang K. Generation of a triple-shuttling vector and the application in plant plus-strand RNA virus infectious cDNA clone construction [J]. International Journal of Molecular Sciences, 2023, 24(6): 5477.). SUMMARY
[0005] The application provides a Panax A virus cloning vector pCB301-PnVA with infectivity, and the nucleotide sequence of the vector is shown as SEQ ID NO: 1.
[0006] The vector can also comprise a GFP gene, and the application amplifies the CP gene and RdRp gene of Panax A virus and a GFP reporter gene, and fuses the GFP gene to the virus RdRpDownstream of the gene, a recombinant vector capable of expressing viral proteins and reporter proteins simultaneously is successfully constructed, and the recombinant vector is named as pPnVA-GFP. The pPnVA-GFP vector is transformed into leaves of receptor plants (Panax notoginseng and Nicotiana benthamiana) by an Agrobacterium-mediated method for expression, so as to verify whether the vector can successfully replicate in the plant body and cause viral symptoms, and the expression of the vector is detected by means of the GFP fluorescent protein. The experiment proves that the vector can complete the replication of viral genes in the plant cell and cause typical viral disease symptoms; meanwhile, the replication and accumulation dynamics of the virus in the host body are realized by means of the GFP fluorescent signal. The pPnVA-GFP vector constructed by the application provides a key tool and experimental basis for in-depth research on the interaction mechanism of PnVA and host plants, and has important scientific research and application value.
[0007] The object of the application is achieved by the following technical solutions. The CP gene and the RdRp gene fragments of Panax notoginseng virus A are amplified from the cDNA of Panax notoginseng leaves infected with Panax notoginseng virus A by means of RT-PCR, the GFP gene fragment is amplified from the pBI221-GFP vector plasmid by means of PCR, the CP gene and the RdRp gene fragments are cloned into the linearized pCB301 vector by means of the Infusion HD recombination enzyme, and the pCB301-PnVA recombinant vector is constructed. On the basis of the recombinant vector, the GFP gene fragment is cloned into the downstream of the RdRp gene of the linearized pCB301-PnVA vector by means of the Infusion HD recombination enzyme, the recombinant vector is screened, and the plasmid is extracted, so as to obtain the Panax notoginseng virus A infectious cloning vector pPnVA-GFP carrying the GFP gene; (2) The recombinant plasmid pCB301-PnVA or pPnVA-GFP of step (1) is transformed into the Agrobacterium GV3101 strain, the Panax notoginseng leaves are infiltrated by means of injection, the Panax notoginseng plants are observed regularly, and whether the leaves appear disease symptoms is recorded; the expression and distribution of the GFP protein can be detected by means of a handheld fluorescence detector for the pPnVA-GFP transfection. In order to confirm the successful replication of the virus in the Panax notoginseng leaves, the CP gene fragment of Panax notoginseng virus A is amplified from the total RNA of the symptomatic leaves by means of RT-PCR technology and is verified; (3) The recombinant plasmid pCB301-PnVA or pPnVA-GFP obtained in step (1) is transformed into the Agrobacterium GV3101 strain, the Nicotiana benthamiana leaves are infiltrated by means of injection, the Nicotiana benthamiana plants are observed regularly, and whether the leaves appear disease symptoms is recorded; the expression and distribution of the GFP protein can be detected by means of a handheld fluorescence detector for the pPnVA-GFP transfection. In order to confirm the successful replication of the virus in the Nicotiana benthamiana leaves, the CP gene fragment of Panax notoginseng virus A is amplified from the total RNA of the symptomatic leaves by means of RT-PCR technology and is verified; The results show that the Panax A virus clone vectors pCB301-PnVA or pPnVA-GFP can not only establish systemic infection in a model plant tobacco and express a reporter gene efficiently, but also establish systemic infection in Panax and express a reporter gene efficiently.
[0008] The clone vectors pCB301-PnVA or pPnVA-GFP constructed by using a recombination technology are the first infectious clone vectors related to Panax A virus, can stably infect Panax and a model plant Nicotiana benthamiana, and the pPnVA-GFP can express GFP in leaves of infected plants efficiently. The establishment of the infectious clone system realizes convenient genetic operation on the genome level of PnVA. The fluorescence labeling system based on GFP can directly and visually reflect the distribution, movement and colonization process of viruses in the plant body, not only provides key technical support for in-depth analysis of the interaction mechanism and pathogenic mechanism of PnVA and the host, but also provides a theoretical basis for the development of relevant virus disease prevention and control strategies. BRIEF DESCRIPTION OF DRAWINGS
[0009] Figure 1 is a schematic diagram of construction of the infectious clone vectors pCB301-PnVA and pPnVA-GFP; Figure 2 is a detection result diagram of pPnVA-GFP or pCB301-PnVA transgenic Panax 21 days after agrobacterium injection, Fig. A is an observation diagram of pPnVA-GFP transgenic Panax under natural light and a green fluorescence observation diagram under ultraviolet light; Fig. B is an observation diagram of pCB301-PnVA transgenic Panax under natural light; Fig. C is a PCR detection result diagram, wherein, a negative control (-) is a PCR product of cDNA of Panax infected by empty vector (pCB301) as a template; a positive control (+) is a PCR product of pPnVA-GFP plasmid as a template; (1) is a PCR product of cDNA of pPnVA-GFP transgenic Panax as a template; (2) is a PCR product of cDNA of pCB301-PnVA transgenic Panax as a template; Figure 3Figure 1 shows the detection results of pPnVA-GFP or pCB301-PnVA transgenic tobacco plants 21 days after Agrobacterium injection. Figure 2 shows the observation of pPnVA-GFP transgenic tobacco plants under natural light and under ultraviolet light. Figure 3 shows the observation of pCB301-PnVA transgenic tobacco plants under natural light. Figure 4 shows the PCR detection results. The negative control (-) is the PCR product with empty vector (pCB301) transgenic tobacco cDNA as template. The positive control (+) is the PCR product with pPnVA-GFP plasmid as template. (1) is the PCR product with pPnVA-GFP transgenic tobacco cDNA as template. (2) is the PCR product with pCB301-PnVA transgenic tobacco cDNA as template. Detailed Implementation
[0010] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in the embodiments are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.
[0011] Example 1: Construction of an infectious cloning vector for Panax notoginseng A virus ① Panax notoginseng A virus CP Genes and RdRp Gene amplification PnVA-infected Panax notoginseng leaves were collected from a Panax notoginseng cultivation base in Wenshan, Yunnan Province. The leaves were ground with liquid nitrogen, and total RNA was extracted using the TRIzol reagent method. First-strand cDNA was synthesized using the GoScript™ Reverse Transcriptase System. The reaction system and procedure were as follows: 5 μg total RNA, 1 μL Oligo dT15, 1 μL Randomprimer, and Nuclease-Free Water to a final volume of 10 μL. The mixture was incubated at 70°C for 5 min, followed by an ice bath for 5 min. Then, 4 μL 5×Reaction Buffer, 4 μL 25 mM MgCl2, 1 μL PCR Nucleotide Mix, 0.4 μL RNasin® Ribonuclease Inhibitor, 0.4 μL Reverse Transcriptase, and 1.2 μL Nuclease-Free Water were added. The reaction was incubated at 25°C for 5 min, 42°C for 90 min, and 70°C for 10 min. The resulting cDNA was stored at -20°C.
[0012] Using cDNA as a template, two pairs of primers were designed to amplify PnVA- CPand PnVA- RdRp Fragments, primer sequences were PnVA- CP F: GAGGCCTGACCTGCAGGTCGACATGGATTCCTTCGTGCGACAG, PnVA- CP R: GTTATTCCTGGTTAAAGGCACTTTACTCATATCCTCTACCACACCTTGGACAT, PnVA- RdRp F: ATGTCCAAGGTGTGGTAGAGGATATGAGTAAAGTGCCTTTAACCAGGAA TAAC, PnVA- RdRp R: GCCATGCCGACCCGGGGATCCTAATAAAGTGCGTAATGTGTAAT CTACATCTTTCAC; the target fragment was amplified by Ex Taq® DNA Polymerase (TaKaRa, Japan). The PCR system was as follows: 2.5 μL cDNA, 5 μL 10×Ex Taq Buffer, 4.5 μL dNTP Mixture, 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 0.25 μL Ex Taq enzyme (5 U / μL), and Nuclease-Free Water was added to 50 μL. CP The gene amplification procedure was 94℃ 5 min; 32 cycles (95℃ 30 s, 62℃ 30 s, 72℃ 2 min 20 s); 72℃ 5 min. RdRp The gene amplification procedure was 94℃ 5 min; 32 cycles (95℃ 30 s, 63℃ 30 s, 72℃ 2 min 40 s); 72℃ 5 min. The PCR product was verified by agarose gel electrophoresis.
[0013] 2. Construction of Panax notoginseng A viral infectious clone vector The pCB301 plasmid was double-digested by restriction endonucleases Sal I and Bam HI (TaKaRa, Japan), and the reaction system and operation process were as follows: 20 μL pCB301 plasmid, 10 μL 10×K buffer, 5 μL Sal I, 5 μL BamAdd HI, then add Nuclease-Free Water to 50 μL, mix well, centrifuge briefly, and incubate at 37℃ for 3 h for enzyme digestion. Spot the digestion product and the above PCR product onto an agarose gel for electrophoresis, then perform PnVA- CP Fragment, PnVA- RdRp The fragments and the linearized pCB301 vector large fragment were recovered separately using gel electrophoresis, and multi-fragment recombination was performed using Infusion-HD enzyme. The recombination system consisted of 4 ng pCB301 vector and 2 ng PnVA- CP Fragment, 2 ng PnVA- RdRp Fragment, 2 μL Infusion-HD enzyme; react at 50℃ for 30 min. The ligation product was transformed into *E. coli* DH5α, plated on LB agar plates containing kanamycin (50 mg / L), and incubated overnight at 37℃. The correct infectious cloning vector pCB301-PnVA was screened by colony PCR. Figure 1 ), and extract plasmids.
[0014] ③ Amplification of the GFP gene Using the pBI221-GFP plasmid preserved in this experiment as a template, primers were used... GFP -F (TTACACATTACGCACTTTATTAATGGTGAGCAAGGGCGAG) and GFP -R (GCCATGCCGACCCGGGGATCCTTACTTGTACAGCTCGTCCATGCC) amplifies the GFP gene. This primer was used to amplify the 720 bp GFP gene. The PCR system and procedure were the same as step ①, except the extension time was changed to 72℃ for 45 s. The PCR product was recovered by gel electrophoresis to obtain the GFP fragment.
[0015] ④ Construction of the Panax notoginseng A virus infectious cloning vector pPnVA-GFP carrying the GFP gene The pCB301-PnVA vector obtained in step ② was used with restriction endonucleases Bam After HI digestion, the product was recovered from the gel. The digestion system was the same as that used in step ②. The pCB301-PnVA gel product and the product obtained in step ③ were recovered using Infusion-HD recombinase (purchased from TaKaRa). GFPThe genes were recombined. The recombination system was as follows: 50 ng of linearized PnVA vector, 30 ng of GFP gene fragment, 2 μL of Infusion-HD enzyme was added, and the reaction volume was made up to 10 μL with nuclease free water. The reaction system was placed at 50°C for 30 min. The recombination product was transformed into E. coli DH5α, and was coated on an LB plate containing kanamycin (50 mg / L) and was cultured at 37°C for 16 h. Positive clones were screened by colony PCR, and the pPnVA-GFP vector was obtained by extracting the plasmid Figure 1 ).
[0016] 5. pCB301-PnVA and pPnVA-GFP vectors were transformed into Agrobacterium 100 ng of pCB301-PnVA or pPnVA-GFP plasmid was added to 100 μL of Agrobacterium GV3101 competent cells, which were placed in an ice bath for 30 min, frozen in liquid nitrogen for 5 min, then heat shocked at 37°C for 5 min, placed in an ice bath for 2 min, and then 800 μL of antibiotic-free LB liquid medium was added, and the mixture was cultured at 28°C and 200 rpm for 4-6 h. The bacterial solution was coated on an LB plate containing kanamycin (50 mg / L) and rifampicin (20 mg / L), and was cultured at 28°C until single colonies appeared. Positive transformants were verified by colony PCR.
[0017] Example 2: pCB301-PnVA and pPnVA-GFP were transformed into strains and injected into Panax notoginseng leaves and pathogenicity was identified Agrobacterium GV3101 containing pCB301-PnVA or pPnVA-GFP plasmid was inoculated into 50 mL of LB liquid medium containing kanamycin and rifampicin, and was cultured at 28°C and 200 rpm for 12 h. The bacterial pellet obtained after centrifugation at 5000 rpm for 5 min was resuspended in buffer (10 mM MgCl2, 10 mM MES, 100 μM acetyl-syringone), and the OD 600 was adjusted to 1.0, and the mixture was placed at room temperature for 1 h before use.
[0018] Five two-year-old Panax notoginseng plants with consistent growth were selected and were placed under light for 2 h to promote stomatal opening. 1 mL of a sterile syringe was used to press and infiltrate pCB301-PnVA or pPnVA-GFP Agrobacterium resuspension into the leaves, and about 0.1 mL of bacterial solution was inoculated per leaf. Another 5 plants with similar growth were inoculated with Agrobacterium containing pCB301 empty vector in the same way as the negative control. All plants were placed in a greenhouse for 3 weeks, and the observation results are shown in Table 1. Figure 2As shown in A-B, the pCB301-PnVA and pPnVA-GFP transgenic leaves of Panax notoginseng showed yellowing symptoms, and the pPnVA-GFP transgenic leaves of Panax notoginseng emitted green fluorescence under ultraviolet light. In contrast, the empty transgenic leaves of Panax notoginseng showed no yellowing symptoms, and no green fluorescence was observed under ultraviolet light. PCR was performed using primers PnVA-F / R to detect the accumulation of PnVA, and the results are shown in C. The specific band of the CP gene was detected in the pCB301-PnVA and pPnVA-GFP transgenic leaves of Panax notoginseng, but not in the empty transgenic leaves of Panax notoginseng. The above results show that pCB301-PnVA and pPnVA-GFP successfully infected Panax notoginseng under Agrobacterium mediation, and replicated and spread in the leaves of Panax notoginseng, causing typical viral disease symptoms. CP Figure 2 As shown in A-B, the pCB301-PnVA and pPnVA-GFP transgenic leaves of Panax notoginseng showed yellowing symptoms, and the pPnVA-GFP transgenic leaves of Panax notoginseng emitted green fluorescence under ultraviolet light. In contrast, the empty transgenic leaves of Panax notoginseng showed no yellowing symptoms, and no green fluorescence was observed under ultraviolet light. PCR was performed using primers PnVA-F / R to detect the accumulation of PnVA, and the results are shown in C. The specific band of the CP gene was detected in the pCB301-PnVA and pPnVA-GFP transgenic leaves of Panax notoginseng, but not in the empty transgenic leaves of Panax notoginseng. The above results show that pCB301-PnVA and pPnVA-GFP successfully infected Panax notoginseng under Agrobacterium mediation, and replicated and spread in the leaves of Panax notoginseng, causing typical viral disease symptoms.
[0019] Example 3: Injection of tobacco leaves with pCB301-PnVA and pPnVA-GFP strains and pathogenicity identification In this example, the remaining steps are the same as in Example 2, except for inoculating the plants; Five 3-week-old Nicotiana benthamiana plants with consistent growth were selected, and 0.2 mL of pCB301-PnVA or pPnVA-GFP Agrobacterium resuspension solution with OD 600 was injected into the tobacco leaves, with 6 leaves per tobacco plant and 0.2 mL per leaf. Another 5 plants were inoculated with Agrobacterium containing pCB301 empty vector as negative controls. All plants were placed in a greenhouse for 3 weeks.
[0020] The results of phenotypic observation are shown in Figure 3 As shown in A-B, the pCB301-PnVA or pPnVA-GFP transgenic leaves of tobacco showed yellowing symptoms, and the pPnVA-GFP transgenic leaves of tobacco showed green fluorescence under ultraviolet light. In contrast, the empty transgenic tobacco plants showed no yellowing symptoms, and no green fluorescence was observed under ultraviolet light. PCR was performed using primers PnVA-F / R to detect the accumulation of PnVA, and the results are shown in C. The specific band of the CP gene was detected in the pCB301-PnVA or pPnVA-GFP transgenic leaves of tobacco, but not in the empty transgenic leaves of Panax notoginseng. The above results show that pCB301-PnVA and pPnVA-GFP successfully infected Nicotiana benthamiana, and replicated and spread in the new leaves of Nicotiana benthamiana, demonstrating their ability to cross-host infection. CP Figure 3 As shown in A-B, the pCB301-PnVA or pPnVA-GFP transgenic leaves of tobacco showed yellowing symptoms, and the pPnVA-GFP transgenic leaves of tobacco showed green fluorescence under ultraviolet light. In contrast, the empty transgenic tobacco plants showed no yellowing symptoms, and no green fluorescence was observed under ultraviolet light. PCR was performed using primers PnVA-F / R to detect the accumulation of PnVA, and the results are shown in C. The specific band of the CP gene was detected in the pCB301-PnVA or pPnVA-GFP transgenic leaves of tobacco, but not in the empty transgenic leaves of Panax notoginseng. The above results show that pCB301-PnVA and pPnVA-GFP successfully infected Nicotiana benthamiana, and replicated and spread in the new leaves of Nicotiana benthamiana, demonstrating their ability to cross-host infection.
Claims
1. An infectious Panax notoginseng A virus cloning vector, the nucleotide sequence of which is shown in SEQ ID NO:
1.
2. The infectious Panax notoginseng A virus cloning vector according to claim 1, characterized in that: The CP and RdRp genes of Panax notoginseng A virus were cloned into the pCB301 vector to obtain the infectious cloning vector pCB301-PnVA.
3. The infectious Panax notoginseng A virus cloning vector according to claim 2, characterized in that: The Panax notoginseng A virus cloning vector pCB301-PnVA is fused with the GFP gene, which is located downstream of the RdRp gene, to obtain the infectious cloning vector pPnVA-GFP with the fluorescent reporter gene GFP.