Application of transcription factor ZmWRKY34 in improving fungal disease resistance of corn
By screening and validating the WRKY transcription factor ZmWRKY34, a maize gene knockout mutant was constructed using CRISPR/Cas9 technology. This activated the Zx1 and Zx5 promoters, promoted the synthesis of phytoalexins, solved the problem of insufficient resistance to fungal diseases in maize, and achieved broad-spectrum disease resistance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-04-14
AI Technical Summary
The existing technology has not yet discovered WRKY transcription factors that can regulate the biosynthesis of terpene phytoalexins in maize and have significant resistance to Fusarium and Rhizoctonia species, resulting in insufficient resistance of maize to fungal diseases.
Bioinformatics analysis was used to screen for the WRKY transcription factor ZmWRKY34, and a ZmWRKY34 gene knockout mutant was constructed using CRISPR/Cas9 technology to verify its disease resistance function in maize. The results showed that it promotes the biosynthesis of maize sesquiterpene phytoprotectants by directly activating the Zx1 and Zx5 promoters, thereby improving maize's resistance to various fungal diseases.
ZmWRKY34 significantly improved maize's resistance to fungal diseases of the genera Fusarium and Rhizoctonia. By directly activating the transcription of Zx1 and Zx5, it promoted the synthesis of phytoalexins and achieved broad-spectrum disease resistance.
Smart Images

Figure CN121851131A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant molecular biology and crop disease resistance breeding, specifically to the application of transcription factor ZmWRKY34 in improving maize resistance to fungal diseases. Background Technology
[0002] corn( Zea mays L. As one of the world's most important food crops, maize can also be used as feed and fuel. However, maize often faces challenges from abiotic and biotic stresses, severely limiting its yield and quality. For example, stresses caused by Fusarium spp. (…) Fusarium ) fungus Fusarium graminearum ( Fusarium graminearum Fusarium moniliforme () Fusarium moniliforme Fusarium pseudoverticum ( Fusarium verticillioides Maize stem rot (Fusarium stem rot, FSR) and ear rot (…) caused by… Fusarium ear rot FER) and corn sheath blight caused by Rhizoctonia solani (FER) Banded leaf and sheath blight BLSB (Fluorescent Bacterial Strains) has led to a significant reduction in global maize production. Furthermore, the effects of climate change, overly dense planting, or long-term cultivation of the same maize variety can all result in the accumulation of pathogenic microorganisms in the soil, thereby promoting the occurrence of FSR, FER, and BLSB.
[0003] Breeding maize varieties with broad-spectrum insect and disease resistance while maintaining stable yields is a goal pursued by plant breeders. Broad-spectrum resistance (BSR) refers to resistance to multiple pathogens or most physiological races within the same species. To resist pathogen infection, plants can synthesize secondary metabolites with broad-spectrum antibacterial activity. For example, after maize is infected by pathogens or eaten by insects, it rapidly induces the production of non-volatile acidic terpenoids for defense; these terpenoids are named maize terpenoid phytoprotective agents. WRKY is a plant-specific zinc finger transcription factor that plays a crucial role in plant disease resistance and stress response. Currently, no WRKY transcription factor has been discovered in maize that can regulate the biosynthesis of maize terpenoid phytoprotective agents and significantly enhance resistance to both Fusarium and Rhizoctonia species. Summary of the Invention
[0004] Transcription factors that regulate resistance to various maize fungal diseases have been rarely reported. This invention, through bioinformatics analysis, gene co-expression analysis, and expression pattern analysis, screened and identified a gene involved in the synthesis of maize sesquiterpene phytoprotective factors (zealexins). Zx1, Zx5ZmWRKY34 (Zm00001eb346880), a member of the WRKY transcription factor family IIc subgroup co-expressed and induced by pathogens, has an amino acid sequence as shown in SEQ ID NO:2 and a nucleotide sequence encoding the gene as shown in SEQ ID NO:1.
[0005] This invention further constructs using CRISPR / Cas9 technology. zmwrky34 Gene knockout mutant maize material was tested by inoculation with Fusarium graminearum (Gynostemma pentaphyllum). Fusarium graminearum Fusarium moniliforme () Fusarium moniliforme Fusarium pseudoverticum ( Fusarium verticillioides ) and Rhizoctonia solani ( Rhizoctonia solani The study investigated the function of ZmWRKY34 in maize disease resistance against various pathogenic fungi, including wild-type fungi. Results showed that compared to the wild type, [ZmWRKY34] significantly improved maize resistance. zmwrky34 The knockout mutant showed significantly reduced resistance to the aforementioned pathogenic fungi, significantly increased lesion area, more vigorous mycelial growth, and significantly increased conidial number, demonstrating that ZmWRKY34 positively regulates maize's resistance to multiple fungal diseases.
[0006] To elucidate its molecular mechanism, this invention systematically investigated the regulatory role of ZmWRKY34 on downstream target genes using dual-luciferase reporter gene assays, yeast one-hybrid assays, DAP-qPCR assays, and electrophoretic gel retardation assays (EMSA). The results showed that ZmWRKY34 can specifically bind to... Zx1 B-box (TTGACT) at promoter site 904 and Zx5 The W-box (TGACT) at promoter site 880 is directly activated. Zx1, Zx5 The transcription of zealexins promotes the biosynthesis of maize sesquiterpene phytoprotective agents, thereby conferring broad-spectrum disease resistance to maize.
[0007] Based on the above findings, the present invention provides the following technical solution: In a first aspect, the present invention provides a maize transcription factor ZmWRKY34, which is: (a) A protein having the amino acid sequence shown in SEQ ID NO:2; or (b) A variant that has at least 90% sequence identity with the sequence shown in SEQ ID NO:2, and has a WRKY domain and retains the function of regulating phytoalexin synthesis; or (c) A protein encoded by the nucleotide sequence shown in SEQ ID NO:1.
[0008] Secondly, the present invention provides an isolated nucleic acid molecule that encodes the ZmWRKY34 protein described in the first aspect.
[0009] Thirdly, the present invention provides a recombinant expression vector comprising the nucleic acid molecule described in the second aspect, and a promoter operatively linked to the nucleic acid molecule.
[0010] Fourthly, the present invention provides a recombinant host cell comprising the recombinant expression vector described in the second aspect.
[0011] Fifthly, the present invention provides a method for improving maize's resistance to fungal diseases by increasing the expression level or biological activity of the ZmWRKY34 protein as described in claim 1 in maize through transgenic, gene editing or genetic breeding methods.
[0012] In a sixth aspect, the present invention provides a method for identifying or screening maize materials resistant to fungal diseases, comprising: detecting the expression level of the ZmWRKY34 gene or the activity of the ZmWRKY34 protein in a maize sample and comparing it with a control sample; Among them, maize materials with significantly higher expression levels or activities than the control were identified as having enhanced disease resistance.
[0013] Furthermore, the detection methods include, but are not limited to, quantitative PCR, Western blot, EMSA, or molecular marker-assisted selection.
[0014] In a seventh aspect, the present invention provides a method for breeding maize with disease resistance, comprising: crossing donor maize containing the ZmWRKY34 gene or its highly active allele with recipient maize, and selecting offspring carrying the gene or its allele through molecular marker-assisted selection to improve the resistance of the offspring to fungal diseases of the Fusarium and / or Rhizoctonia spp.
[0015] Furthermore, the phytoestrogen synthesis-related genes are preferably one or more of Zx1, Zx3, Zx4, and Zx5.
[0016] Eighthly, the present invention provides a method for regulating the biosynthesis of terpenoid phytoalexins in maize, characterized in that it includes: regulating the expression or activity of ZmWRKY34 protein, thereby regulating the expression of phytoalexin synthesis-related genes.
[0017] Ninthly, the present invention provides the use of the ZmWRKY34 protein described in the first aspect or the nucleic acid molecule described in the second aspect in the preparation of biological agents or breeding kits for improving maize resistance to fungal diseases.
[0018] The "fungal diseases" mentioned in this invention preferably include maize diseases caused by pathogenic fungi of the genera *Fusarium* and *Rhizoctonia*, including but not limited to maize stalk rot, ear rot, and sheath blight.
[0019] Compared with the prior art, the present invention has the following beneficial effects: Firstly, this invention investigated the effects of ZmWRKY34 gene knockout on plant disease susceptibility by constructing CRISP-Cas9 knockout mutant materials. Specifically, the expression level of ZmWRKY34 gene is positively correlated with the resistance level of maize to various fungal diseases. The maize WRKY transcription factor ZmWRKY34 can positively regulate maize's resistance to various fungal diseases, including Fusarium graminearum, Fusarium moniliforme, Fusarium verticillata, and Rhizoctonia solani.
[0020] Secondly, this invention further reveals the molecular mechanism of ZmWRKY34's disease resistance: ZmWRKY34 directly activates the transcription of key genes Zx1 and Zx5 in the zealexins synthesis pathway of maize by specifically recognizing W-box cis elements in the promoters of target genes, thereby rapidly initiating zealexin accumulation in the early stages of pathogen infection and conferring broad-spectrum disease resistance to maize. This mechanism has not been reported in the maize WRKY family before. Attached Figure Description
[0021] The accompanying drawings, which are provided to further illustrate the invention and constitute a part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings: Figure 1 This is an analysis of the co-expression and expression pattern of ZmWRKY34 and phytoalexin synthesis genes in Example 1 of the present invention; wherein, in Figure A, the left side represents the biosynthesis of maize diterpenoid phytoalexins, and the right side represents the biosynthesis of maize sesquiterpenoid phytoalexins, with MBGs representing MTP biosynthetic genes; Figure B shows the statistics of transcription factors co-associated with MTP synthesis genes ZmAn2 and Zx1, with CRGs representing... ZmAn2、Zx1 The top 300 coexpressed relative genes were identified. Figure C shows the induction pattern analysis of ZmWRKY34, Zx1, and ZmAn2 under Fusarium graminearum infection. Figure D shows the KEGG analysis of the top 300 coexpressed relative genes of ZmWRKY34 at the top and the GO analysis of the top 300 coexpressed relative genes of ZmWRKY34 at the bottom.
[0022] Figure 2 This is the carrier spectrum of pMD19-T-ZmWRKY34 in Embodiment 2 of the present invention.
[0023] Figure 3 These are the pSG-MU6 vector map (A) and pOSCas9 vector map (B) in Embodiment 3 of the present invention.
[0024] Figure 4 This refers to the identification of the ZmWRKY34 gene CRISPR / Cas9 knockout mutant material in Example 3 of this invention; wherein, Figure A is... zmwrky34 Editing status of target sites in three lines of knockout mutants; BC plots show the PCR band identification results and effective editing sequencing peaks of two homozygous lines, respectively.
[0025] Figure 5 This is a schematic diagram of the positive regulation of resistance to multiple Fusarium fungi by the maize transcription factor ZmWRKY34 in Example 4 of the present invention. In the figure, WT is the wild-type B104 of the CRISPR / Cas9 mutant of this gene. zmwrky Figures 34-6 / 14 represent two stable T4 generation mutant lines of ZmWRKY34 mediated by CRISPR / Cas9. Figure A shows the susceptibility phenotypes and lesion area statistics of the mutant and wild-type seedlings inoculated with *Fusarium graminearum*. Figure B shows the susceptibility phenotypes and lesion area statistics of the mutant and wild-type seedlings inoculated with *Fusarium moniliforme*. Figure C shows the susceptibility phenotypes and lesion area statistics of the mutant and wild-type seedlings inoculated with *Fusarium graminearum* during the heading stage. Figure D shows the susceptibility phenotypes and conidia number statistics of the mutant and wild-type seedlings inoculated with *Fusarium verticillatum*.
[0026] Figure 6 This is a schematic diagram of the positive regulation of Rhizoctonia solani by the maize transcription factor ZmWRKY34 in Example 5 of the present invention. In the diagram, WT represents the wild-type B104 of the CRISPR / Cas9 mutant of this gene. zmwrky 34-6 / 14 are two stable T4 generation mutant lines of ZmWRKY34 mediated by CRISPR / Cas9; Figure A represents the susceptible phenotype of the mutant and wild type inoculated with Rhizoctonia solani; Figure B represents the quantification of lesion length.
[0027] Figure 7 This is the pCAMBIA2300-eGFP vector map in Example 6 of the present invention.
[0028] Figure 8 In Embodiment 6 of this invention, ZmWRKY34 is directly activated. Zx1, Zx5 A schematic diagram illustrating the positive transcriptional regulation of zealexins biosynthesis; where A represents the construction of the dual-luciferase reporter gene system vector; and B represents the ZmWRKY34 pair. Zx1, Zx5 Promoter activity assay of the full-length promoter fusion of the LUC reporter gene; C represents yeast one-hybrid identification of ZmWRKY34 pairs. Zx1, Zx5 The promoter binds directly; D is for DAP-qPCR experiments to verify whether ZmWRKY34 can directly bind to the promoter. Zx1, Zx5 The promoter is rich in W-box regions; E is the EMSA-identified ZmWRKY34 that can interact with Zx1, Zx5 Fragments containing W-box in the promoter are directly combined. Detailed Implementation
[0029] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0030] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These descriptions are for illustrative purposes only and not for limiting the scope of protection of the present invention. Furthermore, it should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art.
[0031] Example 1:
[0032] This embodiment performs co-expression analysis and expression pattern analysis of ZmWRKY34 and phytoalexin synthesis genes, as detailed below: 1) Using the ATTED co-expression database (https: / / atted.jp / ), key rate-limiting enzyme genes in MTP biosynthesis were identified. ZmAn2 and ZmTPS6 Target genes ( Figure 1 A) Co-expression analysis was performed based on multiple maize transcriptome datasets. The top 300 genes most closely associated with the target gene were analyzed, and a heatmap of co-expressed genes was created using TBtools software. The results showed strong co-correlation among multiple MTP biosynthesis genes, indicating the reliability of the co-expression database. Furthermore, 10 and 9 transcription factors, respectively, were found to be co-expressed with the target gene. ZmAn2 , ZmTPS6 There is a co-association, among which ZmZNF4, ZmWRKY34, ZmWRKY56, ZmWRKY130, ZmWRKY106, and ZmHSF16 are simultaneously associated with two synthetic genes. Figure 1 B). This suggests that these transcription factors are more likely to be involved in the regulation of MTP biosynthesis.
[0033] To further screen potential transcription factors, this embodiment also analyzed the induced expression patterns of these transcription factors under pathogen infection based on the maize eFPbrowser database. The results showed that under infection by various pathogens such as *Fusarium graminearum*, *Colletotrichum gloeosporioides*, and *Fusarium verticillioides*, ZmWRKY34 and... ZmAn2, ZmTPS6 (ZX1) The spatiotemporal expression and induced expression of several terpene synthase genes were similar. Simultaneously, the expression patterns of ZmWRKY34, ZmAn2, and Zx1 at different time points under Fusarium graminearum infection were analyzed by real-time quantitative PCR. The specific procedure was as follows: leaf samples from different infection time points were flash-frozen in liquid nitrogen, ground, and RNA was extracted. Maize cDNA was obtained using a reverse transcription kit (Vazyme). The maize cDNA template obtained from reverse transcription was diluted to approximately 10-50 ng / μL. Quantitative primers with specific fragment sizes of 100-200 bp were designed based on the target gene base sequence (as shown in Table 1). After amplification by conventional PCR, the fragments were sequenced, and sequence alignment confirmed primer usability. Then, the optimal annealing temperature for the primers was screened. Since most phytoalexin synthesis genes are induced genes with low background expression, the DNA concentration was diluted to 100 ng / μL in the quantitative PCR, and the primers were diluted to 1 μM before and after. The fluorescent dye used was Novizan SYBR Green Mix. The 10 μL reaction system consisted of 2 μL cDNA, 0.3 μL each of the pre- and post-primer primers, 5 μL SYBR Green Mix, and 2.4 μL sterile water. The running program on the Bio-Rad CFX real-time PCR instrument was: 95 ℃ pre-denaturation for 30 s, 95 ℃ denaturation for 10 s, optimal annealing temperature for 30 s, 40 cycles, 95 ℃ for 15 s, 60 ℃ for 60 s, and 95 ℃ for 15 s. At least three biological replicates were performed for each sample. Maize ZmEf1α was used as the internal control gene. -ΔΔCt Data analysis was conducted. The results showed that maize leaves sampled at 0 h served as a control. The results revealed that ZmWRKY34 expression was significantly upregulated at 6 h of infection, reaching its peak at 48 h. However, at 12 h of infection, ZmWRKY34 expression was not significant, which may be related to the sampling time being under dark conditions, suggesting that ZmWRKY34 expression may be related to light. Notably, the expression pattern of ZmWRKY34 is similar to that of maize sesquiterpenoid phytoalexins (MSPs). ZmTPS6 (ZX1) Similar expression patterns ( Figure 1 C).
[0034] 2) Using the ATTED co-expression database, ZmWRKY34 was selected as a target gene. Further KEGG and GO enrichment analyses of the top 300 genes most closely associated with ZmWRKY34 co-expression revealed that these co-associated genes were enriched in the biosynthesis of secondary metabolites, plant hormone signal transduction, terpene biosynthesis, and the MAPK signaling pathway, suggesting that ZmWRKY34 may also possess these functions. GO analysis showed that these co-associated genes were more involved in defense responses, chitinase activity, and regulation of the jasmonic acid signaling pathway, indicating that ZmWRKY34 may also be involved in these pathways. Figure 1 D). Next, based on the above KEGG and GO analyses, we focused on analyzing the top 300 genes most closely co-expressed by ZmWRKY34 and those related to terpene biosynthesis. We found that ZmWRKY34 is strongly associated with the synthesis genes ZmTPS6 (ZX1), ZmTPS11 (ZX3), ZmTPS13 (ZX4), and ZmCYP71Z19 (ZX5) in the zealexin (methyl sesquiterpene) biosynthesis pathway of maize. These results indicate that ZmWRKY34 is highly likely to participate in the regulation of MSP biosynthesis.
[0035] Table 1 Primer Sequences
[0036] Example 2: This embodiment clones the ZmWRKY34 gene and constructs the pMD19-T-ZmWRKY34 vector, as follows: Figure 2 As shown, the specific process is as follows: Download the complete CDS sequence of maize transcription factor ZmWRKY34 from the website phytozome V14 (https: / / phytozome-next.jgi.doe.gov / ).
[0037] Gene cloning was performed using commercially available maize inbred line Mo17 seedlings. Maize seeds were germinated for 6 hours with 1% hydrogen peroxide solution before sowing in moist nutrient soil. The culture temperature was 28℃, with a light cycle of 16 hours light / 8 hours dark. After the third leaf was fully expanded, leaf samples were cut, mixed, and flash-frozen in liquid nitrogen. The samples were then ground and pulverized, and RNA was extracted using TRzol reagent (Biomed), followed by reverse transcription into cDNA (Vazyme). Using this as a template, specific primers (F: 5'-ATGGCGACTTCGCTGGGACT-3'; R: 5'-TCAGAAGGCTAGGGAGCCCGA-3') were used for cloning and construction into the pMD19-T vector (Takara). The ZmWRKY34 gene fragment, measuring 618 bp, was obtained. Its CDS sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2. It consists of 205 amino acid residues (the final TGA in SEQ ID NO.1 is a stop codon and does not encode an amino acid). It is a subfamily IIc transcription factor within the WRKY family of transcription factors. Its DNA-binding domain (WRKY domain) is located in the region from amino acid C-terminus 107 to 166.
[0038] SEQ ID NO.1: ATGGCGACTTCGCTGGGACTGAACCCTGAAGATCTCTTCACTTCGTACTCGTCTTCCTACTACTCCTCGCCGCCGTTCATGTCCGACTACGCGGCGAGCTTCACGCCGGCGGCCGGGGACTCCACGGCCTTCTCCTCGGAGCTCGACGACCTTCACCACTTCGACTACTCACCGGCGCCGATCGTCACTGCTGCCGGAGCCGGGGCTGGGGGCGGCGATCGCAACGAGAAGATGATGTGGTGTGAGGGTGGTGGTGACGAGAGAAGACTCAGAAGCAACGGAAGGATCGGGTTCAGAACGAGGTCAGAGGTGGAGATCTTGGACGACGGATTCAAGTGGAGGAAGTACGGGAAGAAGGCCGTCAAGAACAGCCCAAATCCAAGGAACTACTACCGCTGCTCGTCGGAGGGCTGCGGCGTGAAGAAGCGGGTGGAGAGGGACCGCGACGACCCCCGCTACGTCATCACCACCTACGACGGCGTCCACAACCACGCCAGCCCCGGAGCCGCTGCTATCATCGTCCCGTACGGCAGCGGCGGCGGCAATAGCGGCTTCTACAGCCCGCCGCACAGCGGCTCCCCGTCGGCCACCTCCTACTCGGGCTCCCTAGCCTTCTGA; SEQ ID NO.2: .
[0039] Example 3:
[0040] This embodiment focuses on the construction and identification of ZmWRKY34-CRISPR-Cas9 mutant maize lines. The construction of knockout materials was outsourced to a commercial company. The specific process is as follows: 1) In order to obtain CRISPR / Cas9-mediated ZmWRKY34 knockout mutant maize, three guide-RNA targeting sites were designed in the exon region of ZmWRKY34: Target1: GACGGCGGCGAGGAGTAGTAGG; Target2: GCAGCAGCAGTGACGATCGGCGCCGG; Target3: GAAGACTCAGAAGCAACGGAAGG.
[0041] 2) The sgRNA fragment was amplified using the primers in Table 2. Subsequently, the fragment was ligated with the pSG-MU6 intermediate vector using T4 ligase (vector map shown). Figure 3 A) The enzyme digestion and ligation system consisted of: 2 μl gRNA fragment, 1.5 μl vector, 0.5 μl BsaⅠ, 0.5 μl T4 ligase, 1 μl T4 buffer, and 4.5 μl H2O. 5 μl of the ligation product was transformed into competent *E. coli* cells DH5α. After overnight culture, single colonies were picked for colony PCR and plasmid extraction for gene sequencing. Multiple intermediate vector fragments containing target sites were ligated into the final vector pOSCas9 (vector map shown in [link to vector diagram]) using a homozygous enzyme ligation method. Figure 3 B), the ligation system consisted of: pOSCas9 50 ng, pSgA-T1 8 ng, pSgA-T2 8 ng, pSgA-T3 8 ng, T4 ligase 0.5 μl, T4 buffer 1 μl, and H2O up to 10 μl. Subsequently, DH5α competent cells were transformed, and single colonies were selected for colony PCR and plasmid extraction for gene sequencing.
[0042] Table 2 Primer Sequences
[0043] 3) Transform the correctly sequenced plasmid into Agrobacterium EHA105, pick single clones, culture them in liquid YEP medium, and collect the bacterial suspension. Using freshly peeled corn embryos (approximately 1 mm in diameter), place the peeled corn embryos into 2 ml plastic centrifuge tubes containing 1.8 mL of suspension. Process approximately 150 immature embryos within 30 min; aspirate the suspension, leaving the corn embryos in the tube, then add 1.0 ml of Agrobacterium suspension and let stand for 5 min. Resuspend the embryos in the centrifuge tubes and pour them onto co-culture medium, aspirating excess Agrobacterium suspension from the surface with a pipette. Co-culture at 23°C in the dark for 3 days. After co-culture, transfer the embryos to resting medium and culture at 28°C in the dark for 6 days. Then, transfer them to selection medium containing diammonium phosphate for two weeks of selection culture, followed by two weeks of selection culture on a new selection medium. Resistant callus tissue was transferred to differentiation medium and cultured at 25°C, 5000 lx, under light for 3 weeks. The differentiated seedlings were then transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting occurred. The seedlings were then transferred to plug trays for further growth, and subsequently transplanted to the field. The harvested seedlings were designated as Generation T1. zmwrky34 Mutant corn.
[0044] 4) PCR identification of genomic DNA from leaves of the T3 generation materials was performed, and homozygous lines were selected for further research, resulting in two homozygous lines: zmwrky34-6 and zmwrky34-14Specifically, genomic DNA was extracted from the leaves of the knockout mutant using the CTAB method. Fragments containing target sites 1-3 were amplified by PCR using primer sequences: F: 5'-CTACCTGGTGCTTGTTGTGC-3', R: 5'-TTCATCTCTTTGCTCTTGTC-3'. Single-band gel samples from both the wild-type WT and knockout lines were sent to either Qingke or Sangon Biotech for sequencing. The peak shape of the editing site was determined by comparing the sequencing results. A single PCR band and a single-peak sequencing result indicated a homozygous positive knockout line. zmwrky34-6 The effective target site of the strain was edited to target 2 (Target2). The insertion of one base caused premature termination of translation, while zmwrky34-14 The strain exhibited a 350 bp deletion at target sites 1-3, leading to premature translation termination. Figure 4 A). PCR identification and sequencing results showed that both strains were homozygous. Figure 4 BC).
[0045] 5) Based on the above analysis and identification, the T3 generation is homozygous and can be stably inherited. Therefore, a series of resistance factor analyses can be carried out using the T3 generation material. However, due to the limited number of T3 materials, the subsequent examples all used the T4 generation for resistance research.
[0046] Example 4:
[0047] This embodiment examines the effect of ZmWRKY34 knockout on FSR and FER resistance. The specific process is as follows: 1) Carefully selected, uniform, plump, and healthy wild-type and T4 generation teas. zmwrky34 Mutant corn seeds were disinfected by soaking in 75% ethanol solution and 6% sodium hypochlorite solution for 10 minutes, respectively, and then rinsed repeatedly with sterile water 4-5 times until there was no obvious sodium hypochlorite odor.
[0048] 2) For live inoculation with *Fusarium graminearum* and *Fusarium moniliforme*: Sow seeds evenly in germination boxes lined with germination paper. Add 7 ml of distilled water to each germination box. Place the seeds in a light incubator at a constant temperature of 28℃ and relative humidity of 95%, and incubate in the dark until germination. After germination, transfer the seeds to a nutrient substrate. Adjust the light incubator parameters to 85% relative humidity, alternating between 14 h light (28℃) and 10 h dark (22℃). Place 5 mm diameter sterile filter paper discs on PDA medium and inoculate with *Fusarium graminearum*, *Fusarium moniliforme*, and *Rhizoctonia solani* mycelial blocks for activation. Invert the discs and incubate at 28℃ for 3-7 days until the mycelium covers the medium. After the third leaf has fully unfolded, inoculate seedlings using filter paper discs infused with *Fusarium graminearum* and *Fusarium moniliforme* mycelium. Make a slit 1.5 cm from the stem base for inoculation and keep the inoculation moist. Observe the disease phenotype after 3 days and photograph the results. Figure 5 A and B.
[0049] 3) For field inoculation with *Fusarium graminearum*: Cultivate seedlings under the above conditions until they reach the three-leaf stage and one bud stage, then transplant them to the field in Gaoshan Village, Wenjiang District. Use a wide-narrow row planting configuration: narrow row spacing 60cm, wide row spacing 80cm, and plant spacing 50cm. Place *Fusarium graminearum* mycelial blocks in CMC liquid medium and incubate at 25℃ and 200rpm for 7 days. Centrifuge to collect the mycelium and resuspend it until the spore concentration reaches 1×10⁻⁶. 6 Cells / mL. Inject 300 μL of bacterial suspension into the naturally growing panicle-inducing stage. zmwrky34 The middle section of the third stem of both mutant and wild-type materials was wrapped with sealing film to keep it moist. The phenotype was observed and photographed 8 days after the onset of the disease. The results are as follows: Figure 5 C.
[0050] 4) For inoculating grains with *Fusarium verticillatum*: Place *Fusarium verticillatum* mycelial blocks in CMC liquid medium, incubate at 25℃ and 200 rpm for 7 days, centrifuge to collect the mycelial cells and resuspend them to a spore concentration of 1×10⁻⁶. 6 / mL. Using a sterile blade, longitudinally cut the hypocotyl of each seed approximately 0.5 cm. Place four seeds of similar size into the same glass scintillation bottle, inoculate with 500 μL of *Fusarium verticillatum* conidia suspension, and vortex to mix. Place sterile, water-moistened germination paper at the bottom of an 84-sterilized transparent germination box, place the inoculated scintillation bottle inside, maintain a relative humidity above 95%, and incubate in the dark at 28°C. Observe the disease phenotype daily and photograph the results. The results are as follows: Figure 5 D.
[0051] Experimental results are as follows Figure 5 As shown, this indicates that compared to the wild type, zmwrky34 Three days after inoculating mutant seedlings with *Fusarium graminearum* and *Fusarium moniliforme*, and eight days after inoculating stems with *Fusarium graminearum* during the booting stage, both knockout lines showed significantly reduced resistance to *Fusarium graminearum* and *Fusarium moniliforme*, exhibiting more severe disease and larger lesion areas. From the 5th day after disease onset, compared with the wild type, zmwrky34 When mutant grains were inoculated with Fusarium verticillatum for 5-7 days, the two knockout lines showed significantly reduced resistance to Fusarium verticillatum, exhibiting more mycelia and a significantly increased number of conidia on day 7 compared to the wild type.
[0052] The above results indicate that knockout of the ZmWRKY34 gene leads to a significant reduction in maize's resistance to multiple Fusarium fungi, meaning that ZmWRKY34 positively regulates maize's resistance to multiple Fusarium fungi.
[0053] Example 5:
[0054] This embodiment investigates the effect of ZmWRKY34 knockout on maize sheath blight resistance. The specific process is as follows: 1) Carefully selected, uniform, plump, and healthy wild-type and T4 generation teas. zmwrky34 Mutant corn seeds were disinfected by soaking in 75% ethanol solution and 6% sodium hypochlorite solution for 10 minutes, respectively, and then rinsed repeatedly with sterile water 4-5 times until there was no obvious sodium hypochlorite odor.
[0055] 2) For live inoculation of Rhizoctonia solani: Sow seeds evenly in germination boxes lined with germination paper, adding 7 ml of distilled water to each box. Place the seeds in a light incubator at a constant temperature of 28℃ and relative humidity of 95%, and incubate in the dark until germination. After germination, transfer the seeds to a nutrient substrate. Adjust the light incubator parameters to 85% relative humidity, alternating between 14 hours of light (28℃) and 10 hours of darkness (22℃). Place 5 mm diameter sterile filter paper discs on PDA medium and inoculate with Rhizoctonia solani mycelium blocks for activation. Invert the discs and incubate at 28℃ for 3-5 days until the mycelium covers the medium. Once the third leaf has fully unfolded, gently sift the filter paper discs containing Rhizoctonia solani mycelium, along with the covering mycelium blocks, into the second leaf sheath, spraying with sterile water to keep the mycelium blocks moist. Continue incubating the inoculated material under the same conditions. Observe the disease phenotype after 3 days and take photographs.
[0056] Experimental results are as follows Figure 6 As shown, this indicates that compared to the wild type, zmwrky34 When mutant seedlings were inoculated with *R. solani*, their resistance to *R. solani* was significantly reduced, resulting in more severe disease, significantly increased lesion length, and larger lesion area. That is, ZmWRKY34 positively regulates maize resistance to *R. solani*.
[0057] Example 6:
[0058] This embodiment aims to reveal the direct activation of ZmWRKY34. Zx1, Zx5 Transcriptional regulation positively regulates zealexin biosynthesis, and the specific process is as follows: (1) Experiment on dual-luciferase reporter gene system: Vector construction: design Zx1, Zx5 The promoter or promoter containing partial exons was cloned using primers and sequenced for verification. The target fragment was constructed into the pGreenⅡ0800-LUC vector as a reporter gene, and Renilla luciferase as an internal control gene. The construction process was as follows: commercially available maize inbred line B73 seedlings were used for gene cloning. Before sowing, maize seeds were germinated with 1% hydrogen peroxide solution for 6 hours, sown in moist nutrient soil, and cultured at 28℃ with a light condition of 16 hours of light / 8 hours of darkness. After the third leaf was fully expanded, leaf samples were cut, mixed, and flash-frozen in liquid nitrogen. The samples were then ground and genomic DNA was extracted from the leaves. Using this as a template, specific primers (Table 3) were used for cloning and construction into the pMD19-T vector (Takara). pThe Zx1 fragment is 1500 bp in size. p The Zx5 fragment is 1936 bp in size. KpnⅠ and NotⅠ were selected as restriction enzyme sites, and pGreenⅡ0800- was constructed using a homologous recombination kit (Vazyme C115). p Zx1 / p The Zx5-LUC plasmid must be constructed and successfully sequenced before use. The pCAMBIA2300-ZmWRKY34-eGFP vector is used as the effector gene; vector image is shown below. Figure 7 The specific process is as follows: The ZmWRKY34 fragment, with the stop codon removed, was subcloned from the successfully sequenced pMD19-T-ZmWRKY34 plasmid. KpnⅠ and XbaⅠ were selected as restriction enzyme sites. The pCAMBIA 2300-ZmWRKY34-eGFP plasmid was constructed using a homologous recombination kit (Vazyme C115). Successful sequencing alignment after construction was required for use. The successfully constructed plasmid was extracted in large quantities and co-transformed into maize protoplasts. The protoplasts were collected, and luciferase activity was measured using a dual-luciferase reporter gene detection system (Promega). Firefly fluorescence in the samples was detected using a microplate reader. LUC ) and Renal fluorescein fluorescence ( REN The chemiluminescence value of ZmWRKY34 was used to determine its effect on the transcriptional activity of downstream target gene promoters by calculating the relative luciferase activity. Further analysis of cis-elements in the target gene promoters was conducted, and dual-luciferase reporter gene systems were constructed by deleting and site-directed mutagenesis of the promoters. These systems were compared with full-length or unmutated gradient deletion sequences of the promoters to determine the promoter-active region or binding site of ZmWRKY34. Experimental results are shown below. Figure 6 Figures A and B indicate a significant increase in the LUC / REN value, meaning that ZmWRKY34 is significantly activated. Zx1, Zx5 Promoter.
[0059] Table 3 Primer Sequences
[0060] (2) Yeast one-hybrid experiment: ZmWRKY34 was ligated into the pGADT7 vector, Zx1, Zx5 The promoter was ligated into the pAbAi vector to construct the pBait-AbAi vector. The specific construction method was as follows: Subcloning fragments was performed using the primers listed in Table 4, and ligation was carried out using the Novavit Progenitor Recombinant Kit (C115). The vector could only be used after successful sequencing alignment. 2 μg of pBait-AbAi- was added using the BstbI restriction endonuclease. pZx1 / Zx5 Linearization of recombinant plasmids: 1 μg of linearized pBait-AbAi- pZx1 / Zx5The plasmid was transformed into yeast strain Y1H-Gold, plated on SD / -Ura plates, and incubated at 28°C for 3-5 days. DNA was extracted from several yeast monoclonal colonies, and positive results were identified by PCR. Positive monoclonal colonies were selected to screen for a gold basididin concentrations to inhibit its background activity. After obtaining a suitable gold basididin concentration, the above-mentioned yeast pBait-AbAi-- pZx1 / Zx5 Yeast competent cells were reconstituted using the strain, and the pGADT7-ZmWRKY34 plasmid was transformed into these competent cells. The cells were then plated on SD / -Ura / -Leu plates and incubated at 28°C for 3-5 days. Subsequently, single-clone stock solutions were diluted to 10×, 100×, and 1000×, and 3 μL of each dilution was spotted onto solid media SD / -Leu / -Ura and SD / -Leu / -Ura+AbA to observe whether the co-transformed yeast strains grew on the double-deficient medium. If ZmWRKY34 could bind to the cis-acting element of the target gene promoter, the corresponding colonies could grow on the selective medium containing AbA; otherwise, they could not grow. This determined whether the transcription factor had a binding effect on the target gene promoter. The experimental results are as follows: Figure 8 As shown in Figure C, the results indicate that ZmWRKY34 binds to... Zx1 , Zx5 Promoter.
[0061] Table 4 Primer Sequences
[0062] (3) Gel retardation experiment: The coding region of ZmWRKY34 was cloned and constructed into the vector pCold-GST with a 6×His tag. The specific construction method was as follows: the coding region of the ZmWRKY34 gene was amplified using the primer pGST-ZmWRKY34 in Table 5 to obtain the ZmWRKY34 fragment. The PCR product was ligated to the linearized pCold-GST vector using the Novavito plasmid recombinant recombinant kit (C115). The constructed plasmid was used only after successful sequencing alignment. The successfully constructed plasmid was transformed into E. coli BL21 (DE3) for induced expression at 16°C, 200 rpm, for 16-24 h. The bacterial cells were collected by centrifugation at 4°C, 4300 rpm for 5 min, and the cells were resuspended in cell lysis buffer. The cells were sonicated and centrifuged at 4°C, 12000 rpm for 10 min. The supernatant and precipitate were collected and subjected to SDS-PAGE electrophoresis to detect the induced expression of the recombinant protein. The ZmWRKY34 recombinant protein was purified using the Ni protein purification kit. The promoter cis-element sequence was synthesized and biotin-labeled at the 5' end, followed by annealing to form a double-stranded nucleotide probe. The purified ZmWRKY34 protein and probe were mixed and reacted at 28°C for 20 min. Electrophoresis was performed on a non-denaturing polyacrylamide gel, and the mixture was transferred to a positively charged nylon membrane. The probe labeling was detected using a chemiluminescent EMSA kit (Beyotime) to identify the in vitro binding of ZmWRKY34 to the target gene promoter cis-element sequence. The labeled probes were Zx1-W1-Biotin, Zx5-Biotin, and Zx1-W2-Biotin, while the competing probes were Zx5-W1-Comp-5' / Zx5-W1-Comp-3', Zx5-W2-Comp-5' / Zx5-W2-Comp-3', and Zx5-Comp-5' / Zx5-Comp-3'. Results are as follows: Figure 8 As shown in E, it was found pZx1 -W1、 pZx5 -W1 exhibited a hysteresis band after incubation, and this band disappeared upon the addition of a competing probe, indicating that ZmWRKY34 is effective against hysteresis. Zx1 Starter - 904-bit B-box (TTGACT) Zx5 The W-box (TGACT) at promoter site-880 binds directly.
[0063] Table 5 Primer Sequences
[0064] The above results indicate that ZmWRKY34 can specifically bind to Zx1, Zx5 The W-box on the promoter directly activates transcription, thereby activating gene expression.
[0065] Example 7:
[0066] This example aims to demonstrate how to use the transcription factor ZmWRKY34 to improve maize resistance in actual production. The procedure is as follows: 1) Mining of superior haplotypes: First, resequencing analysis was performed on maize inbred lines (natural population) with wide sources and rich variations. Then, post-inoculation phenotypic analysis was performed on this population. Combined with the variation of cisfunctional elements on the ZmWRKY34 promoter, sites that can significantly affect disease resistance were screened to mine haplotypes HAP1 (highly resistant) and HAP2 (susceptible).
[0067] 2) Creation of near-isotropic inbred lines: Using the HAP2 (susceptible) donor parent as the maternal parent, cross with the backbone inbred lines Zheng 58 and Chang 7-2 of the HAP1 (highly resistant) recipient parent to obtain F1 hybrids (HAP1 × HPA2). Using the F1 hybrids as the maternal parent, backcross with Zheng 58 and Chang 7-2 to generate the BC1F1 population. Select plants with the genetic background closest to the recurrent parents Zheng 58 / Chang 7-2 and carrying the HAP2 haplotype homozygous or heterozygous variant locus for backcrossing. Use the selected BC1F1 plants as the maternal parent and backcross with Zheng 58 and Chang 7-2 to generate the BC2F1 segregating population. Select plants with the genetic background closest to the recurrent parents and carrying the HAP2 haplotype homozygous or heterozygous variant locus. The superior individual plants selected in the previous step are backcrossed with the recurrent parents for two more generations to generate the BC4F1 population. In the BC4F1 generation, single plants carrying the HAP2 haplotype homozygous or heterozygous variant site with high background recovery were selected for self-crossing to obtain the BC4F2 population. Single plants homozygous for the target susceptible haplotype and with a genetic background close to the recurrent parents (Zheng 58 / Chang 7-2) were selected by molecular marker screening. These were the successfully created stable NIL materials with Zheng 58 and Chang 7-2 as the genetic background.
[0068] 3) Application and Improvement: The obtained homozygous NIL lines were self-pollinated to form a stable population, and the disease resistance of this population was analyzed. The successfully created NIL population material with Zheng 58 as the genetic background was crossed with the NIL population material with Chang 7-2 as the genetic background to obtain F1 hybrids, and then the disease resistance was analyzed.
[0069] In summary, this study discovered a strategy by which the WRKY family transcription factor ZmWRKY34 enhances the broad-spectrum resistance of maize to multiple biological stresses, providing a new genetic resource for green breeding.
[0070] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.
Claims
1. A maize transcription factor ZmWRKY34, characterized in that, It is: (a) A protein having the amino acid sequence shown in SEQ ID NO:2; or (b) A variant that has at least 90% sequence identity with the sequence shown in SEQ ID NO:2, and has a WRKY domain and retains the function of regulating phytoalexin synthesis; or (c) A protein encoded by the nucleotide sequence shown in SEQ ID NO:
1.
2. An isolated nucleic acid molecule encoding the ZmWRKY34 protein of claim 1.
3. A recombinant expression vector comprising the nucleic acid molecule of claim 2, and a promoter operatively linked to the nucleic acid molecule.
4. A recombinant host cell comprising the recombinant expression vector of claim 3.
5. A method for improving maize's resistance to fungal diseases, characterized in that, The expression level or biological activity of the ZmWRKY34 protein as described in claim 1 can be increased in maize through transgenic, gene editing, or genetic breeding methods.
6. A method for identifying or screening maize materials resistant to fungal diseases, characterized in that, include: The expression level of the ZmWRKY34 gene or the activity of the ZmWRKY34 protein in maize samples were detected and compared with control samples. Among them, maize materials with significantly higher expression levels or activities than the control were identified as having enhanced disease resistance.
7. A method for breeding disease-resistant maize, characterized in that, include: Donor maize containing the ZmWRKY34 gene or its highly active allele is crossed with recipient maize, and offspring carrying the gene or its allele are selected by molecular marker-assisted selection to improve their resistance to Fusarium and / or Rhizoctonia fungal diseases.
8. A method for regulating the biosynthesis of terpenoid phytoalexins in maize, characterized in that, include: By regulating the expression or activity of the ZmWRKY34 protein, the expression of genes related to phytoalexin synthesis can be regulated.
9. The use of the ZmWRKY34 protein of claim 1 or the nucleic acid molecule of claim 2 in the preparation of biological agents or breeding kits for improving maize resistance to fungal diseases.