Application of PbATX2 gene in increasing pollen scattering amount of plant pollen
By overexpressing the PbATX2 gene in tobacco or fruit tree plants, the problem of poor pollen shedding effect in existing technologies has been solved, resulting in a significant increase in pollen shedding and improved pollination success rate, which is suitable for genetic engineering breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-21
- Publication Date
- 2026-04-14
AI Technical Summary
Existing methods for increasing pollen shedding have limited effectiveness and may have adverse effects on plants, and are difficult to control precisely. There is also limited research on genetic engineering techniques in this area.
By overexpressing the PbATX2 gene, a plant overexpression vector was constructed using the CDS sequence and encoded protein sequence of the PbATX2 gene. This vector was then introduced into tobacco or fruit tree plant cells via Agrobacterium-mediated transformation to achieve overexpression of the PbATX2 gene.
It significantly increases the amount of pollen shed by the plant by about 50%, improves the pollination success rate, and does not affect the normal germination activity of the pollen. It is suitable for breeding self-fertile varieties and saves labor.
Smart Images
Figure CN121852403A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and particularly relates to a... PbATX2 Application of genes in increasing pollen shedding in plants. Background Technology
[0002] In plant breeding and agricultural production, pollen shedding is a crucial factor affecting pollination efficiency and seed yield. Currently, methods to increase pollen shedding mainly include chemical treatment and environmental control, but these methods often have limited effectiveness and may have adverse effects on plants. For example, the use of chemical agents may cause environmental pollution and affect plant growth and development; environmental control is limited by climatic conditions and difficult to precisely control.
[0003] In current technology, there are few studies on increasing pollen shedding through genetic engineering. Although some studies have reported that certain genes are related to pollen development, there are no definitive reports. PbATX2 The application of genes in increasing pollen shedding.
[0004] Therefore, developing a method to effectively increase pollen shedding through genetic engineering is of great significance for improving crop yields. Summary of the Invention
[0005] The main objective of this invention is to provide a PbATX2 The application of genes in increasing the amount of pollen shed by plants to overcome the shortcomings of existing technologies.
[0006] To achieve the aforementioned objectives, the technical solution adopted by this invention includes: According to a first aspect of the present invention, a method is provided. PbATX2 The application of genes in increasing pollen shedding in plants, the aforementioned PbATX2 The CDS sequence of the gene is shown in SEQ ID NO.1.
[0007] Furthermore, the aforementioned PbATX2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.
[0008] Furthermore, through overexpression PbATX2 Genes are used to increase the amount of pollen shed by plants.
[0009] Furthermore, the plant is a tobacco or fruit tree plant.
[0010] According to a second aspect of the present invention, a plant overexpression vector is provided, the vector comprising a nucleotide sequence as shown in SEQ ID NO.1. PbATX2 Gene.
[0011] According to a third aspect of the present invention, a transgenic plant cell is provided, the plant cell comprising the above-described plant overexpression vector, or the plant cell integrating a nucleotide sequence as shown in SEQ ID NO. 1. PbATX2 Gene.
[0012] According to a fourth aspect of the present invention, a transgenic plant is provided, the plant comprising the transgenic plant cells described above.
[0013] According to a fifth aspect of the present invention, a method for increasing pollen shedding from plants is provided, comprising introducing the above-described plant overexpression vector into plant cells or tissues to obtain transgenic plant material, wherein... PbATX2 The gene was overexpressed in the plant material.
[0014] Furthermore, the introduction of the plant overexpression vector into plant cells or tissues is achieved through Agrobacterium-mediated transformation.
[0015] Furthermore, the genetically modified plant material is a tobacco or fruit tree plant.
[0016] Compared with the prior art, the advantages of the present invention include: This invention provides PbATX2 The application of genes in increasing pollen shedding in plants is presented in the form of transgenic plants. PbATX2 Overexpression in tobacco plants requiring enhancement can increase pollen shedding by approximately 50%, improving pollination success rate without affecting normal pollen germination. This improves pollination success rate, solves pollen abortion, ensures offspring reproduction, and allows for the development of self-fertile varieties, saving labor costs. Attached Figure Description
[0017] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings: Figure 1 This is a typical embodiment of PCR amplification in the present invention. PbATX2 Gene map; Figure 2 This is a typical embodiment of the invention for constructing a plant overexpression vector. PbATX2-pRI101 Escherichia coli bacterial culture identification diagram; Figure 3 This is a typical embodiment of the present invention. PbATX2 Overexpression transgenic seedlings; Figure 4This is the pollen phenotype of a transgenic seedling in a typical embodiment of the present invention; Figure 5 This is a statistical analysis of pollen shedding amount of WT and transgenic seedlings in a typical embodiment of the present invention; Figure 6 This is a statistical analysis of the pollen germination rate of WT and transgenic seedlings in a typical embodiment of the present invention. Detailed Implementation
[0018] In view of the shortcomings of the prior art, the inventors of this invention, through long-term research and extensive practice, have proposed the technical solution of this invention. The following will further explain and illustrate this technical solution, its implementation process, and its principles.
[0019] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0020] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials used in the following embodiments are commercially available.
[0021] This invention provides a PbATX2 The application of genes in increasing pollen shedding in plants, the aforementioned PbATX2 The CDS sequence of the gene is shown in SEQ ID NO.1. PbATX2 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO. 2. The application is achieved by overexpressing the protein in plants. PbATX2 This is achieved through genes. The plants mentioned include, but are not limited to, tobacco or fruit trees, preferably pears.
[0022] This invention identifies and confirms that it originates from pears. PbATX2 The gene has a direct and significant biological function of increasing pollen shedding in plants. Molecular biology experiments have demonstrated that overexpression of this gene in the model plant tobacco can increase pollen shedding in transgenic plants by approximately 50% (e.g., ...). Figure 5 As shown), and does not affect the normal germination viability of pollen (e.g. Figure 6 (As shown). This indicates PbATX2 The gene product likely participates in and positively regulates key physiological processes such as late pollen development, anther dehiscence, or pollen release. Its effect is not by altering the basic fertility of pollen, but by increasing the number of viable pollen that can be successfully released, thereby achieving phenotypic improvement.
[0023] To better understand the technical solution of the present invention, the following detailed discussion is provided in conjunction with specific embodiments.
[0024] Example 1 PbATX2 Monoclonal amplification of genes (1) PCR amplification PbATX2 Gene Using upstream primer F and downstream primer R as primer pairs, the following 40 μL system was used: PbATX2 Genes are amplified in single clones to obtain PbATX2 Nucleotide double strands; in which, PbATX2 PbATX2 The nucleotide sequence (SEQ ID NO.3) of upstream primer F is: ATGGCATTTCCCCTCAAGCA; The nucleotide sequence (SEQ ID NO.4) of the downstream primer R is: TTCACCACTCCAATCTATTAACTCGC.
[0025] Table 1 The results are as follows Figure 1 As shown, Figure 1 PCR amplification PbATX2 The genome map shows that the first lane is for DNA markers, and the following four lanes are for amplification. PbATX2 A segment of a gene's DNA.
[0026] (2) Connecting the PMD-19-T (Simple) vector The PCR amplification obtained above PbATX2 Nucleotide double strands are linked using the 10 μL system shown in Table 2 below. PMD- 19-T (Simple) carrier, purchased from TaKaRa The company, by incubating the product overnight at 16°C, obtained the ligation product.
[0027] Table 2 (3) The ligation product is transformed into competent cells. Remove E. coli DH5α competent cells from the -80℃ ultra-low temperature freezer and thaw them on ice. Transfer 20 μL of DH5α competent cells to a 1.5 mL sterile centrifuge tube, add 10 μL of the constructed ligation product, and gently pipette to mix. Incubate on ice for 30 min, then heat shock in a 42℃ water bath for 90 s (preheat the water bath to 42℃), followed by another 2 min on ice. In a clean bench, add the cells to 200 μL of LB liquid medium (without any antibiotics) and place in a shaker at 37℃ and 180 rpm for 1 h. After shaking, take 100 μL of the bacterial culture and spread it onto an LB agar plate (with antibiotics). Continue spreading until the plate dries, then seal and label the plate. Incubate at 37℃ for approximately 10 h until plaques appear.
[0028] (4) Spot picking In a sterile laminar flow hood, use a sterile pipette tip to draw 200 μL of LB liquid culture medium and transfer it to a 1.5 mL sterile centrifuge tube. Use a 10 μL sterile pipette tip to pick up 10 of the above-mentioned plaques (with relatively regular shapes and sizes), place them in LB liquid culture medium (containing antibiotics), agitate a few times, cap the tube, mark it, and place it in a 37°C shaker at 180 rpm for 4-6 hours.
[0029] (5) Identification of bacterial culture After the inoculum culture was shaken, the bacterial suspension was identified using the system shown in Table 3. Using the bacterial suspension as a template, the upstream primer was the vector upstream primer, with the sequence (SEQ ID NO. 5) CGCCAGGGTTTTCCCAGTCACGAC. The downstream primer was the gene downstream primer. Identification was performed according to the normal validation procedure, with water as a negative control. The positive rate of the bacterial suspension was tested, and the brightest bacterial suspensions among the positive results were selected.
[0030] Table 3 Example 2: Construction of plant overexpression vectors PbATX2-pRI101 (1) Extraction of plasmids Plasmids were extracted from the positive bacterial culture (plasmid extraction method was performed according to the kit (purchased from Cisco Systems)) to obtain samples containing... PbATX2 of PMD-19-T (Simple) fusion plasmid.
[0031] (2) Double enzyme digestion Will be connected PbATX2 of PMD-19-T (Simple) fusion plasmid and pRI101 The empty vector was double-digested according to the 40 μL system shown in Table 4, and reacted at 37°C for 1 h.
[0032] Table 4 (3) Recovery and ligation of the target gene and the target vector After cutting out the target gene band, the gel was recovered (according to the kit). At the same time, the enzyme digestion band of the target vector was also cut out and recovered (according to the kit). Then, the system shown in Table 5 was ligated.
[0033] Table 5 (4) The ligation product is transformed into competent cells. The above ligation products were transformed into Escherichia coli DH5α competent cells according to the system shown in Table 6.
[0034] Table 6 Then, remove the E. coli DH5α competent cells from the -80℃ freezer and immediately place them on pre-prepared ice to thaw. Transfer 20µL of E. coli DH5α competent cells into a 1.5mL sterile centrifuge tube, add 10µL of the constructed ligation product, and gently pipette to mix. Incubate on ice for 30min, heat shock at 42℃ for 90s, and then incubate on ice for 2min. Add 200µL of LB liquid medium in a sterile environment, place in a shaker at 37℃ and 180rpm, and shake for 1h. Spread 100µL of the bacterial culture (with the corresponding antibiotic) onto an LB plate until the plate dries, seal the plate, label it, and incubate at 37℃ for about 10h.
[0035] (5) Spot picking In a sterile laminar flow hood, use a sterile pipette tip to draw 200 µL of LB liquid culture medium (with appropriate resistance) and transfer it into a 1.5 mL sterile centrifuge tube. Use a 10 µL sterile pipette tip to pick up 10 plaques, place them in the LB liquid culture medium, agitate a few times, cap the tube, mark it, and place it in a shaker at 37 °C and 180 rpm for 4-6 hours.
[0036] (6) Identification of bacterial culture After the culture was shaken, PCR identification was performed using the 10µL system shown in Table 3 above. The bacterial culture was used as a template, and the primers were the upstream primer for the vector and the downstream primer for the gene. Identification was performed according to the normal validation procedure, with water as a negative control. The positive rate of the bacterial culture was tested, and the brightest positive cultures were selected. The results are shown below. Figure 2 As shown, Figure 2 It is to construct plant overexpression vectors PbATX2-pRI101 Image of E. coli bacterial culture identification; where: the first lane is the DNA marker, and the following 8 lanes are... PbATX2 Overexpression vector PbATX2-pRI101 PCR products of Escherichia coli bacterial culture.
[0037] (7) Extract plasmids from the positive bacterial cultures (plasmid extraction method according to the kit steps) to obtain plant overexpression vectors. PbATX2-pRI101 .
[0038] Example 3: Plant overexpression vectors using Agrobacterium-mediated transformation PbATX2-pRI101 Heterogeneous transfer of tobacco plants (1) Plant overexpression vector PbATX2-pRI101 Transformed into Agrobacterium EHA105 Agrobacterium EHA105 competent cells were removed from an ultra-low temperature freezer at -80℃. 50 μL of Agrobacterium EHA105 competent cells were transferred to a 1.5 mL sterile centrifuge tube, and the constructed overexpression vector was added. PbATX2 -PRI 1015 μL, mix thoroughly by pipetting; ice bath for 30 min, heat shock at 37℃ for 90 s, then ice bath for 2 min; add 200 μL of LB liquid medium in a clean bench, place in a shaker at 28℃ and 180 rpm for 4 h. After shaking, take 100 μL of bacterial solution and spread it on an LB plate. Continue spreading until the plate dries, cover and seal, mark, and incubate in a 28℃ incubator for 36-40 h.
[0039] (2) Agrobacterium-mediated transformation of expression vectors into tobacco plants When the tobacco leaves have grown to 4-6 leaves, take the young leaves, rinse off the surface dust with clean water, and place them in a 1 L beaker. Under aseptic conditions, rinse the tobacco leaves 2-3 times with sterile water (with 2-3 drops of Tween) to remove the surface fuzz. Then, add 75% alcohol and shake for 30 seconds (for preliminary sterilization of the tobacco leaf surface); rinse 3-5 times with sterile water, and gently shake in 0.1% HgCl2 for 5-10 minutes (for further sterilization); after rinsing 3-5 times with sterile water (to remove any residual HgCl2), cut small pieces of about 1 cm² (between the veins) with scissors; place the leaf pieces on sterile filter paper to absorb as much moisture as possible from the leaf surface, and then transfer them to a petri dish containing pre-culture medium (leaf side up); incubate in the dark at 25°C for 2-3 days. The obtained Agrobacterium EHA105 was placed in 50 mL of YEP medium and cultured in a shaker at 180 rpm and 28°C for 4-6 hours until the OD value reached 0.8-1.0. The cells were collected by centrifugation at 25°C and 5000 rpm for 5 min. The bacterial suspension was resuspended in glucose liquid medium, and 20 mg of acetylsyleugenone was added for later use. Then, the pre-cultured leaves were placed in a liquid co-culture medium containing Agrobacterium, and shaken several times every 2 min for approximately 8 min. The leaf pieces were then transferred to sterile filter paper, the bacterial suspension on the leaf surface was blotted dry, and the leaf pieces without bacterial suspension were quickly transferred to the co-culture medium. Once small buds appeared on the leaves, they were transferred to a propagation medium for proliferation. After the buds developed into seedlings, they were placed in a rooting medium to root, resulting in transgenic plants. Figure 3 As shown, Figure 3 yes PbATX2 Overexpression of transgenic seedlings.
[0040] Example 4: Overexpression PbATX2 Functional verification of transgenic plants (1) Twenty transgenic tobacco plants with uniform growth and root development at two months old were selected, along with 20 non-transgenic tobacco plants from the control group.
[0041] (2) Transplant the plants into small pots pre-filled with substrate (autoclaved), ensuring the roots are spread out as much as possible. After transplanting, water thoroughly, cover the pots with a transparent plastic bag, secure the bottom with a rubber band, and place them in a light-curing room (25℃, 3000 lux, 12 hours of light per day). Remove the plastic bag after 1-2 days. Continue watering frequently, maintain light exposure, and monitor for pests and diseases for further observation and verification.
[0042] (3) After the flowering phenotype appears in the plants, observe and statistically analyze the pollen shedding quantity and pollen germination rate of the control group and the transgenic plants. This experiment should be repeated at least three times. Plant comparison photos are shown below. Figure 4 As shown, Figure 4 This represents the pollen phenotype of the transgenic seedlings; WT serves as the control group. PbATX2-OE 1, PbATX2-OE 2, PcPbATX2-OE 3 for PbATX2 Overexpression group.
[0043] Results analysis: After domestication PbATX2 Phenotypic observation was conducted on overexpressing plants after 65 days of growth. PbATX2 The transgenic tobacco plants exhibited a significant increase in pollen shedding, which means... PbATX2 It can significantly increase the amount of pollen shed by plants.
[0044] The pollen shedding quantity and pollen germination rate of the two groups of plants were measured, and overexpression was investigated. PbATX2 The transgenic plants shed significantly more pollen than the control group, such as... Figure 5 As shown, Figure 5 This is a statistical analysis of pollen shedding from WT and transgenic seedlings. Specifically, WT seedlings averaged 12 pollen grains per field of view, while transgenic seedlings averaged 18 pollen grains per field of view, representing an approximately 50% increase in the number of pollen grains per field of view compared to WT seedlings.
[0045] like Figure 6 As shown, Figure 6 This is a statistical analysis of pollen germination rates for WT and transgenic seedlings; the pollen germination rates of both WT and transgenic seedlings were approximately 60%, with little difference between them. The pollen germination rates of the three transgenic lines showed no significant difference compared to the control group.
[0046] In summary, PbATX2 Transgenic plants have a significant ability to increase pollen shedding.
[0047] The above descriptions are merely some embodiments of the present invention. It should be noted that those skilled in the art can make other modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the protection scope of the present invention.
Claims
1. A kind PbATX2 The application of genes in increasing pollen shedding in plants is characterized by, The PbATX2 The CDS sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The PbATX2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
2.
3. The application according to claim 1, characterized in that, Through overexpression PbATX2 Genes are used to increase the amount of pollen shed by plants.
4. The application according to claim 1, characterized in that, The plant in question is a tobacco or fruit tree plant.
5. A plant overexpression vector, characterized in that, The vector contains a nucleotide sequence as shown in SEQ ID NO.
1. PbATX2 Gene.
6. A transgenic plant cell, characterized in that, The plant cells contain the plant overexpression vector of claim 5, or the plant cells have integrated nucleotide sequences as shown in SEQ ID NO.
1. PbATX2 Gene.
7. A transgenic plant, characterized in that, The plant comprises the transgenic plant cells as described in claim 6.
8. A method for increasing the amount of pollen shed by plants, characterized in that, This includes introducing the plant overexpression vector of claim 5 into plant cells or tissues to obtain transgenic plant material, wherein... PbATX2 The gene was overexpressed in the plant material.
9. The method according to claim 8, characterized in that, The process of introducing plant overexpression vectors into plant cells or tissues is achieved through Agrobacterium-mediated transformation.
10. The method according to claim 8, characterized in that, The genetically modified plant material is a tobacco or fruit tree plant.