SNP (Single Nucleotide Polymorphism) detection marker related to major effect of wheat grain hardness
By developing the SNP molecular marker 1B_5307, which is related to the major QTLqHI.1B-2 of wheat grain hardness, and its KASP primer set, the problem of insufficient soft wheat variety types has been solved, enabling rapid identification of wheat grain hardness and early screening of new varieties, thus promoting the improvement and diversity development of soft wheat varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-04-14
AI Technical Summary
In the current technology, the global planting share of soft wheat varieties is insufficient, and the variety types are not rich enough to meet the growing diverse needs of people. In particular, the proportion of soft wheat in China is less than 10%, and the import dependence is high.
We developed the SNP molecular marker 1B_5307, which is associated with the major QTLqHI.1B-2 of wheat grain hardness, and its corresponding KASP primer set. Through PCR amplification and fluorescence detection, we achieved rapid identification of wheat grain hardness. We then used the KASP primer set to identify wheat materials with different hardness in wheat molecular breeding.
It enables rapid and accurate identification of wheat grain hardness, providing a technical basis for early screening and accelerating the breeding of new varieties. It can significantly distinguish the grain hardness of different wheat materials, promoting the improvement and diversification of soft wheat varieties.
Smart Images

Figure CN121852581A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of wheat molecular breeding, and specifically relates to a major-effect QTL qHI.1B-2 associated SNP molecular marker and its application related to wheat grain hardness. Background Technique
[0002] Grain hardness (Grain Hardness Index, GHI) is one of the key indicators affecting wheat processing quality and end-use quality. It refers to the force required to break the structure of wheat grains and reflects the physical properties of the grains. GHI is mainly affected by the endosperm texture and depends on the strength of the interaction between proteins and starch granules in the grains. During the flour milling process, wheat grains and their fragments are ground into small particles, and then further ground and screened to obtain flour. In the endosperm of soft wheat, due to the weak interaction between starch and protein granules, the fragmentation during the milling process mainly occurs at the cellular level and requires less external force; while in hard wheat, due to the strong interaction between starch and protein granules, the fragmentation mainly occurs at the cell wall, especially the cell wall under the aleurone layer, and requires stronger external force. To more accurately describe grain hardness, according to the national standard of our country, wheat can be divided into hard wheat (GHI≥60), soft wheat (GHI≤45) and intermediate type (45<GHI<60) (GB-1351–2023). In addition, soft wheat can be further subdivided into common soft wheat (12<GHI≤45) and "super soft wheat" (GHI≤12). Wheat with different grain hardnesses has different processing uses. Generally, hard wheat is suitable for processing into bread and high-quality noodles, etc., while soft wheat is suitable for processing into cakes and pastries, etc. In addition, due to the loose endosperm structure, high flour yield and high amylopectin content of soft wheat, it can be used as a high-quality raw material for brewing.
[0003] Existing studies have used genetic and association analysis populations to mine genetic loci (genes) controlling wheat grain hardness, and reported multiple QTL and gene loci related to wheat GHI; the most important locus is the hardness locus (Ha) on the short arm of chromosome 5D, which can explain 80% of the grain hardness variation. This locus is mainly composed of two main proteins, GrainSoftness Protein-1 and friabilin; friabilin contains two proteins, Puroindoline a (PinA) and Puroindoline b (PinB), which are enriched on the surface of washed starch of soft wheat. Mutation of either of the two genes can cause an increase in grain hardness. Identified in the association analysis population PinA and PinBSix haplotypes were identified, and specific molecular markers were developed. Furthermore, some minor QTL loci on other chromosomes also affect GHI, explaining 2.6–36.7% of phenotypic variation under different environments. Simultaneously, the study found different modes of interaction between genetic loci, exhibiting additive and epistatic effects, and identified a three-marker interaction model that explains 75% of phenotypic variation. The study found significant phenotypic variation among soft wheat varieties (10.4 ≤ GHI ≤ 45), but few QTLs and gene loci were associated with the grain hardness trait in soft wheat. Only two major loci controlling GHI in soft wheat were identified using population association analysis. QSKhard.wql-3A and QSKhard.wql-5A ,and QSKhard.wql-2B , QSKhard.wql-3A , QSKhard.wql-3B and QSKhard.wql-6B Four minor sites, etc.
[0004] Statistics show that soft wheat accounts for approximately 7.5% of global wheat cultivation, with major producing areas including the United States (soft white winter wheat) and Canada (soft white spring wheat). Of China's annual wheat production of approximately 200 million tons, soft varieties account for less than 10% of demand, resulting in an import dependency exceeding 60%. Furthermore, the variety of soft wheat varieties is insufficient to meet the growing diverse needs of the population. Therefore, further exploration of genes related to grain hardness in soft wheat and the development of molecular markers for key gene loci are of great significance for improving the quality of soft wheat and breeding superior soft wheat varieties. Summary of the Invention
[0005] The purpose of this invention is to provide a QTL that is primarily related to wheat grain hardness. qHI.1B-2 The relevant SNP molecular markers and corresponding detection primers can lay a certain technical foundation for the development and breeding of new wheat varieties with different hardness.
[0006] The specific technical solution adopted in this application is as follows.
[0007] A QTL with main effect on wheat grain hardness qHI.1B-2 The relevant SNP molecular marker, named 1B_5307, has a G / T polymorphic variant site, which can be divided into two types: GG genotype and TT genotype. The SNP sequence corresponding to the GG genotype (201 bp, with G at position 101 bp, as shown in SEQ ID No. 1) is as follows: GCAGCAGATGAAGCAGCAAAGTATAAGGATTATTTTCCAGTGATGCAGTCCCTGCAGCTGCCGGACCCAGGCATCAAGTTCACAGCAACTCCCTCTGGTGGCGGTCTTGATATGTTCGCGCTCTTCAACCCCCGCGGCACCAGCGAAGGCAGAATTGTTTTTAGCAATTCGATCGGTGAGGCTGTGCTGTACGACGCCGAC; The SNP sequence corresponding to the TT genotype (201 bp, with T at the 101 bp site, as shown in SEQ ID No. 2) is as follows: GCAGCAGATGAAGCAGCAAAGTATAAGGATTATTTTCCAGTGATGCAGTCCCTGCAGCTGCCGGACCCAGGCATCAAGTTCACAGCAACTCCCTCTGGTGTCGGTCTTGATATGTTCGCGCTCTTCAACCCCCGCGGCACCAGCGAAGGCAGAATTGTTTTTAGCAATTCGATCGGTGAGGCTGTGCTGTACGACGCCGAC.
[0008] The SNP molecular markers were applied in wheat molecular breeding, and the grain hardness of TT genotype wheat materials was significantly lower than that of GG genotype wheat materials (i.e., GG genotype wheat grain hardness was higher than TT genotype wheat grain hardness; TT genotype wheat grain hardness was lower, and it can be used to breed soft wheat).
[0009] The KASP primer set for detecting the SNP molecular marker is a set of primers for PCR amplification, and its specific design is as follows: 1B_5307-F1:5'-GTTCACAGCAACTCCCTCTGGTGT-3'; 1B_5307-F2: 5'-GTTCACAGCAACTCCCTCTGGTGG-3'; 1B_5307-R: 5'-CTGCTCCCTTAGGCTCGTTGAGGC-3'.
[0010] During PCR amplification, based on the need for fluorescence collection after PCR amplification, a FAM fluorescent tag sequence: GAAGGTGACCAAGTTCATGCT can be added to the 5' end of primer 1B_5307-F1. Similarly, a HEX fluorescent tag: GAAGGTCGGAGTCAACGGATT can be added to the 5' end of primer 1B_5307-F2.
[0011] A detection reagent or kit for wheat grain hardness was prepared using the aforementioned KASP primer set.
[0012] The KASP primer set is used in wheat variety breeding for the detection and identification of wheat grain hardness in wheat molecular breeding.
[0013] The method for identifying wheat grain hardness using the aforementioned KASP primer set includes the following steps: (a) Extraction of genomic DNA Genomic DNA was extracted from the wheat samples to be tested. (II) PCR amplification Using the genomic DNA extracted in step (I) as a template, PCR amplification was performed using the KASP primer set; (III) Result Determination The determination is based on the identification results of the PCR amplification products in step (II) (fluorescence signal results, electrophoresis detection, or sequencing analysis results), and the determination criteria are as follows: The grain hardness of wheat with blue fluorescence TT genotype was significantly lower than that of wheat with green fluorescence GG genotype. The grain hardness of red fluorescent GT heterozygous wheat grains is between that of TT and GG genotype wheat grains.
[0014] In previous research, the inventors discovered a significant difference in grain hardness between Zhengmai 113 (normal soft wheat, HI=20.02) and Zhengmai 824 (extra soft wheat, HI=11.85). Therefore, based on these two materials, the inventors constructed an F2 segregating population and used bulked segregant RNA sequencing (BSR-seq) to locate the genetic loci regulating wheat grain hardness. The results revealed a SNP molecular marker closely linked to the wheat grain hardness gene (named 1B_5307, with the corresponding major-effect QTL named...). qHI.1B-2 Furthermore, based on this SNP molecular marker, the inventors developed a set of KASP primers that can be used to identify this site.
[0015] Preliminary experimental results show that the SNP sites and corresponding KASP primer sets developed in this application can effectively distinguish the grain hardness of different wheat materials. These results provide a solid technical foundation for the early and rapid screening of wheat varieties with different grain hardness and for accelerating the breeding process of new wheat varieties. Attached Figure Description
[0016] Figure 1 The distribution of grain hardness phenotypic data of mature grains from 430 naturally harvested soft wheat F2 population materials is shown in the figure. The grain hardness phenotypic data were measured by a single grain characteristic tester (SKCS-4100). Figure 2 To calculate the Δ(SNP-index) value for each variant site based on BSR-seq analysis, a distribution map of the Δ(SNP-index) across the 21 chromosomes was obtained, including major-effect QTLs. qHI.1B-2 The significant marker 1B_5307 identified in this invention, as indicated by the red box, is in the major QTL. qHI.1B-2 Within the chromosome, this marker is located on wheat chromosome 1B; Figure 3 The image shows the genotyping results of the KASP molecular marker 1B_5307 in 430 soft wheat F2 single plants. Blue indicates the genotype 1B_5307. _ TT, green indicates genotype 1B_5307 _ GG, red indicates genotype 1B_5307 _ GT, gray indicates the blank control (NTC) without genomic DNA; Figure 4 Figure 1 shows a comparative analysis of the differences in grain hardness of the KASP molecular marker 1B_5307 in soft wheat materials with different allelic genotypes; in the figure, "***" indicates that the difference is significant at the p<0.001 level. Detailed Implementation
[0017] The present application will be further explained below with reference to the embodiments. Before further introducing the specific embodiments, the experimental background of some biological materials and other factors involved in the following embodiments will be briefly described as follows.
[0018] Biomaterials: Zhengmai 113 and Zhengmai 824 are common wheat varieties in the existing technology. As a professional wheat research institution, the applicant has been preserving and collecting relevant wheat germplasm materials for many years and has also built a public germplasm resource bank. The relevant materials can also be obtained through public channels. In the following examples, the wheat was planted in the applicant's experimental field (located in Xinxiang, Henan Province), and sown and managed in accordance with the recommendations of the local agricultural technology department and common planting and management methods.
[0019] Example 1 In their research on wheat grain hardness, the inventors discovered a significant ploidy difference between Zhengmai 113 and Zhengmai 824. To further analyze this difference, the inventors conducted a cross between Zhengmai 113 and Zhengmai 824 (maternal parent: Zhengmai 824, paternal parent: Zhengmai 113), constructing an F2 population. Preliminary investigations into specific regulatory genes were then conducted, and the specific experimental details are briefly described below.
[0020] (I) Grain hardness phenotypic determination and analysis The grain hardness phenotypic data of 430 naturally harvested F2 soft wheat single-plant mature grains were measured using a single grain characteristic analyzer (SKCS-4100). During the measurement, impurities were removed from each sample, and 300 grains were taken for hardness index determination. The average value of these 300 grain phenotypic data was statistically analyzed (each sample was repeated twice, and the average value was taken). The distribution map of the relevant phenotypic data was obtained (statistical results are shown in Figure 1). Figure 1 (As shown).
[0021] (ii) Cluster separation analysis based on transcriptome sequencing (BSR-seq) The specific process is as follows: (1) Constructing a mixed pool: Based on the grain hardness index of the F2 segregating population, the 40 plants with the highest grain hardness and the 40 plants with the lowest grain hardness were selected to construct extreme mixed ponds. (2) Sample testing: RNA was extracted from the extreme mixed pool sample constructed in step (1) for transcriptome sequencing. It should be noted that before transcriptome sequencing, agarose gel electrophoresis and nanodrop detection were performed to ensure the quality and quantity of the sample RNA (the RNA concentration should not be less than 50 ng / ul and the total amount should not be less than 1000 ng to ensure the accuracy and repeatability of sequencing). (3) Library construction and quality control: mRNA was enriched using magnetic beads with Oligo(dT) and then fragmentation buffer was added to randomly break down the mRNA after enrichment. Using mRNA as a template, the first cDNA strand was synthesized using six-base random primers. Then, buffer, dNTPs, RNase H and DNA polymerase I were added to synthesize the second cDNA strand. The cDNA was purified using AMPureXPbeads. The purified double-stranded cDNA was then repaired at the ends, A-tailed, and ligated with sequencing adapters. Fragment size selection was then performed using AMPureXPbeads. cDNA libraries were obtained by PCR enrichment. The obtained cDNA library was initially quantified using Qubit 2.0, and the insert size of the library was detected using Agilent 2100. The next step of the experiment could only be carried out after the insert size met the expectations. Finally, the effective concentration of the library was accurately quantified using the qPCR method (effective concentration of library > 2nM) to complete the library detection. (4) Sequencing: After the library passes the inspection, different libraries are pooled according to the target amount of data to be generated, and paired-end 150bp (PE150) sequencing is performed using the Illumina HiSeq platform. During sequencing, PE150, or paired-end sequencing, reads 150 bp from each end. It utilizes insert fragments from small fragment libraries for high-throughput sequencing, facilitating subsequent sequence alignment and analysis, and improving the accuracy and reliability of the data.
[0022] The Δ(SNP-index) value for each variant site was calculated using cluster segregation analysis based on transcriptome sequencing (BSR-seq). The resulting distribution map of the Δ(SNP-index) across the 21 chromosomes is shown in the figure below (partial results are shown in the figure below). Figure 2 (As shown).
[0023] (III) Results Analysis Combining the grain hardness phenotypic data from step (I) and the BSR sequencing results from step (II), a major QTL regulating wheat grain hardness was finally located (named...). qHI.1B-2 Within this interval, a SNP locus 1B_5307 with the highest Δ (SNP-index) value was identified. Further referencing the 'Chinese Spring' genome sequence information, this closely linked molecular marker 1B_5307 is located at nucleotides 530,740,897 on chromosome 1B, with the specific corresponding SNP sequence as follows: GCAGCAGATGAAGCAGCAAAGTATAAGGATTATTTTCCAGTGATGCAGTCCCTGCAGCTGCCGGACCCAGGCATCAAGTTCACAGCAACTCCCTCTGGTG[G / T]CGGTCTTGATATGTTCGCGCTCTTCAACCCCCGCGGCACCAGCGAAGGCAGAATTGTTTTTAGCAATTCGATCGGTGAGGCTGTGCTGTACGACGCCGAC.
[0024] Example 2 Based on the analysis results of Example 1, and to facilitate subsequent identification and application, the inventors further developed and designed a set of KASP primers based on the KASP technology principle, as follows: 1B_5307-F1:5'-GTTCACAGCAACTCCCTCTGGTGT-3'; 1B_5307-F2: 5'-GTTCACAGCAACTCCCTCTGGTGG-3'; 1B_5307-R: 5'-CTGCTCCCTTAGGCTCGTTGAGGC-3'; Meanwhile, to facilitate subsequent quantitative fluorescence detection and analysis, a FAM fluorescent tag (GAAGGTGACCAAGTTCATGCT) was added to the 5' end of primer 1B_5307-F1, and a HEX fluorescent tag (GAAGGTCGGAGTCAACGGATT) was added to the 5' end of primer 1B_5307-F2.
[0025] Based on the aforementioned 430 F2 materials, the inventors conducted further detection and verification experiments using the above primer set. The specific experimental details are briefly described below.
[0026] (a) Extraction of genomic DNA In the early stages of the experiment, the inventors collected and preserved leaf material from F2 population plants about 10 days after emergence. Using this material as a sample, they extracted genomic DNA using the CTAB method (dilution to a concentration of 30 ng / μL).
[0027] (II) PCR amplification Using the genomic DNA extracted in step (I) as a template, PCR amplification was performed. The amplification system of 5 μL was designed as follows: KASP Master mix, 2.5μL; MgCl2, 0.04 μL; KASP Primer mix, 0.7μL; DNA template, 1 μL; ddH2O, 0.76 μL; The KASP Primer mix is a mixture of 1B_5307-F1, 1B_5307-F2 and 1B_5307-R (concentrations of 10 μmol / L) and water in a volume ratio of 12:12:30:46. The PCR amplification program was as follows: 95°C, 15 min; 95°C, 20 s, 65°C-55°C, 1 min, 10 cycles (decreasing by 1°C per cycle); 95°C, 20 s, 57°C, 1 min, 35 cycles; 37°C, 1 min. After PCR amplification, CFX Connect was used. TM The fluorescence signal was read, and the genotyping results of the KASP molecular marker 1B_5307 in 430 soft wheat F2 single plants were obtained (statistical results are shown in the figure). Figure 3 (As shown in the figure). Blue fluorescence indicates that the wheat material has the TT genotype, green fluorescence indicates that the wheat material has the GG genotype, and red fluorescence indicates that the wheat material has the GT heterozygous genotype.
[0028] (III) Statistical Results Genotyping of different alleles of 1B_5307 was performed on wheat materials from 430 wheat F2 populations, revealing that 138 wheat materials were of 1B_5307 type. _ The TT genotype accounted for approximately 32.09%; 106 wheat materials were classified as 1B_5307. _ The GG genotype accounts for approximately 24.65% (as shown in Table 1 below).
[0029] Table 1. Results of differentiation of different genotypes of wheat material 1B_5307 based on KASP primer sets. Note: a and b represent in P The difference was significant at the <0.05 level.
[0030] Statistical comparative analysis of the grain hardness index of wheat F2 population (see Appendix Table 1 at the end of the article for specific measurement results) reveals that there are significant differences in grain hardness among different alleles (e.g., Figure 4 (as shown in the figure). Furthermore, the grain hardness of TT genotype wheat materials is significantly lower than that of GG genotype wheat materials, that is, TT genotype is a favorable genotype for reducing wheat grain hardness.
[0031] Appendix Table 1: Hardness index and genotyping results based on KASP primer sets for 430 wheat materials Continued from the previous table: Continued from the previous table: Continued from the previous table: Continued from the previous table: .
Claims
1. A QTL with major effect on wheat grain hardness qHI.1B-2 The relevant SNP molecular markers are characterized by, This molecular marker is named 1B_5307 and has two genotypes: GG and TT. The SNP sequence corresponding to the GG genotype is shown in SEQ ID No. 1; The SNP sequence corresponding to the TT genotype is shown in SEQ ID No.
2.
2. The application of the SNP molecular marker as described in claim 1 in wheat molecular breeding, characterized in that, The grain hardness of TT genotype wheat materials was significantly lower than that of GG genotype wheat materials.
3. The KASP primer set for detecting the SNP molecular marker described in claim 1, characterized in that, The KASP primer set is a set of primers for PCR amplification, and its specific design is as follows: 1B_5307-F1:5'-GTTCACAGCAACTCCCTCTGGTGT-3'; 1B_5307-F2: 5'-GTTCACAGCAACTCCCTCTGGTGG-3'; 1B_5307-R: 5'-CTGCTCCCTTAGGCTCGTTGAGGC-3'; Meanwhile, primer 1B_5307-F1 has a FAM fluorescent tag sequence at its 5' end: GAAGGTGACCAAGTTCATGCT; The 5' end of primer 1B_5307-F2 is equipped with a HEX fluorescent tag: GAAGGTCGGAGTCAACGGATT.
4. A reagent or kit for detecting wheat grain hardness prepared using the KASP primer set described in claim 3.
5. The application of the KASP primer set described in claim 3 in wheat variety breeding, characterized in that, Used for identifying wheat grain hardness in wheat molecular breeding.
6. A method for identifying wheat grain hardness using the KASP primer set described in claim 3, characterized in that, Includes the following steps: (a) Extraction of genomic DNA Genomic DNA was extracted from the wheat samples to be tested. (II) PCR amplification Using the genomic DNA extracted in step (I) as a template, PCR amplification was performed using the KASP primer set; (III) Result Determination The determination is based on the PCR amplification product identification results from step (II), and the determination criteria are as follows: The grain hardness of wheat with blue fluorescence TT genotype was significantly lower than that of wheat with green fluorescence GG genotype. The grain hardness of the GT heterozygous genotype with red fluorescence is between that of the TT and GG genotypes.