DCAPS molecular marker for identifying character of grain number per ear of wheat and application of dCAPS molecular marker

Abstract

The invention discloses a dCAPS molecular marker related to the character of the grain number per ear of wheat and application of the molecular marker in identification or auxiliary identification of the character of the grain number per ear of wheat. The dCAPS molecular marker is used for detecting the genotype of an A492C SNP site in a wheat gene to be detected, so that a wheat variety with relatively high grain number per ear can be found. The A492C SNP locus is located at the 492nd basic group from the 5'tail end of the sequence shown in SEQ ID NO.1, and comprises two allele types, namely an AA homozygous type and a CC homozygous type. Association analysis proves that the grain number of wheat with the genotype of AA homozygous type at the A492C SNP site is greater than or candidate greater than that of wheat with the genotype of CC homozygous type. The molecular marker disclosed by the invention provides a new method for molecular marker-assisted selective breeding of wheat, and has important significance in cultivation and research of high-yield wheat varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to a dCAPS molecular marker for identifying the number of grains per ear of wheat and its application. Background Technology

[0003] Currently, researchers have identified a large number of QTLs regulating grain number per spike. Wang et al. used 151 recombinant inbred lines derived from Yangmai 4 and Yanzhan 1 as materials, constructed a high-density genetic map using a wheat 55K single nucleotide polymorphism (SNP) microarray, and combined this with phenotypic data from four environments over three years to perform QTL mapping analysis on the grain number per spike trait. They detected three QTLs related to grain number per spike on chromosomes 4A, 5A, and 5B. Hu et al. used phenotypic data from a population of recombinant inbred lines constructed from Kenong 9204 and Jing 411, along with wheat 660K microarray genotypic data, to perform QTL mapping, detecting the grain number per spike QTL-qKnps-2A located on chromosome 2A in six environments. Chen et al. used near-isogenic lines constructed by crossing octoploid wheat with common wheat varieties Hengguan 35 and Kenong 199 as research materials. They used a 660K SNP chip to perform whole-genome scanning on near-isogenic lines with significant differences in the number of grains per ear phenotype, and identified QTLs located on chromosomes 1B and 3B, respectively.

[0004] Despite the large number of QTLs associated with wheat grain number identified, most of these QTLs have a small phenotypic contribution and poor repeatability across different years and environments, making them difficult to apply to the genetic improvement of wheat grain number.

[0005] Therefore, developing novel SNP markers that are closely linked to the major QTLs of wheat ear grain number and have both high phenotypic contribution and environmental stability is of great significance for high-yield wheat breeding. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a dCAPS molecular marker for identifying the number of grains per ear of wheat and its application.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0008] A primer pair for detecting single nucleotide polymorphism of A492C SNP in wheat genome, wherein the primer pair is primer pair F1 and R1 composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pair F2 and R2 composed of SEQ ID NO.4 and SEQ ID NO.5;

[0009] The A492C SNP corresponds to the 492nd base from the 5' end of the sequence shown in SEQ ID NO.1, and contains two allele types: AA homozygous and CC homozygous, and wheat with different genotypes has different number of grains per spike.

[0010] On the other hand, the present invention also includes reagents or kits for identifying or assisting in the identification of wheat ear grain number traits, the reagents or kits being used to detect the A492C SNP locus genotype, and containing at least the above-described primer combination and the necessary restriction endonuclease components.

[0011] As a preferred embodiment of the present invention, the restriction endonuclease is NdeI enzyme.

[0012] On the other hand, the present invention also includes a method for identifying or assisting in the identification of the number of grains per ear of wheat, comprising the following steps:

[0013] (1) Extract genomic DNA from the wheat sample to be identified;

[0014] (2) Detect the genotype of the A492C SNP site in the wheat genomic DNA to be identified, wherein the polymorphism of the A492C SNP site is A / C;

[0015] (3) Determine the number of grains per ear of wheat to be identified based on genotype: wheat with genotype AA homozygous has a greater or candidate greater number of grains per ear than wheat with genotype CC homozygous.

[0016] As a preferred embodiment of the present invention, the method for detecting the genotypic polymorphism of the A492C SNP site in wheat genomic DNA includes the following (1) or (2):

[0017] (1) Direct sequencing;

[0018] (2) Use the above primer combination or reagent or kit to perform PCR amplification of the wheat genomic DNA to be tested, and perform enzyme digestion identification on the amplification products. Determine the genotype based on the electrophoretic banding of the enzyme digestion products.

[0019] As a preferred embodiment of the present invention, the DNA fragment amplified by PCR is the 5' end 471-711bp and / or 359-1176bp sequence in SEQ ID NO.1.

[0020] As a preferred embodiment of the present invention, the determination of genotype based on the electrophoretic banding of enzyme digestion products is specifically as follows: if the PCR product can be cut, the genotype of the wheat A492C SNP site to be tested is AA homozygous; if the PCR product cannot be cut, the genotype of the wheat A492C SNP site to be tested is CC homozygous.

[0021] On the other hand, the present invention also includes the application of the above-mentioned primer combinations, reagents or kits, and methods for identifying or assisting in the identification of wheat ear grain number traits, characterized in that: the application is any one of the following:

[0022] (1) Application in identifying or assisting in the identification of wheat ear grain number trait;

[0023] (2) Application in screening or assisting in screening wheat varieties with high grain number per ear;

[0024] (3) Application in wheat breeding and / or assisted breeding;

[0025] (4) Application in the preparation of wheat breeding and / or assisted breeding products.

[0026] On the other hand, the present invention also includes a product, characterized in that: the product prepared based on the above-described application is any one of the following:

[0027] (1) Products that detect wheat A492C SNP site polymorphism or genotype;

[0028] (2) Products used for identification or auxiliary identification of the number of grains per ear of wheat;

[0029] (3) Products used for wheat breeding and / or assisted breeding.

[0030] Finally, the present invention also includes a method for wheat breeding, characterized in that: firstly, the polymorphism of the A492C SNP site in the wheat genome is detected, and wheat with the SNP site in the wheat genome being homozygous for AA is selected as the parent for breeding.

[0031] The beneficial effects of adopting the above technical solution are as follows: This application provides a dCAPS molecular marker related to the grain number trait of wheat and its application. This molecular marker, by detecting the genotype of the A492C SNP site in the wheat gene to be tested, can identify or assist in identifying the grain number trait of wheat, helping to select wheat plants with a relatively high grain number per ear. The A492C SNP site is located at the 492nd base from the 5' end of the sequence shown in SEQ ID NO.1, and contains two allelic types: AA homozygous and CC homozygous. Association analysis shows that wheat with the AA homozygous genotype has a higher or candidate higher grain number per ear than wheat with the CC homozygous genotype. This provides a new method for marker-assisted selection breeding of wheat, which is of great significance in the breeding of high-yielding wheat varieties and research. Attached Figure Description

[0032] Figure 1 The genomic location and regional characteristics of the A492C SNP site.

[0033] Figure 2 This is a schematic diagram of the electrophoresis detection results of dCAPS molecular marker enzyme digestion products.

[0034] Figure 3 A schematic diagram of SNP genotyping for 320 wheat varieties A492C.

[0035] Figure 4 This is a schematic diagram illustrating the association between wheat A492C SNP genotype and grain number per ear under different environmental conditions. Detailed Implementation

[0036] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0037] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0038] Example 1: Discovery of A492C SNP loci associated with wheat ear grain number trait and development of dCAPS molecular markers

[0039] 1. Discovery of the A492C SNP site

[0040] TFB1 is a cloned wheat gene that regulates grain number per spike, and three copies exist in the wheat genome: TFB1-A, TFB1-B, and TFB1-D. Genetic variation analysis of the TFB1 gene coding region in a natural wheat population revealed a SNP in the coding region of TFB1-B, corresponding to position 492 from the 5' end of the sequence shown in SEQ ID NO.1. This SNP has two genotypes: homozygous AA and homozygous CC. The genomic location and regional characteristics of this SNP locus are as follows... Figure 1 As shown.

[0041] All wheat materials used were obtained from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm). Material information can be found on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0042] 2. Development of dCAPS molecular markers

[0043] Designed dCAPS molecular marker primer pairs for amplifying DNA fragments including the A492C SNP site. The primer pairs consist of primer pairs F1 and R1 composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs F2 and R2 composed of SEQ ID NO.4 and SEQ ID NO.5.

[0044] F1:ACTGTGGCTGAAGCACTTGC (SEQ ID NO.2)

[0045] R1: CGCATATAACCCACATTTAGTTAGTC (SEQ ID NO.3)

[0046] F2: AACCACCTCCTAGCTTGCAT (SEQ ID NO.4)

[0047] R2:TTGTCTAGATACGGATGTATAGTAC (SEQ ID NO.5)

[0048] PCR amplification was performed using primer pairs F1 and R1, amplifying the sequence from positions 359 to 1176 as shown in SEQ ID NO. 1; PCR amplification was performed using primer pairs F2 and R2, amplifying the sequence from positions 471 to 711 as shown in SEQ ID NO. 1. Enzyme digestion analysis showed that this polymorphism could be recognized by NdeI.

[0049] Example 2: Method for detecting the genotype of wheat A492C SNP locus using dCAPS molecular markers

[0050] 1. Extract genomic DNA from the wheat sample to be tested.

[0051] 2. Using the genomic DNA from step 1 as a template, perform PCR amplification with primers F1 and R1 to obtain the PCR amplification product P1.

[0052] The PCR amplification system was 10 μL, containing: ddH2O μL, 1 μL 10×PCR Buffer, 0.3 μL each of primer F1 (5 μmol / L) and primer R1 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0053] PCR amplification conditions were as follows: 94℃ for 4 min; 94℃ for 30 s, 56℃ for 30 s, 72℃ for 30 s, 32 cycles; 72℃ for 10 min; and stored at 16℃.

[0054] 3. Dilute the PCR amplification product P1 from step 2 by 100 times, and use it as a template to perform PCR amplification with primers F2 and R2 to obtain the PCR amplification product P2.

[0055] The PCR amplification system was 10 μL, containing: ddH2O μL, 1 μL 10×PCR Buffer, 0.3 μL each of primer F2 (5 μmol / L) and primer R2 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0056] PCR amplification conditions were as follows: 94℃ for 4 min; 94℃ for 30 s, 56℃ for 30 s, 72℃ for 10 s, 32 cycles; 72℃ for 10 min, and stored at 16℃.

[0057] 4. Digest the PCR amplification product P2 obtained in step 3 with NdeI to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified site according to the following method:

[0058] If the enzyme digestion product consists of two or smaller fragments, then the genotype of the wheat A492C SNP site to be tested is homozygous AA. Figure 2 The band shown in lane A of the middle swim bladder); if the enzyme digestion product is a single or large fragment, then the genotype of the wheat A492CSNP locus to be tested is CC homozygous ( Figure 1 (The band shown in lane C of the middle swimming lane). Figure 1 As shown in the figure. Lane M represents the molecular weight standard; lane A represents the band cleaved by NdeI enzyme; and lane C represents the band that cannot be cleaved by NdeI enzyme.

[0059] Example 3: Generating natural populations using dCAPS molecular markers and performing correlation analysis with grain number trait.

[0060] 1. Genotyping of A492C SNP loci in 320 wheat varieties from a natural population.

[0061] Exon capture sequencing was performed on 385 wheat accessions from natural populations, and specific genotyping was conducted on these materials. Of these 385 accessions, 320 had agronomic trait data from multiple years and locations, while the remaining 65 accessions did not have sufficient data to meet the requirements for subsequent analysis. Therefore, only the data from these 320 accessions were used for the association analysis between the wheat A492C SNP locus genotype and grain number per ear.

[0062] Genotyping was performed on 320 wheat varieties (all hexaploid) in a natural population using the method described in Example 2. Genotyping was carried out according to step 2, and the amplification products of a random sample of wheat varieties were sequenced for verification. The results are shown in Table 1. Figure 3 As shown, genotype I indicates that the genotype at the A492C SNP site is homozygous AA, and genotype II indicates that the genotype at the A492C SNP site is homozygous CC.

[0063]

[0064]

[0065]

[0066]

[0067] 2. Association analysis between different genotypes of the A492C SNP locus and the number of grains per ear in wheat.

[0068] In 2018, wheat populations of the above-mentioned natural populations were planted in dry and hot fields, dry fields, hydrothermal fields, and irrigated fields at the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei Province); in 2019, in irrigated fields and dry fields at the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Hengshui, Hebei Province); and in 2020, in dry and hot fields, dry fields, hydrothermal fields, and irrigated fields at the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of grains per spike for each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the relationship between the number of grains per spike and the polymorphic loci. A mixed linear model + population structure (MLM + (Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 4 As shown.

[0069]

[0070] The results showed that the differences in grain number per spike between the two different genotypes at the A492C SNP locus in the 320 hexaploid wheat accessions shown in Table 2 were statistically significant (P<0.05). Specifically, wheat of type I (homozygous AA genotype at this locus) had a higher grain number per spike than wheat of type II (homozygous CC genotype at this locus). In several environments, wheat of type I had 2.77, 2.5, 1.86, 1.47, 3.01, 3.54, 2.74, 1.83, and 3.33 more grains per spike than wheat of type II, respectively. Studies on natural populations indicate that the AA homozygous genotype at the A492C SNP locus is an excellent genotype for increasing grain number per spike in wheat.

[0071] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A primer combination, characterized in that: For detecting the single nucleotide polymorphism of A492C SNP in the wheat genome, the primer combination is primer pair F1 and R1 composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pair F2 and R2 composed of SEQ ID NO.4 and SEQ ID NO.5; The A492C SNP corresponds to the 492nd base from the 5' end of the sequence shown in SEQ ID NO.1, and contains two allele types: AA homozygous and CC homozygous, and wheat with different genotypes has different number of grains per spike.

2. A reagent or kit for identifying or assisting in the identification of the number of grains per ear in wheat, characterized in that: This reagent or kit is used to detect the A492C SNP genotype as described in claim 1, and contains at least the primer combination and necessary restriction endonuclease components as described in claim 1.

3. The reagent or kit for identifying or assisting in the identification of wheat ear grain number traits according to claim 2, characterized in that: The restriction endonuclease is NdeI enzyme.

4. A method for identifying or assisting in the identification of the number of grains per ear in wheat, characterized in that: Includes the following steps: (1) Extract genomic DNA from the wheat sample to be identified; (2) Detect the genotype of the A492C SNP site in the wheat genomic DNA to be identified, wherein the polymorphism of the A492C SNP site is A / C; (3) Determine the number of grains per ear of wheat to be identified based on genotype: wheat with genotype AA homozygous has a greater or candidate greater number of grains per ear than wheat with genotype CC homozygous.

5. The method for identifying or assisting in the identification of wheat ear grain number trait according to claim 4, characterized in that: The method for detecting the genotypic polymorphism of the A492C SNP site in wheat genomic DNA includes the following (1) or (2): (1) Direct sequencing; (2) PCR amplification of the wheat genomic DNA to be tested is performed using the primer combination described in claim 1 or the reagent or kit described in claim 3, and the amplification products are identified by enzyme digestion. The genotype is determined based on the electrophoretic banding of the enzyme digestion products.

6. The method for identifying or assisting in the identification of wheat ear grain number trait according to claim 5, characterized in that: The DNA fragment amplified by PCR is the 5' end sequence of 471-711bp and / or 359-1176bp in SEQ ID NO.

1.

7. The method for identifying or assisting in the identification of wheat ear grain number trait according to claim 5, characterized in that: The specific method for determining genotype based on electrophoretic banding of enzyme digestion products is as follows: if the PCR product can be cut, the genotype of the wheat A492C SNP site to be tested is AA homozygous. If the PCR product cannot be cut, the genotype of the wheat A492C SNP site to be tested is CC homozygous.

8. The application of the primer combination of claim 1, the reagent or kit of claim 3, and the method for identifying or assisting in the identification of wheat ear grain number trait according to any one of claims 4-7, characterized in that: The application is any one of the following: (1) Application in identifying or assisting in the identification of wheat ear grain number trait; (2) Application in screening or assisting in screening wheat varieties with high grain number per ear; (3) Application in wheat breeding and / or assisted breeding; (4) Application in the preparation of wheat breeding and / or assisted breeding products.

9. The product, characterized in that: The product prepared based on the application described in claim 8 is any one of the following: (1) Products that detect the polymorphism or genotype of the A492C SNP site in wheat as described in claim 1; (2) Products used for identification or auxiliary identification of the number of grains per ear of wheat; (3) Products used for wheat breeding and / or assisted breeding.

10. A method for wheat breeding, characterized by: First, the polymorphism of the A492C SNP site described in claim 1 in the wheat genome was detected, and wheat with the AA homozygous SNP site in the wheat genome was selected as the parent for breeding.

Images