Molecular marker closely linked with major QTL (Quantitative Trait Loci) of soluble solid content of carrots and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with a major QTL (Quantitative Trait Loci) of the content of soluble solids in carrots and application of the molecular marker, and belongs to the field of molecular marker-assisted breeding. A major QTL (quantitative trait loci) located in a 0.86-0.88 Mb interval of a chromosome 5 is accurately determined, and a stable and detectable SNP (single nucleotide polymorphism) marker 'SNP869655' and a matched KASP primer combination and a detection method thereof are developed, so that rapid and accurate genotype identification on the content potential of soluble solids in carrots can be realized in a seedling stage, and the efficiency and accuracy of early selection of breeding are remarkably improved. Reliable technical support is provided for conversion of carrot quality breeding from phenotype selection to genotype selection, rapid cultivation of a new carrot variety with excellent taste and rich nutrition is facilitated, and breeding efficiency and industrial competitiveness are improved.

Description

Technical Field

[0001] This invention relates to the field of marker-assisted breeding, and in particular to molecular markers closely linked to major QTLs related to the soluble solids content of carrots and their applications. Background Technology

[0002] Carrots, as an important root vegetable, are rich in carotenoids, carbohydrates, pectin, and dietary fiber, among other nutrients. They possess numerous health benefits, including anti-cancer properties, anti-aging effects, vision protection, improved immunity, gut health promotion, maintenance of heart and muscle function, and reduction of the toxicity of metal ions. Therefore, they have very high nutritional, medicinal, and even health-promoting value. Soluble solids content refers to the total amount of sugars, acids, vitamins, and other substances dissolved in water in food. Soluble solids are an important indicator reflecting the overall flavor, nutritional quality, and characteristics of fruit crops. In vegetable crops, high soluble solids content can make vegetables taste sweeter and may also indicate the presence of more soluble nutrients. Therefore, the soluble solids content of carrots, as one of many vegetables, is crucial for improving carrot varieties.

[0003] Currently, genetic improvement of carrot soluble solids content mainly relies on traditional breeding methods, using field phenotypic screening for high-solids materials. However, soluble solids is a typical quantitative trait, regulated by multiple genes and easily influenced by the environment. Relying solely on phenotypic selection is inefficient, time-consuming, and inaccurate, making rapid and precise variety breeding difficult. With the development of molecular marker technology, using markers linked to traits for assisted selection has become an important means to improve breeding efficiency. Single nucleotide polymorphism (SNP) markers have advantages such as abundant quantity, high stability, and ease of high-throughput detection, and are widely used in plant genetic breeding. Currently, although some molecular markers for traits such as carrot disease resistance and color have been developed, functional SNP markers for the important quality trait of soluble solids content are still rarely reported. This is mainly because the carrot genome has high heterozygosity and a complex genetic background, making it difficult to locate QTLs related to solids content, and stable and reliable linked markers are hard to obtain.

[0004] Furthermore, even when relevant QTLs are identified in existing studies, they are often difficult to directly apply to breeding practices due to their low effect sizes, strong interactions with the environment, or the lack of practical molecular markers with tight linkage. Therefore, developing stable and detectable SNP molecular markers that are tightly linked to the major QTLs of carrot soluble solids content, and establishing efficient genotyping and trait identification methods, has become a key technological bottleneck in promoting the transformation of carrot quality breeding from phenotypic selection to genotypic selection, and is also an important problem that urgently needs to be solved in this field. Summary of the Invention

[0005] The purpose of this invention is to provide molecular markers tightly linked to the major QTL for soluble solids content in carrots and their applications, thereby addressing the problems existing in the prior art. This invention provides SNP molecular markers tightly linked to the major QTL for soluble solids content in carrots and their detection system, enabling early, rapid, and accurate identification of this trait. These markers can be effectively used for screening and molecular breeding of high-solids carrot germplasm, significantly improving breeding efficiency and accelerating the development of superior varieties.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a molecular marker tightly linked to a major QTL for soluble solids content in carrots. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, and a T / C mutation exists at the 221st base of the sequence shown in SEQ ID NO.4. The genotypes at this site include TT, CC, and CT.

[0007] The present invention also provides a KASP primer combination for detecting the molecular marker, the KASP primer combination comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.1, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.2, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.3.

[0008] The present invention also provides a kit for detecting the molecular marker, comprising the KASP primer combination described above.

[0009] The present invention also provides an application of the molecular marker, the KASP primer combination, or the kit described herein, for any of the following applications: (1) To determine the soluble solids content of carrots; (2) Screen carrot varieties or strains with high soluble solids content; (3) Marker-assisted breeding of carrots; (4) Improve carrot germplasm resources.

[0010] Optionally, when the genotype of the molecular marker mutation site is CC, the soluble solids content of the carrot is high; when the genotype of the molecular marker mutation site is TT, the soluble solids content of the carrot is low.

[0011] This invention also provides a method for identifying the soluble solids content of carrots, comprising the following steps: Using the genomic DNA of the carrot sample to be tested as a template, the template was amplified by real-time PCR using the KASP primers and the kit described above. The genotype of the carrot to be tested was determined based on the amplification results. Carrots with the CC genotype have a higher soluble solids content than carrots with the TT genotype.

[0012] Optionally, the PCR amplification reaction system is as follows: 5 μL of 2×PARMS master mix; 0.15 μL of 10 μM upstream primer F1; 0.15 μL of 10 μM upstream primer F2; 0.4 μL of 10 μM downstream primer R; 10-100 ng of template DNA; and double-distilled water to a final volume of 10 μL.

[0013] Optionally, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 20 s; 65-75℃ gradient extension for 60 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 94℃ denaturation for 20 s; 57℃ extension for 60 s, for a total of 30 cycles.

[0014] This invention also provides a method for breeding carrot germplasm with high soluble solids content, comprising the following steps: Using the genomic DNA of the carrot sample to be tested as a template, the template is amplified by real-time PCR using the KASP primer combination or the kit described above, and the genotype of the carrot to be tested is determined based on the amplification results. Carrots with genotype CC have a higher soluble solids content than carrots with genotype TT; germplasm with genotype CC was selected for subsequent breeding and propagation.

[0015] Optionally, the PCR amplification reaction system is as follows: 5 μL of 2×PARMS master mix; 0.15 μL of 10 μM upstream primer F1; 0.15 μL of 10 μM upstream primer F2; 0.4 μL of 10 μM downstream primer R; 10-100 ng of template DNA; and double-distilled water to a final volume of 10 μL. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 20 s; 65-75℃ gradient extension for 60 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 94℃ denaturation for 20 s; 57℃ extension for 60 s, for a total of 30 cycles.

[0016] The present invention discloses the following technical effects: The SNP molecular marker and its detection and application system closely linked to the major QTL for soluble solids content in carrots provided by this invention effectively solves the technical bottlenecks of low efficiency, poor accuracy, and long cycle in existing carrot quality breeding, which rely on traditional phenotypic selection. By precisely identifying the major QTL locus located in the 0.86-0.88 Mb region on chromosome 5, and developing a stable and detectable SNP marker "SNP_869655" and its matching KASP primer combination and detection method, rapid and accurate genotypic identification of carrot soluble solids content potential can be achieved at the seedling stage, significantly improving the efficiency and accuracy of early selection in breeding.

[0017] This marker possesses advantages such as co-dominance, stable polymorphism, high detection throughput, and low cost, and can be widely applied in various stages of carrot germplasm resource evaluation, high-solids parental screening, molecular marker-assisted selection, and multi-trait aggregation breeding. This invention provides reliable technical support for the shift from phenotypic selection to genotypic selection in carrot quality breeding, helping to accelerate the cultivation of new carrot varieties with excellent taste and rich nutrition, and improving breeding efficiency and industrial competitiveness. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a Manhattan plot showing the correlation between carrot soluble solids content and genome-wide association analysis. The horizontal axis represents the physical location on the chromosome, and the vertical axis represents statistical significance. The smaller the p-value, the larger the vertical axis, and the stronger the correlation. Figure 2 This is a QQ-plot of the soluble solids content of carrots. Figure 3 This is a box plot of soluble solids content in carrots. The horizontal axis represents genotype (FAM and HEX), and the vertical axis represents soluble solids content. Narrower boxes indicate more concentrated data, while wider boxes indicate more dispersed data. A median at the center of the box indicates a more symmetrical data distribution; a median above or below the center indicates a deviation. A longer dashed line (median line) at the center of the box indicates a wider data distribution. Figure 4 The results show the fluorescent signal genotyping results for "SNP_869655". Purple indicates genotype HEX, and green indicates genotype FAM. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Example 1: Construction and genetic analysis of a genetic population (1) Test plant materials This embodiment selected a natural population of over 300 carrot germplasm resources with different genetic backgrounds provided by the Vegetable Research Institute of the Guangdong Academy of Agricultural Sciences. All materials were grown at the experimental base of the Vegetable Research Institute of the Guangdong Academy of Agricultural Sciences, under unified field management, and harvested after the fleshy roots matured for subsequent analysis.

[0026] (2) Determination of soluble solids content and genetic analysis of carrot fleshy roots The fresh fleshy roots of the harvested single carrot plants were homogenized using a blender. The homogenate was then filtered through a nylon mesh. The filtered carrot juice was placed on a handheld refractometer to determine its soluble solids content. The experiment was repeated three times to determine the soluble solids content in the fresh carrot fleshy root samples. The obtained phenotypic data were statistically analyzed. Seventy representative varieties with phenotypic variations covering high, medium, and low solids content were selected from all materials (results are shown in Table 1) for subsequent molecular marker development and validation.

[0027] Table 1. Content of soluble solids in fresh samples of fleshy roots of single carrot plants from 70 natural populations. Example 2: Preliminary determination of the soluble solids content of carrots (1) Extraction of carrot genomic DNA Genomic DNA was extracted from the above 70 representative materials using the CTAB method.

[0028] (2) QTL mapping of soluble solids content gene Genome-wide association analysis was performed on the genotypes of the carrot population and the aforementioned soluble solids content phenotypic data to identify significantly associated genetic loci, thereby locating the QTLs controlling soluble solids content. PLINK was used for association analysis; MapQTL5 was selected for QTL mapping; and ANNOVAR was used for functional annotation of significant SNPs and molecular marker development.

[0029] like Figure 1 As shown in the figure, the horizontal dashed line represents the significance threshold; points above the dashed line indicate statistically significant associations. Points above the threshold represent gene loci significantly associated with the trait. Figure 1 It can be concluded that the soluble solids gene is located on chromosome 5 (between 0.86 and 0.88 Mb). Further analysis revealed that this site is located at the candidate gene β-galactosidase, which regulates soluble solids. Dcβ-GAL )superior.

[0030] To evaluate the rationality of the association analysis model, a quantile-quantile plot (QQ-plot) was further plotted to compare the observed P-value with the expected P-value, as shown below. Figure 2 As shown in the figure, the vast majority of the scatter points are distributed along the diagonal, with only a small deviation at the tail, indicating that the results of this GWAS analysis are less affected by factors such as population structure, the model fits well, and the detected association signals are reliable.

[0031] Example 3: Development and Validation of SNP Molecular Markers 1. Development of SNP molecular markers Based on the major-effect QTL region located in Example 1, all SNP sites within this region were screened. One SNP site (physical location: 869655 bp) located within this region, exhibiting stable polymorphism between high and low solids materials, high linkage disequilibrium, and easy for designing specific primers was selected. Dcβ-GAL The coding region, designated as a candidate molecular marker, is named "SNP_869655," with a base variation of T / C at this site. The sequence containing this SNP site is shown in SEQ ID NO.4.

[0032] SEQ ID NO.4: .

[0033] Based on the SNP marker information of “SNP_869655”, a specific primer combination for fluorescent PCR genotyping was designed. In this embodiment, the specific primer combination consists of three sequences: upstream primer F1, upstream primer F2, and downstream primer R. Upstream primers F1 and F2 contain FAM (underlined portion) and HEX (dashed portion) fluorescent adapters, respectively. Downstream primer R has the same structure as ordinary PCR primers. The upstream primers (upstream primers F1 and F2) consist of three parts: a universal adapter sequence, a common amplification primer sequence, and a genotyping site sequence.

[0034] The specific SNP primer sequences used to amplify "SNP_869655" are shown below: Upstream primer F1: 5'- GAAGGTGACCAAGTTCATGCT GCCCACCTCTCGTGTGCA T-3' (SEQ ID NO.1); Upstream primer F2: 5'- GAAGGTCGGAGTCAACGGATT GCCCACCTCTCGTGTGCA C-3' (SEQ ID NO.2); In the upstream primer, the italicized part is the universal adapter sequence, the underlined part is the ordinary amplification primer sequence, and the bolded T base (for SEQ ID NO.1) and C (for SEQ ID NO.2) at the 3' end are the genotyping sites (sequences).

[0035] Downstream primer R: 5'-CATAGGACTTGTGAGCATGACAAGAT-3' (SEQ ID NO.3).

[0036] The soluble solids content distribution was detected using the “SNP_869655” genotype. The PCR detection system consisted of: 5 μL of 2×PARMS master mix; 0.15 μL of upstream primer F1 (10 μM); 0.15 μL of upstream primer F2 (10 μM); 0.4 μL of downstream primer R (10 μM); 10–100 ng of carrot genomic DNA; and double-distilled water to a final volume of 10 μL. The PCR reaction conditions were: pre-denaturation (94℃, 15 min), denaturation (94℃, 20 s), gradient annealing and extension (65–75℃, 1 min), 10 cycles; denaturation (94℃, 20 s), annealing and extension (57℃, 1 min), 30 cycles. After PCR, the TECAN Infinite M1000 microplate reader reads the fluorescence signal, and then the corresponding software snpdecoder (http: / / www.snpway.com / snpdecoder / ) is used to analyze and convert the fluorescence signal, obtaining a clear and easy-to-understand genotyping map. Based on the different colors, the genotyping results are output. Figure 4 ).

[0037] Depend on Figure 4 It can be seen that when using the "SNP_869655" genotyping to detect the distribution of soluble solids content, when all alleles of "SNP_869655" are T, the test sample will bind to the specific FAM detection primer and release a green fluorescent group. As the number of PCR reaction cycles increases, the green fluorescent signal intensifies, thus the genotype with low soluble solids content in carrot fleshy roots can be identified by the fluorescence color (the SNP marker genotyping result is defined as: FAM). When all alleles at this locus are C, the test sample will bind to the specific HEX detection primer and release a purple fluorescent group. As the number of PCR reaction cycles increases, the purple fluorescent signal is enhanced, thus the genotype with high soluble solids content in carrot fleshy roots can be identified by the fluorescence color (the SNP marker genotyping result is defined as: HEX).

[0038] 2. Validation of SNP molecular markers The fluorescence signal of "SNP_869655" was used to perform SNP genotyping on fresh carrot fleshy root samples from 70 natural populations in Example 1. The genotyping results are shown in Table 1. Table 1 shows that "SNP_869655" categorizes materials with high soluble solids content into HEX and materials with low soluble solids content into FAM. Statistical analysis (box plot analysis) was performed. Figure 3The results showed that the average and median soluble solids content of the material population identified by molecular markers as HEX type (CC genotype) was significantly higher than that of the material population identified as FAM type (TT genotype). Figure 3 The box plots visually show that there are significant differences in the distribution of soluble solids content between the two genotype populations, with low overlap, indicating that "SNP_869655" can effectively distinguish between carrot materials with high and low soluble solids content.

[0039] The above demonstrates that the fluorescence signal of "SNP_869655" used in this invention can effectively group 70 carrot samples from a natural population, and the grouping results can distinguish between high and low soluble solids content. The samples with low soluble solids content are classified into genotype FAM, and the samples with high soluble solids content are classified into genotype HEX, thus indicating that this marker can be used for screening materials with high soluble solids content.

[0040] If other published methods are used to detect "SNP_869655" and determine its SNP status, the same purpose can be achieved.

[0041] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker tightly linked to a major QTL related to the soluble solids content of carrots, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, and a T / C mutation is present at the 221st base of the sequence shown in SEQ ID NO.4; the genotypes at this site include TT, CC and CT.

2. A KASP primer combination for detecting the molecular marker of claim 1, characterized in that, The KASP primer combination includes upstream primer F1 with the nucleotide sequence shown in SEQ ID NO.1, upstream primer F2 with the nucleotide sequence shown in SEQ ID NO.2, and downstream primer R with the nucleotide sequence shown in SEQ ID NO.

3.

3. A kit for detecting the molecular marker of claim 1, characterized in that, It includes the KASP primer combination as described in claim 2.

4. The application of the molecular marker of claim 1, the KASP primer combination of claim 2, or the kit of claim 3, characterized in that, For use in any of the following applications: (1) To determine the soluble solids content of carrots; (2) Screen carrot varieties or strains with high soluble solids content; (3) Marker-assisted breeding of carrots; (4) Improve carrot germplasm resources.

5. The application according to claim 4, characterized in that, When the genotype of the molecular marker mutation site is CC, the soluble solids content of the carrot is high; when the genotype of the molecular marker mutation site is TT, the soluble solids content of the carrot is low.

6. A method for determining the soluble solids content of carrots, characterized in that, Includes the following steps: Using the genomic DNA of the carrot sample to be tested as a template, the template is amplified by real-time PCR using the KASP primer combination described in claim 2 or the kit described in claim 3, and the genotype of the carrot to be tested is determined based on the amplification results. Carrots with the CC genotype have a higher soluble solids content than carrots with the TT genotype.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system consisted of: 5 μL of 2×PARMS master mix; 0.15 μL of 10 μM upstream primer F1; and 0.15 μL of 10 μM upstream primer F2. 0.4 μL of 10 μM downstream primer R; 10-100 ng of template DNA; add double-distilled water to a final volume of 10 μL.

8. The method according to claim 6, characterized in that, The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 20 s; 65-75℃ gradient extension for 60 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 94℃ denaturation for 20 s; 57℃ extension for 60 s, for a total of 30 cycles.

9. A method for breeding carrot germplasm with high soluble solids content, characterized in that, Includes the following steps: Using the genomic DNA of the carrot sample to be tested as a template, the template is amplified by real-time PCR using the KASP primer combination described in claim 2 or the kit described in claim 3, and the genotype of the carrot to be tested is determined based on the amplification results. Carrots with genotype CC have a higher soluble solids content than carrots with genotype TT; germplasm with genotype CC was selected for subsequent breeding and propagation.

10. The method according to claim 9, characterized in that, The PCR amplification reaction system consisted of: 5 μL of 2×PARMS master mix; 0.15 μL of 10 μM upstream primer F1; and 0.15 μL of 10 μM upstream primer F2. 0.4 μL of 10 μM downstream primer R; 10-100 ng of template DNA; add double-distilled water to a final volume of 10 μL; the PCR amplification reaction program is: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 20 s; The temperature gradient was extended at 65-75℃ for 60 seconds, with each cycle decreasing by 0.6℃ for a total of 10 cycles; denaturation was performed at 94℃ for 20 seconds; and extension at 57℃ for 60 seconds for a total of 30 cycles.

Images