Reference substance for fluorescent PCR (Polymerase Chain Reaction) detection as well as preparation method and application of reference substance

The use of phosphate thioester-modified DNA single-stranded fragments solves the problems of stability and amplification efficiency of plasmids in fluorescent PCR detection, provides a simple and stable reference, is suitable for the detection of single-stranded and double-stranded DNA viruses, and achieves efficient quantitative results.

CN121874401APending Publication Date: 2026-04-17SHANGHAI ZJ BIO TECH +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511353096.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-09-12
Filing Date
2025-09-22
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

In existing technologies, plasmids used as reference materials for fluorescent PCR detection suffer from problems such as complex preparation, cumbersome operation, poor stability, easy degradation, and uneven amplification efficiency, leading to inaccurate quantitative results.

Method used

Using phosphate-thiolated DNA single-stranded fragments as a reference, the preparation process is simple, avoiding the complex cell culture and molecular cloning steps of plasmids, and enhancing stability to adapt to the detection of single-stranded and double-stranded DNA viruses. This is achieved by adding at least 6 bases of phosphate-thiolated DNA to both ends of the fragment.

Benefits of technology

It provides a simple and stable reference for fluorescent PCR detection, improves preparation efficiency, enhances fragment stability, avoids differences in amplification efficiency, and is suitable for the detection of single-stranded and double-stranded DNA viruses, ensuring quantitative accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874401A_ABST
    Figure CN121874401A_ABST
Patent Text Reader

Abstract

The invention provides a reference substance for fluorescent PCR (Polymerase Chain Reaction) detection as well as a preparation method and application of the reference substance. The reference substance comprises a thiophosphate modified DNA (Deoxyribonucleic Acid) single-stranded fragment, the DNA single-stranded fragment comprises a target gene sequence region, wherein the length of the target gene sequence region is not more than 130 bp; the modification sections are positioned at the 5'end and the 3 'end of the target gene sequence region, and each modification section comprises at least six basic groups; wherein a phosphoric acid skeleton between basic groups of the modification section is modified by thiophosphate, and a sulfur atom is used for replacing a non-bridging oxygen atom in the DNA phosphoric acid skeleton. The thiophosphate modified single-stranded DNA fragment is used as a reference substance in virus nucleic acid detection, so that the problems of complex preparation process, poor storage stability, non-uniform plasmid components, need of additional cell carriers and the like of plasmids are solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a reference material for fluorescent PCR detection, its preparation method, and its application. Background Technology

[0002] Nucleic acid detection technology plays a crucial role in molecular biology, medical diagnostics, and drug development. Traditional DNA-based nucleic acid detection reagents commonly use plasmids as reference materials. Chinese invention patent CN102251032B describes a complex and cumbersome process for preparing reference materials for DNA STR detection. This involves first preparing recombinant plasmids containing STR loci, then introducing the plasmids into cells, sequencing to select clones containing the correct fragments, mass propagating the plasmids, extracting them, and repeating the same steps to prepare each locus before mixing them to obtain the detection reference material. This process is intricate and requires complex cell culture and molecular cloning steps, resulting in a long preparation cycle. Chinese invention patent application CN108977586A uses artificially synthesized plasmids as internal quantitative references, enabling accurate quantification of hepatitis B virus nucleic acid in samples without the need for a standard curve.

[0003] However, during plasmid preparation, three conformations can occur: supercoiled, circular, and linear. These conformations vary in their ease of participation in the PCR reaction, with the order from easiest to most difficult being linear > circular > supercoiled. This leads to differences in amplification efficiency. Furthermore, temperature changes during plasmid storage can alter the proportions of different conformations, resulting in deviations in quantitative results. In addition, Chinese invention patent CN102363814B uses enzyme digestion to homogenize plasmids of different conformations into double-stranded linear plasmids, which are then used as a standard curve for quantification, improving the accuracy of absolute quantitative PCR. However, linearized plasmids have exposed ends, making them susceptible to degradation by exonucleases and leading to decreased stability. Therefore, using plasmids as a quantitative reference suffers from poor homogeneity, resulting in inaccurate quantification; while using linearized plasmids presents problems with poor stability and susceptibility to degradation. Summary of the Invention

[0004] To address the technical problems in the prior art, this invention provides a reference material for fluorescence PCR detection, its preparation method, and its application.

[0005] The first aspect of this invention provides a reference for fluorescence PCR detection, said reference comprising a phosphate-thioester-modified single-stranded DNA fragment (e.g. Figure 2 (as shown) The single-stranded DNA fragment comprises: A target gene sequence region, the length of which shall not exceed 130bp; Modification segments located at the 5' and 3' ends of the target gene sequence region, each of the modification segments comprising at least 6 bases; The phosphate backbone between the bases in the modified region is modified with phosphate thioester, replacing the non-bridging oxygen atoms in the DNA phosphate backbone with sulfur atoms (e.g., ...). Figure 1 (As shown).

[0006] In one embodiment of the present invention, the number of thiophosphate modification sites in the modified segment is 5 to 15.

[0007] A second aspect of the present invention provides the application of the above-mentioned reference material for fluorescent PCR detection in DNA virus detection.

[0008] In one embodiment of the present invention, when the reference material is used for single-stranded DNA virus detection, the reference material is a single-stranded DNA fragment modified with a single thiophosphate as described in any one of claims 1-2.

[0009] In one embodiment of the present invention, when the reference material is used for double-stranded DNA virus detection, the reference material further includes a complementary strand; the complementary strand comprises: A target gene sequence region, the length of which shall not exceed 130bp; The modified segments located at the 5' and 3' ends of the target gene sequence region, each of the modified segments comprising at least 6 bases; wherein the phosphate backbone between the bases of the modified segments is modified by thiophosphate ester; The complementary strand is used in combination with the single-stranded DNA fragment as described in any one of claims 1-2.

[0010] A third aspect of the present invention provides a method for preparing the above-mentioned reference material for fluorescent PCR detection, characterized by comprising the following steps: To meet the nucleic acid detection requirements of the target virus, a target gene sequence with a length not exceeding 130bp is selected; Design a DNA sequence by adding at least 6 bases to both the 5' and 3' ends of the target gene sequence; The phosphate backbone between the added bases is specified to be modified by thiophosphate ester; Single-stranded DNA fragments modified with phosphate thioester were synthesized using DNA synthesis technology; Once the synthesized single-stranded DNA fragments are quantified and valued, they can be used as references.

[0011] In one embodiment of the present invention, when the target virus is a single-stranded DNA virus, a single DNA single-stranded fragment modified with thiophosphate is directly used as a reference material. When the target virus is a double-stranded DNA virus, a complementary strand of the single-stranded DNA fragment is designed and synthesized. The complementary strand is also modified with at least 6 bases added to the 5' end and 3' end and modified with thiophosphate. The mixture of the single-stranded DNA fragment and the complementary strand is used as a reference material.

[0012] In one embodiment of the present invention, the determination step is verified by fluorescent PCR detection.

[0013] Compared with the prior art, the embodiments of the present invention have the following beneficial effects: This invention provides a method for preparing a reference for fluorescence PCR detection. The preparation process is simple and convenient, requiring no complex cell culture and molecular cloning steps, which greatly reduces the difficulty, cost and preparation time.

[0014] The reference material for fluorescence PCR detection provided in this invention has good stability. By modifying the end-terminal segments (each ≥6 bases) with thiophosphate (replacing the non-bridging oxygen atoms of the phosphate backbone with sulfur atoms), it effectively resists nuclease degradation and improves the stability of nucleotide fragments in the in vitro environment.

[0015] This invention provides a method for preparing a reference for fluorescence PCR detection. The synthesized fragment has high purity and is a single homogeneous fragment with a single homogeneous structure. This avoids the differences in amplification efficiency caused by the coexistence of supercoiled / open-circular / linear conformations of the plasmid, and solves the problem of differences in detection Ct values ​​caused by different plasmid conformations.

[0016] This invention provides a reference for fluorescence PCR detection. By switching between single-stranded (single modified fragment) and double-stranded (modified fragment + complementary strand mixture) modes, it is adapted to the detection of single-stranded DNA viruses and double-stranded DNA viruses, solving the problem that plasmids cannot accurately simulate the amplification behavior of single-stranded viruses.

[0017] This invention provides a reference for fluorescence PCR detection. The synthesized fragment has a single homogeneous structure, avoiding differences in amplification efficiency caused by the coexistence of supercoiled / open-circular / linear conformations of the plasmid.

[0018] This invention provides a reference for fluorescent PCR detection, limiting the number of modification sites to 5-15. Within this range, stability can be maintained without affecting amplification efficiency, avoiding the risk of PCR inhibition caused by excessive modification. Attached Figure Description

[0019] Figure 1 A schematic diagram illustrating the principle of thiophosphate modification provided in this embodiment of the invention; Figure 2 A schematic diagram of a thiophosphate modified fragment is provided for an embodiment of the present invention; Figure 3 The amplification peak shape of the plasmid and phosphate thioester modified fragment in Example 1 of this invention; Figure 4 Stability trend diagram of plasmid preservation in Example 1 of this invention; Figure 5 Stability trend of the thiophosphate modified fragment in Example 1 of this invention; Figure 6 Stability trend diagram of the phosphate-thioester-free fragment preserved in the embodiments of the present invention; Figure 7 The amplification peak shapes of different numbers of thiophosphate modification sites in Example 2 of this invention. Detailed Implementation

[0020] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several changes and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0021] The embodiments of the present invention will be described in detail below through specific examples.

[0022] The instruments and equipment used in the embodiments of this invention mainly include: SLAN fluorescence quantitative PCR detector, vortex mixer, etc.

[0023] The reagents and materials used in the embodiments of this invention are as follows: The 2×TaqMan qPCR mix was purchased from the finished kit Hieff Unicon® Universal TaqMan multiplex qPCR master mix, catalog number 11211ES03.

[0024] Example 1 This embodiment provides the preparation and detection of a reference substance for Trichomonas fetus. 1. Sequence design and synthesis A conserved target sequence from *Trichomonas fetus*, 77 bp in length, was selected. Six bases were added to both the 5' and 3' ends to prevent self-complementation and the formation of secondary structures. The bases were modified with phosphate thioester. The sequence was sent to Shanghai Sangon Biotech for the synthesis of two complementary phosphate thioester-modified DNA strands and two complementary unmodified DNA strands, each synthesized at 2 OD. Both strands were purified by HPLC, and the manufacturer must provide a DNA mass spectrometry report. The purity standard is a molecular weight error ≤0.05%. Simultaneously, the sequence was sent to Shanghai Jierui Biotechnology for plasmid synthesis; the manufacturer must provide the sequencing results and peak shape of the plasmid.

[0025] The sequence of the thiophosphate modified fragment is shown below, with the thiophosphate modification occurring between the first and last 6 bases.

[0026] Positive chain (SEQ ID NO.1): A*T*C*T*G*AGACGAACAAATCCTCAACATCCAAGCCCGTAACCCG ACCGATTTCAACAAATGGATTCCAAACAATGTGAAGTCCTCA*T*C*T*G*A Negative chain (SEQ ID NO.2): T*C*A*G*A*TGAGGACTTCACATTGTTTGGAATCCATTTGTTGAAATC GGTCGGGTTACGGGCTTGGATGTTGAGGATTTGTTCGTCT*C*A*G*A*T * indicates thiophosphate modification.

[0027] 2. Verification of the fixed value of the synthesized fragment After the thiophosphate-modified and unmodified fragments arrived, according to the information on the synthesis report, the fragments were dissolved in water to prepare a 20 μM solution, and equal volumes of two complementary fragments were mixed and diluted at least 10 μL. 7 After multiplying, a PCR mixture is prepared and tested to determine the concentration of the fragment.

[0028] After the plasmid arrives, dissolve the plasmid powder in 40 μL of water, then dilute it by 10 μL. 4 After multiplying, a PCR mixture was prepared and tested to determine the plasmid concentration.

[0029] After the concentrations of the fragments and plasmids were determined, they were diluted to a Ct value of approximately 19 for later use in subsequent tests.

[0030] The PCR amplification program was as follows: 37℃×2min; 95℃×90sec; 95℃×5sec, 60℃×30sec, for 45 cycles. Fluorescence detection was performed at 60℃.

[0031] 3. Fragment amplification efficiency Compare the differences in amplification efficiency between single-stranded and double-stranded fragments modified with thiophosphate and plasmids with the corresponding identical sequences.

[0032] The prepared mixture was dispensed into PCR tubes. The phosphate thioester modified fragment and plasmid were diluted 4 times at a 10-fold gradient. 5 μL of each concentration was added to the mixture, and the total reaction volume was 25 μL.

[0033] The results showed that there was no significant difference in the Ct values ​​between the two groups, and the peak shapes were as follows: Figure 3 The red peaks represent the amplification peaks of the single-stranded fragments modified with thiophosphate, the green peaks represent the amplification peaks of the double-stranded fragments modified with thiophosphate, and the blue peaks represent the amplification peaks of the corresponding plasmids. The specific Ct values ​​are shown in Table 3.

[0034] The above experiments show that thiophosphate modification does not affect amplification efficiency, which remains within the range of 95%-105%. Furthermore, there is no significant difference in amplification efficiency when using a single thiophosphate-modified fragment and two complementary thiophosphate-modified fragments as templates.

[0035] 4. Stability test of modified fragments Experimental method: Modified fragments (single-stranded), unmodified fragments (single-stranded), and plasmids were aliquoted into independent tubes and stored in constant temperature test chambers at -20℃, 4℃, 25℃, 37℃, and 40℃, respectively. One tube was taken out for testing at specified time points, and a trend graph was plotted based on the detected Ct values. The Ct value of the first test was used as the baseline, and ±0.5Ct was considered the normal fluctuation range. The plasmid stability results showed that when the plasmid was stored at five different temperatures, the higher the storage temperature and the longer the storage time, the gradually decreasing Ct value; conversely, the lower the storage temperature, the gradually increasing Ct value. Figure 4 As shown, this is because the extracted plasmid itself is composed of three conformations. As the storage temperature changes, the different conformations transform into each other, ultimately leading to differences in the detected Ct values.

[0036] The stability results of the thiophosphate modified fragment showed that after 89 days at 5 temperatures, the detected Ct value was still within the quality control range, and its detection stability was better than that of the plasmid.

[0037] Stability results for the unmodified phosphate thioester fragment showed that it exceeded the quality control range after 28 days at 37°C and after 15 days at 45°C. Figure 6 As shown, it is stable at 25℃, but shows a significant deterioration trend at 37℃ and 45℃.

[0038] Example 2 This embodiment provides the preparation and detection of a reference for hepatitis B virus DNA. 1. Sequence design and synthesis A conserved sequence of hepatitis B virus nucleic acid was selected as the target sequence, with a length of 106 bp. Six bases and 16 bases were added to the 5' and 3' ends, respectively, to prevent self-complementation and the formation of secondary structures. The bases were modified with phosphate thioester, resulting in 5 and 15 phosphate thioester modification sites, respectively. Both sequences were sent to Shanghai Sangon Biotech for the synthesis of two complementary DNA strands, each with a molecular weight of 2 OD. Both strands were purified by HPLC, and the manufacturer was required to provide a DNA mass spectrometry report. The purity standard was a molecular weight error ≤0.05%.

[0039] Sequence of HBV fragment 1.1 (SEQ ID NO.3): A*T*C*T*G*ATTCCTGCTGGTGGCTCCAGTTCCGGGACAGTGAACCCTGTTCCGACTACTGTCTCACTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCACCGAACATGGAA*T*C*T*G*A Sequence of HBV fragment 1.2 (SEQ ID NO.4): T*C*A*G*A*TTCCATGTTCGGTGCAGGGTCCCCAATCCTCGAGAAGATTGACGAGATGAGTGAGACAGTAGTCGGAACAGGGTTCACTGTCCCGGAACTGGAGCCACCAGCAGGAAT*C*A*G*A*T The sequence of HBV fragment 2.1 (SEQ ID NO.5): A*T*C*T*G*A*A*G*T*C*C*T*C*G*C*TTTCCTGCTGGTGGCTCCAGTTCCGGGACAGTGAACCCTGTTCCGACTACTGTCTCACTCATCTCGTCAATCTTCTCGAGGATTGGGGACCCTGCACCGAACATGGAA*T*C*T*G*A*A*G*T*C*C*T*C*G*C*T The sequence of HBV fragment 2.1 (SEQ ID NO.6): A*G*C*G*A*G*G*A*C*T*T*C*A*G*A*TTCCATGTTCGGTGCAGGGTCCCCAATCCTCGAGAAGATTGACGAGATGAGTGAGACAGTAGTCGGAACAGGGTTCACTGTCCCGGAACTGGAGCCACCAGCAGGAAA*G*C*G*A*G*G*A*C*T*T*C*A*G*A*T 2. Verification of the fixed value of the synthesized fragment The dry powders of HBV fragment 1.1 and HBV fragment 1.2 were dissolved in water to form a 20 μM solution according to the information on the synthesis report. The two complementary fragments were then mixed in equal volumes and labeled as HBV fragment 1. This mixture was then diluted at least 10 μL. 7 After multiplying, a PCR mixture was prepared and tested to determine the concentration of HBV fragment 1.

[0040] The dry powders of HBV fragment 2.1 and HBV fragment 2.2 were processed using the same method described above, and the concentration of HBV fragment 2 was finally determined by PCR detection.

[0041] After determining the concentrations of HBV fragment 1 and HBV fragment 2, they are diluted to the same Ct value for subsequent testing.

[0042] The PCR amplification program was as follows: 37℃×2min; 94℃×2min; 95℃×5sec, 60℃×30sec, for 45 cycles. Fluorescence detection was performed at 60℃.

[0043] 3. Fragment amplification efficiency To compare whether the number of thiophosphate modification sites affects amplification efficiency.

[0044] Aliquot the prepared mixture into PCR tubes, then dilute HBV fragment 1 and HBV fragment 2 into four 10-fold gradients, adding 5 μL of each concentration to the mixture, for a total reaction volume of 25 μL.

[0045] The detected peak shape is as follows Figure 7 As shown, green represents HBV fragment 1 and red represents HBV fragment 2. The specific detection Ct values ​​are shown in Table 9.

[0046] The amplification efficiencies were calculated to be between 95% and 105%, with no significant difference between the two. The results indicate that increasing the number of thiophosphate modification sites from 5 to 15 does not affect the amplification efficiency.

[0047] Specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Unless otherwise specified, the embodiments and features described in this application can be arbitrarily combined with each other.

Claims

1. A reference material for fluorescent PCR detection, characterized in that, The references include single-stranded DNA fragments modified with phosphate thioesters; The phosphate-thioester modified DNA single-stranded fragment comprises: A target gene sequence region, the length of which shall not exceed 130bp; Modification segments located at the 5' and 3' ends of the target gene sequence region, each of the modification segments comprising at least 6 bases; In this modified segment, the phosphate backbone between the bases is modified with thiophosphate ester, replacing the non-bridging oxygen atoms in the DNA phosphate backbone with sulfur atoms.

2. The reference material for fluorescent PCR detection according to claim 1, characterized in that, The number of thiophosphate modification sites in the modified segment is 5 to 15.

3. The application of the reference material for fluorescent PCR detection as described in claim 1 in DNA virus detection.

4. The application of the reference material for fluorescent PCR detection according to claim 3 in DNA virus detection, characterized in that, When the reference material is used for single-stranded DNA virus detection, the reference material is a single-stranded DNA fragment modified with a single thiophosphate as described in any one of claims 1-2.

5. The application of the reference material for fluorescent PCR detection according to claim 3 in DNA virus detection, characterized in that, When the reference material is used for double-stranded DNA virus detection, the reference material further includes a complementary strand; the complementary strand comprises: A target gene sequence region, the length of which shall not exceed 130bp; The modified segments located at the 5' and 3' ends of the target gene sequence region, each of the modified segments comprising at least 6 bases; wherein the phosphate backbone between the bases of the modified segments is modified by thiophosphate ester; The complementary strand is used in combination with the single-stranded DNA fragment as described in any one of claims 1-2.

6. The method for preparing a reference for fluorescent PCR detection according to any one of claims 1-2, characterized in that, Includes the following steps: To meet the nucleic acid detection requirements of the target virus, a target gene sequence with a length not exceeding 130bp is selected; Design a DNA sequence by adding at least 6 bases to both the 5' and 3' ends of the target gene sequence; The phosphate backbone between the added bases is specified to be modified by thiophosphate ester; Single-stranded DNA fragments modified with phosphate thioester were synthesized using DNA synthesis technology; Once the synthesized single-stranded DNA fragments are quantified and valued, they can be used as references.

7. The preparation method according to claim 6, characterized in that, When the target virus is a single-stranded DNA virus, a single DNA single-stranded fragment modified with thiophosphate is used directly as a reference material. When the target virus is a double-stranded DNA virus, a complementary strand of the single-stranded DNA fragment is designed and synthesized. The complementary strand is also modified with at least 6 bases added to the 5' end and 3' end and modified with thiophosphate. The mixture of the single-stranded DNA fragment and the complementary strand is used as a reference material.

8. The preparation method according to claim 6, characterized in that, The determination step was verified by fluorescent PCR detection.

Citation Information

Patent Citations

  • Preparation method of reference material (RM) for detecting human DNA (deoxyribonucleic acid) STR (short tandem repeat)

    CN102251032B

  • Absolute quantification polymerase chain reaction (PCR) detection method

    CN102363814B

  • Quantitative detection kit for hepatitis B virus nucleic acid

    CN108977586A