Wheat shock transcription factor gene TaHsfA2e and application thereof in improving heat resistance of wheat

Abstract

The invention discloses a wheat heat shock transcription factor gene TaHsfA2e and application thereof in improvement of wheat heat resistance, the gene TaHsfA2e is located in a 5A chromosome and is separated and cloned from a wheat field, and the sequence of a coding region of the gene TaHsfA2e is shown as SEQ ID NO.2. The invention further discloses a gene TaHsfA2e for wheat heat shock transcription factor gene TaHsfA2e for wheat heat shock transcription factor gene TaHsfA2e. The gene engineering technology is utilized, the expression of the TaHsfA2e gene is enhanced, the TaHsfA2e responds to high-temperature stress and is highly expressed, and downstream related stress-resistant gene expression is further activated, so that the heat resistance of wheat is remarkably improved. The invention has important significance on plant heat resistance research and breeding of high-temperature-resistant wheat.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and genetic engineering technology, and relates to the wheat heat shock transcription factor gene TaHsfA2e and its application in improving wheat heat resistance. Background Technology

[0002] Global research indicates that for every 1°C increase in temperature, average wheat yield decreases by approximately 5.7%. In the Huang-Huai wheat-growing region of my country, extreme high temperatures can lead to yield reductions of 6%–20%; several hot wind events (combined stress of high temperature, low humidity, and strong winds) occurring during the grain-filling stage can cause a 10%–30% decrease in the thousand-grain weight of wheat, with severe cases resulting in yield reductions exceeding 20%. For example, in 2023, the Huang-Huai-Hai wheat-growing region experienced yield losses of up to 50% in some areas due to hot and dry winds combined with prior drought.

[0003] Heat shock transcription factors (Hsfs) are core regulatory elements in plant responses to high-temperature stress. They construct a multi-layered heat resistance defense network by cascading the activation of heat shock proteins (HSPs), antioxidant enzymes, and genes related to metabolic pathways. The wheat genome (IWGSC RefSeq v2.1) contains 82 Hsf members with complex functional divisions: the HsfA2 subfamily (such as TaHsfA2a / b / d / e) possesses a typical acidic activation domain (AHA motif), which can directly bind to heat shock elements (HSE, 5′-nGAAnnTTCn-3′) in the promoters of target genes such as HSP70 / 90 and APX2, inducing their expression levels to increase by 10–100 times. Overexpression of TaHsfA2d significantly enhances wheat heat resistance, increasing plant survival rate by 40% and reducing thousand-grain weight loss by 15% at 42℃ (Zhang et al., 2023); TaHsfA2e activates SOD (superoxide dismutase) gene expression, reducing reactive oxygen species accumulation by 50%. On the other hand, HsfB1, as a transcriptional repressor, negatively regulates HsfA2 activity to avoid excessive energy consumption; HsfC1 alleviates the source-sink imbalance caused by high temperature by regulating the expression of the sugar transporter TaSUT1 (Li et al., 2024).

[0004] However, as a polyploid species, wheat contains a large number of paralogous genes in its genome, and the specific functions of each copy in terms of expression patterns, subcellular localization, and heat tolerance have not yet been systematically elucidated. Furthermore, the interaction mechanisms between Hsfs and epigenetic modifications (such as histone acetyltransferase TaHAC1) and hormonal signaling (such as the ABA / SA pathway) remain unclear. Notably, constitutive overexpression of certain Hsfs (such as TaHsfA2b) may lead to plant dwarfing or biomass reduction (e.g., a 20% decrease in tiller number), indicating a current lack of reproductive-stage-specific expression regulation strategies. Therefore, systematically discovering and identifying heat tolerance genes with breeding potential is of great significance for advancing the genetic improvement of wheat heat tolerance. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide the wheat heat shock transcription factor gene TaHsfA2e and its application in improving wheat heat resistance.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] 1. The coding region sequence of the wheat heat shock transcription factor gene TaHsfA2e is shown in SEQ ID NO.2.

[0008] Preferably, the nucleotide sequence of the wheat heat shock transcription factor gene TaHsfA2e is shown in SEQ ID NO.1.

[0009] 2. The protein TaHsfA2e encoded by the wheat heat shock transcription factor gene TaHsfA2e has the amino acid sequence shown in SEQ ID NO.3.

[0010] 3. Overexpression vectors containing the aforementioned gene TaHsfA2e.

[0011] 4. The application of increasing the expression level of the aforementioned wheat heat shock transcription factor gene TaHsfA2e or overexpressing the aforementioned protein TaHsfA2e in improving wheat heat resistance.

[0012] 5. The application of increasing the expression level of the aforementioned wheat heat shock transcription factor gene TaHsfA2e or overexpressing the aforementioned protein TaHsfA2e in the breeding of heat-resistant wheat.

[0013] 6. Application of the aforementioned overexpression vectors in improving the heat resistance of wheat.

[0014] 7. Application of the aforementioned overexpression vectors in heat-resistant wheat breeding.

[0015] 8. A breeding method for heat-resistant wheat that promotes the expression of protein TaHsfA2e in wheat or increases the expression level of gene TaHsfA2e.

[0016] Preferably, the specific steps are as follows: construct a recombinant vector containing the aforementioned gene TaHsfA2e sgRNA, introduce it into the recipient plant, and obtain transgenic plants with improved heat resistance through induction, subculture, pre-culture, co-culture, resistance screening, differentiation, rooting culture, seedling hardening, and transplanting.

[0017] More preferably, the recipient plant is wheat Fielder.

[0018] A further preferred method for constructing the recombinant vector is as follows:

[0019] S1. PCR amplification was performed using the following primers:

[0020] pWMB110-TaHsfA2e-F:

[0021] 5′- AGGTCGACTCTAGAGGATCC ATGAGCCACCGGATGATGAT - 3′, pWMB110-TaHsfA2e-R:

[0022] 5′- AGCTCGGTACCCGGGGATCC CTAGTCCAGCTTCTCAGCCA - 3′,

[0023] The PCR products were obtained for subsequent ligation.

[0024] S2. The pWMB110 vector was digested with the restriction endonuclease BamHI, and the vector digestion product and PCR product were subjected to a ligation reaction at 50℃ for 30 min to obtain the final product.

[0025] The beneficial effects of this invention are as follows:

[0026] This invention provides the wheat heat shock transcription factor gene TaHsfA2e and its application in improving wheat heat resistance. The gene TaHsfA2e is located on chromosome 5A, isolated and cloned from wheat fielder, and its coding region sequence is shown in SEQ ID NO.2. The amino acid sequence of the encoded protein TaHsfA2e is shown in SEQ ID NO.3, which contains a 1041 bp open reading frame (ORF) encoding 347 amino acids.

[0027] After obtaining the full-length functional gene TaHsfA2e, this invention utilizes genetic engineering technology to enhance the expression of the TaHsfA2e gene. TaHsfA2e is highly expressed in response to high-temperature stress and further activates the expression of downstream related stress-resistance genes, thereby significantly improving the heat tolerance of wheat. This invention is of great significance for plant heat tolerance research and the breeding of heat-resistant wheat. Attached Figure Description

[0028] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0029] Figure 1 This is a graph showing the relative expression levels of TaHsfA2e in wheat leaves induced by high temperature (42℃).

[0030] Figure 2 A schematic diagram of the editing type for TaHsfA2e knockout transgenic plants.

[0031] Figure 3 Phenotypic photographs of heat-treated TaHsfA2e knockout transgenic plants. From left to right: control wheat Fielder, TaHsfA2e knockout lines KO-1 and KO-2.

[0032] Figure 4 The table shows the survival rate statistics for the knockout heat-treated group. The vertical axis represents the survival rate. **** represents p ≤ 0.0001.

[0033] Figure 5 Phenotypic images of TaHsfA2e overexpressing plants in the heat-treated group. From left to right: control wheat Fielder, TaHsfA2e overexpressing lines OE-1 and OE-2.

[0034] Figure 6 The above shows the survival rate statistics for the overexpression treatment group. The vertical axis represents the survival rate. **** represents p ≤ 0.0001. Detailed Implementation

[0035] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores. Unless otherwise specified, the quantitative experiments in the following examples were all performed in triplicate, and the results were averaged.

[0037] Example 1 Cloning of the TaHsfA2e gene

[0038] Analysis of wheat heat stress transcriptome data revealed that the transcription level of the wheat TaHsfA2e gene increased after heat stress at 42℃ compared to 22℃, indicating that the gene was induced to express under heat stress.

[0039] Total RNA was extracted from the leaves of the wheat variety Fielder using TRIzol reagent (Thermo Fisher Scientific, procedure as per instructions). The quality and concentration of RNA were measured to obtain RNA that met the experimental requirements. First-strand cDNA was synthesized using the extracted RNA as a template, following the instructions, using reagents from the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd.).

[0040] Primer pairs designed for amplifying the wheat heat shock transcription factor gene TaHsfA2e include a forward primer and a reverse primer. The forward primer sequence is shown in SEQ ID NO.4, and the reverse primer sequence is shown in SEQ ID NO.5.

[0041] Using Takara's high-fidelity enzyme Tks, PCR amplification was performed using the forward primer SEQ ID NO.4 and the reverse primer SEQ ID NO.5. The amplification program was as follows: 94℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 30 s, 35 cycles; 68℃ extension for 7 min. The amplified products were separated by agarose gel electrophoresis, and a clear band was observed at approximately 1000 bp. The PCR products were sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared with the sequences. The PCR products with correct sequencing were retained for the next step of vector construction.

[0042] Example 2 TaHsfA2e gene expression analysis

[0043] Wheat seedlings that had grown for 10 days were subjected to heat stress treatment in a 42℃ incubator. Samples were taken at six time points: 0, 3, 6, 10, 13, and 24 hours after the heat treatment. Leaves of uniform growth and from the same location were cut and immediately placed in liquid nitrogen after removal from the incubator. RNA was extracted and reverse transcribed into cDNA, which was then stored at -20℃ for later use.

[0044] Based on the gene sequence characteristics of wheat TaHsfA2e, RT-qPCR primers were designed and synthesized by Beijing Xianghong Biotechnology Co., Ltd. The internal reference gene was TaActin, with the sequences Q-Actin-F: GACCGTATGAGCAAGGAGAT and Q-Actin-R: CAATCGCTGGACCTGACTC. The RT-qPCR results are shown below. Figure 1 As shown, the TaHsfA2e gene was expressed in leaves in response to high temperature stress. The expression level gradually increased from 0 to 13 h after heat treatment, reached a peak after 10 to 13 h, and gradually decreased from 13 to 24 h after heat treatment, indicating that the gene plays an important role in the high temperature signal transduction pathway.

[0045] Example 3: Obtaining TaHsfA2e knockout transgenic wheat

[0046] 1. Based on the TaHsfA2e gene sequence, synthesize sgRNA primers: TaHsfA2e-p414F, TaHsfA2e-p414F0, TaHsfA2e-p414R0, and TaHsfA2e-p414R. The 3′ ends of TaHsfA2e-p414F0 and TaHsfA2e-p414R0 can bind to the intermediate vector pCBC-MT1T2, and the 5′ ends contain the target sequence. The 3′ ends of TaHsfA2e-p414F and TaHsfA2e-p414R contain the target sequence, and the 5′ ends contain a BsaI restriction site. Mix the four primers and use the plasmid of the intermediate vector pCBC-MT1T2 (vector source and sequence reference: https: / / www.addgene.org / 50593 / ) as a template to amplify fragments containing BsaI restriction sites and target sequences at both ends. The sgRNA primer pair for the TaHsfA2e gene is as follows:

[0047] TaHsfA2e-p414F0:

[0048] 5′-GTTGAGCTGTCGGACGAAGCGTTTTAGAGCTAGAAATAGC- 3′;

[0049] TaHsfA2e-p414R0:

[0050] 5′-TCGTCTCCTGGACCGCCACCGCTTCTTGGTGCC- 3′;

[0051] TaHsfA2e-p414F:

[0052] 5′-AATAATGGTCTCAAGCGTTGAGCTGTCGGACGAAGCGTT- 3′;

[0053] TaHsfA2e-p414R:

[0054] 5′-ATTATTGGTCTCTAAACTCGTCTCCTGGACCGCCACC- 3′.

[0055] 2. Perform enzyme digestion and ligation of PCR products: The fragment is cloned into the expression vector pBUE411 through the BsaI restriction site to form the vector PUbi414-TaHsfA2e-1 containing two target sites, which is the enzyme digestion and ligation product.

[0056] The vector pBUE411 is described in the following literature: Xing, HL, Dong, L., Wang, ZP, Zhang, HY, Han, C.Y., Liu, B., Wang, X.C., & Chen, Q.J. (2014). A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC plant biology, 14, 327. https: / / doi.org / 10.1186 / s12870-014-0327-y.

[0057] The reaction system was 15µL: PCR product from step 1 2µL, pBUE411 2µL, 10×NEBT4 Buffer 1.5µL, CutSmart Buffer 1.5µL, BsaI 1µL, T4 DNA Ligase 1µL, and ddH2O 6µL.

[0058] Reaction conditions: 37℃ for 5 h, 50℃ for 5 min, 80℃ for 10 min, followed by cooling on ice. The 10× NEBT4 Buffer, CutSmart Buffer, BsaI, and T4 DNA Ligase used were all products of NEW ENGLANDBioLabs.

[0059] 3. The enzyme digestion and ligation products obtained above were transformed into E. coli. The competent transformation steps were performed according to the product instructions of Mach1-T1 Chemically Competent Cell (Shanghai Weidi Biotechnology Co., Ltd.). Finally, the cells were evenly spread on LB plates with Kana resistance (final concentration of Kana antibiotic was 0.1 mM) (LB medium was a product of Beijing Coollab Technology Co., Ltd.) and incubated upside down at 37 ℃ for about 12-16 h. The cells were identified by colony PCR using detection primers 414-F (5'-TTTCCCAGTCACGACGTTGT-3') and 414-R (5'-ATCTCTAGAGAGGGGCACGA-3'). Positive clones were screened for sequencing, and the plasmids of the correctly sequenced positive clones were extracted. The recombinant plasmids were then transformed into Agrobacterium tumefaciens EHA105.

[0060] The term "recombinant plasmid" usually refers to a recombinant DNA molecule constructed by ligating a foreign target gene to a vector in vitro. It can be constructed in any suitable way, as long as the constructed recombinant plasmid can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.

[0061] The recombinant Agrobacterium was used to infect embryogenic callus of wheat Fielder, followed by differentiation culture, rooting culture, and herbicide resistance screening (screening concentration 250 mg / L) to obtain T0 generation regenerated plants. Plant DNA was extracted using the CTAB method, and the target sites were sequenced using primers HSF-CR-AF / R, HSF-CR-BF / R, and HSF-CR-DF / R to identify positive knockout lines. The sequencing primer sequences are as follows:

[0062] HSF-CR-AF: 5′-CCATCTCCGGTGCCAGAA- 3′

[0063] HSF-CR-AR: 5′-TCGTCAGGACTGTGTGAACA-3′

[0064] HSF-CR-BF: 5′-GATGATGATGAGTCCGGTGAAG- 3′

[0065] HSF-CR-BR: 5′-GCCACTCCTTGTAAAACTAGAGC-3′

[0066] HSF-CR-DF: 5′-CATCAACTCAACTGGTGGCG-3′

[0067] HSF-CR-DR: 5′-TCCCCTGCCATACTTTGTGA- 3′

[0068] 4. After harvesting the positive single plants, the plants were multiplied in a greenhouse, and PCR sequencing was used to identify the positive results of the T1 generation plants. Further edited T1 generation plants were selected for planting and identification, resulting in two TaHsfA2e knockout T2 generation homozygous lines, namely KO-1 and KO-2. Their edit types are as follows: Figure 2 As shown, compared with the wild type (WT), both KO-1 and KO-2 had a 1 bp (A) insertion mutation in the A subgenome, both KO-1 and KO-2 had a 1 bp (T) insertion mutation in the B subgenome, KO-1 had a 1 bp deletion mutation in the D subgenome, and KO-2 had a 4 bp deletion mutation in the D subgenome. T2 generation plants were self-crossed to obtain T3 generation seeds for further phenotypic validation experiments.

[0069] Example 4: Obtaining TaHsfA2e overexpression transgenic wheat

[0070] Using the correctly sequenced PCR product obtained in Example 1 as a template, PCR amplification was performed using the following primers (where the underlined sequences are vector adapter sequences):

[0071] pWMB110-TaHsfA2e-F:

[0072] 5′- AGGTCGACTCTAGAGGATCC ATGAGCCACCGGATGATGAT - 3′, pWMB110-TaHsfA2e-R:

[0073] 5′- AGCTCGGTACCCGGGGATCC CTAGTCCAGCTTCTCAGCCA - 3′,

[0074] The specific reaction procedure is as follows: pre-denaturation at 94°C for 5 min; 98°C for 10 s, 58°C for 15 s, 68°C for 1 min, 35 cycles; extension at 68°C for 7 min to obtain PCR products for subsequent ligation; digestion of the pWMB110 vector with restriction endonuclease BamHI (NEB), and ligation reaction of the vector digestion product and PCR product at a constant temperature of 50°C for 30 min to obtain recombinant plasmid.

[0075] Sequencing of the recombinant plasmid confirmed that the primers were universal primers for the pWMB110 vector.

[0076] pubi-F: TAGCCCTGCCTCATACGCT;

[0077] NOS-R: AAGACCGGCAACAGGATTCA;

[0078] A positive recombinant plasmid pWMB110-TaHsfA2e containing the TaHsfA2e gene was obtained. The recombinant vector plasmid pWMB110-TaHsfA2e contains the CDS sequence of the TaHsfA2e gene shown in SEQ ID NO.2 and can express the TaHsfA2e protein shown in SEQ ID NO.3.

[0079] The vector pWMB110 is described in the following literature: Wang, K., Shi, L., Liang, X. et al. The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat. Plants 8, 110-117 (2022).

[0080] https: / / doi.org / 10.1038 / s41477-021-01085-8.

[0081] The identified positive lines were further screened for T0 generation plants using RT-qPCR to detect the relative gene expression levels, resulting in several overexpression positive lines. These lines were then used to generate T1 generation seeds in a greenhouse. Simultaneously, positive lines were screened for T1 generation seedlings using PCR electrophoresis and RT-qPCR expression level detection. T2 generation seeds were obtained by self-pollination of the T1 generation positive lines. Two positive lines (OE-1 and OE-2) were selected for the next step of phenotypic verification experiments.

[0082] Example 5: Identification of the heat tolerance phenotype of TaHsfA2e knockout and overexpression transgenic wheat

[0083] 1. Experimental protocol for heat treatment of TaHsfA2e transgenic wheat

[0084] Seeds of wheat TaHsfA2e transgenic KO-1, KO-2, OE-1, and OE-2, as well as wild-type Fielder, were selected and disinfected with 50 ml of 1% hydrogen peroxide for 10 min. They were then washed 3-4 times with distilled water. The seeds were neatly arranged in petri dishes with the ventral groove facing down (with two layers of filter paper and a small amount of distilled water added). After being placed at 4°C in the dark for 2 days, they were cultured at room temperature for 2 days.

[0085] Nine seedlings of uniform growth were transplanted into culture boxes containing nutrient soil (vermiculite and nutrient soil mixed in a 1:2 volume ratio). Each treatment had six replicates. Seedlings were cultured for seven days under normal conditions of 22℃, 16 h light / 8 h dark, and 60%-70% humidity. They were then transferred to a 42℃ incubator for heat treatment for 3-5 days, and then returned to normal conditions (22℃) for 5-7 days. Phenotypic results were recorded by photographing. This heat treatment experiment was repeated at least three times, and the survival rate was calculated for each instance.

[0086] Survival rate = (Number of surviving seedlings / Total number of seedlings) × 100%. Survival is defined as: stems remaining green, leaves partially or completely turning green again, or new leaves unfolding. Death is defined as: leaves turning yellow and dying, stems completely withered with no signs of regreening.

[0087] 2. Identification of heat tolerance phenotypes in TaHsfA2e knockout and overexpression transgenic wheat

[0088] Phenotypic results after heat stress are as follows Figure 3 (Knockout of genetically modified organisms) and Figure 5 As shown in the (overexpression transgene) diagram, under normal conditions (before heat treatment), there was no significant difference between TaHsfA2e knockout and overexpression transgenic wheat seedlings and wild-type. After high-temperature treatment at 42℃, compared with wild-type Fielder, TaHsfA2e knockout transgenic seedlings showed more wilting and yellowing of leaves and stems, and a lower plant survival rate. Figure 4The TaHsfA2e overexpression transgenic seedlings exhibited a poorer heat (high temperature) stress phenotype; conversely, the TaHsfA2e overexpression transgenic seedlings had more leaves and stems that remained green, more leaves that re-greened during the recovery period, and a higher plant survival rate. Figure 6 The TaHsfA2e gene exhibits a stronger heat (high temperature) stress phenotype. These results indicate that overexpression of the TaHsfA2e gene can significantly enhance wheat's heat (high temperature) stress tolerance.

[0089] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. The wheat heat shock transcription factor gene TaHsfA2e, characterized in that, Its coding region sequence is shown in SEQ ID NO.

2.

2. The wheat heat shock transcription factor gene TaHsfA2e according to claim 1, characterized in that, The nucleotide sequence of the wheat heat shock transcription factor gene TaHsfA2e is shown in SEQ ID NO.

1.

3. The protein TaHsfA2e encoded by the wheat heat shock transcription factor gene TaHsfA2e according to claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

3.

4. An overexpression vector containing the gene TaHsfA2e as described in claim 1.

5. The application of increasing the expression level of the wheat heat shock transcription factor gene TaHsfA2e as described in claim 1 or overexpressing the protein TaHsfA2e as described in claim 3 in improving the heat resistance of wheat.

6. The application of increasing the expression level of the wheat heat shock transcription factor gene TaHsfA2e as described in claim 1 or overexpressing the protein TaHsfA2e as described in claim 3 in the breeding of heat-resistant wheat.

7. The application of the overexpression vector according to claim 4 in improving the heat resistance of wheat.

8. The application of the overexpression vector according to claim 4 in the breeding of heat-resistant wheat.

9. A method for breeding heat-resistant wheat, characterized in that, Promotes the expression of the protein TaHsfA2e as described in claim 3 in wheat or increases the expression level of the gene TaHsfA2e as described in claim 1.

10. The method for breeding heat-resistant wheat according to claim 9, characterized in that, The specific steps are as follows: construct a recombinant vector containing the gene TaHsfA2e sgRNA as described in claim 1, introduce it into the recipient plant, and obtain transgenic plants with improved heat resistance through induction, subculture, pre-culture, co-culture, resistance screening, differentiation, rooting culture, hardening, and transplanting.

Images