Mycobacterium tuberculosis real-time fluorescence isothermal amplification detection kit and application thereof

Abstract

The invention discloses a Mycobacterium tuberculosis real-time fluorescence isothermal amplification detection kit for internally controlling amplification efficiency through a color development method and application of the Mycobacterium tuberculosis real-time fluorescence isothermal amplification detection kit. The kit comprises an isothermal amplification primer aiming at mycobacterium tuberculosis, a probe modified by a fluorophore substance, an isothermal amplification primer aiming at an exogenous internal control gene, a pH value sensitive dye, an isothermal amplification enzyme and an endonuclease. According to the invention, isothermal amplification detection containing amplification efficiency internal control can be realized only by using a single fluorescent labeled probe, mutual interference among a plurality of fluorescent probes is reduced so as to ensure efficient and specific detection of target genes, and meanwhile, the cost of a detection reagent and the cost requirement of detection equipment are reduced.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a real-time fluorescence isothermal amplification detection kit for Mycobacterium tuberculosis with internal control over amplification efficiency using a chromogenic method and its application. Background Technology

[0002] Tuberculosis (TB) is a systemic chronic infectious disease caused by the Mycobacterium tuberculosis complex (MTC), transmitted through the respiratory tract, and is prevalent worldwide. Currently, approximately one-third of the world's population is infected with Mycobacterium tuberculosis, with 9 million new cases occurring annually. Early and accurate diagnosis and monitoring of active TB are fundamental to the treatment and control of this respiratory infectious disease, and finding rapid and accurate diagnostic methods has always been a primary research area in tuberculosis.

[0003] Isothermal nucleic acid amplification technology has been applied to some extent in the detection of Mycobacterium tuberculosis nucleic acid. This method does not involve template denaturation or prolonged temperature cycling, meaning there is no temperature adjustment process, and therefore, it does not require specific, expensive equipment. Compared with traditional nucleic acid level detection methods, it is simple, rapid, accurate, inexpensive, and easy to detect. The application of isothermal nucleic acid amplification technology for the detection of Mycobacterium tuberculosis has significant implications for the development of clinical diagnostic techniques.

[0004] In clinical gene amplification testing, including isothermal amplification and PCR amplification, commercial nucleic acid amplification test reagents usually contain an "internal control" to avoid false negative results that may occur during sample processing and amplification reaction. The "internal control" completes the amplification reaction simultaneously with the target nucleic acid in the amplification reaction system. If the "internal control" does not amplify, it indicates a problem in the experimental process, and the test result of the sample is invalid.

[0005] Internal controls play a crucial role in monitoring test results. However, currently used internal controls often require an additional set of primers and probes, and the equipment must contain a separate fluorescence channel for detection. This can lead to amplification and detection interference with the target, and it is also not conducive to reducing the production cost of supporting equipment. Summary of the Invention

[0006] This invention addresses the aforementioned shortcomings by establishing a real-time fluorescence isothermal amplification kit for detecting Mycobacterium tuberculosis DNA, incorporating a colorimetric amplification efficiency control method. It utilizes isothermal amplification primers and probes modified with fluorescent groups to detect Mycobacterium tuberculosis. The isothermal amplification primers amplify the internal control gene, and the effectiveness of the amplification detection reaction is determined by visually observing the color change of a pH-sensitive chromogenic dye. To achieve the objectives of this invention, the following technical solution is proposed:

[0007] This invention relates to a real-time fluorescent isothermal amplification detection kit for Mycobacterium tuberculosis with internal control over amplification efficiency using a colorimetric method. The kit comprises isothermal amplification primers for Mycobacterium tuberculosis, probes modified with fluorescent groups, isothermal amplification primers for exogenous internal control genes, a pH-sensitive dye, an isothermal amplification enzyme, and a ribonuclease. When fluorescence is detected after amplification, it indicates that the amplification efficiency is unaffected and that the Mycobacterium tuberculosis test is positive. When fluorescence is not detected after amplification, but a color change in the reaction solution is observed visually, it indicates that the amplification is effective and the Mycobacterium tuberculosis test is negative. When fluorescence is not detected after amplification, and no significant color change in the reaction solution is observed visually, it indicates that the amplification detection is invalid.

[0008] In a preferred embodiment of the present invention, the pH-sensitive dye is phenol red.

[0009] In a preferred embodiment of the present invention, the exogenous internal control gene is a gene with less than 10% homology to the Mycobacterium tuberculosis gene.

[0010] In a preferred embodiment of the present invention, the isothermal amplification primers and fluorescently modified probes for Mycobacterium tuberculosis are as follows:

[0011] F3: CACACAGCTGACCGAGC

[0012] B3: TGCATCTGGCCACCTCG

[0013] FIP: TGAGTTCGCCATCGCGCAGCTGTGCCGATCGCCCCA

[0014] BIP: GGAGCACATCAGCCGCGTCCTCACGGTTCAGGGTTAGCC

[0015] LF: CTCCCGGTTGATGTGGTCG

[0016] LB: GCCGCCAACTACGGTGTTT

[0017] P:CTCrCCGGiBHQ2dTTGATGTGGTCG.

[0018] In a preferred embodiment of the present invention, the primers for isothermal amplification of exogenous endogenous control genes are as follows:

[0019] F3: GCACGCTGACTTGTCAGAC

[0020] B3: ATGACTCACGTCCGTCGT

[0021] FIP: GGCATCTGTCTCGGAAAGGCCATTAGCTCTGCGCTGTCAAC

[0022] BIP: ATTCAATCGCGGGGCGTGAGGGCTTCTGGTGCGTCAAAG

[0023] LF: TTGCGGTTTCTCCGTGGTG

[0024] LB: TGCAATGCGTTTCGGTACGTAAG.

[0025] Another aspect of the present invention relates to the application of the above-mentioned kit in the quantitative and / or qualitative detection of Mycobacterium tuberculosis.

[0026] The beneficial effects of this invention are as follows:

[0027] This invention enables isothermal amplification detection with internal control of amplification efficiency using only a single fluorescently labeled probe, reducing mutual interference between multiple fluorescent probes to ensure efficient and specific detection of target genes, while also reducing the cost of detection reagents and the cost requirements of detection equipment. Attached Figure Description

[0028] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 This is a color observation diagram of the reaction solution for amplification detection of different DNA templates in Example 1;

[0030] Figure 2 This is a fluorescence amplification curve for amplification detection of different DNA templates in Example 1;

[0031] Figure 3 This is a color observation diagram of the reaction solution used in Example 2 to amplify concentration gradient samples L1, L2, and L3, and five clinical samples S1, S2, S3, S4, and S5 using the reagents of the present invention.

[0032] Figure 4 Example 2 shows the fluorescence amplification curves of five clinical samples (L1, L2, L3, S1, S2, S3, S4, and S5) amplified by the dedicated primer and probe system of this invention during fluorescence isothermal amplification.

[0033] Figure 5 This is a color observation diagram of the reaction solution used in Example 3 to detect Mycobacterium tuberculosis and other non-tuberculous mycobacteria and pathogens using the kit of the present invention;

[0034] Figure 6 Example 3 shows the fluorescence amplification curves of Mycobacterium tuberculosis and other non-tuberculous mycobacteria and pathogens detected using the kit of the present invention. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0036] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0037] Example 1

[0038] This embodiment establishes a method for real-time fluorescence isothermal amplification detection and internal control of amplification efficiency for Mycobacterium tuberculosis, which includes:

[0039] 1. Primer and probe design and screening

[0040] Gene sequences of Mycobacterium tuberculosis were searched in the NCBI database. The conserved sequence of the IS6110 gene was selected as the target, and multiple pairs of primer probes for the target genes and primers for exogenous internal control genes were designed.

[0041] 1) IS6110 primer and probe screening

[0042] (1) Design IS6110 specific primers and probes. The specific sequences are shown in Table 1:

[0043] Table 1 Different primer-probe combinations for IS6110

[0044]

[0045] (2) The IS6110 gene standard plasmid was synthesized based on the standard sequence of the Mycobacterium tuberculosis IS6110 gene downloaded from the NCBI database (synthesized by Beijing Qingke Biotechnology Co., Ltd.). Two dilutions of 1000 copies / mL and 10000 copies / mL of the IS6110 gene standard plasmid as the DNA template and sterile enzyme-free water were used.

[0046] (3) Amplification system

[0047] Table 2 IS6110 amplification reaction system

[0048]

[0049] (4) The amplification program was set as follows: temperature 63℃, amplification cycle number 30 cycles, 1 min per cycle, and fluorescence signal was collected in each cycle.

[0050] (5) The screening results are shown in the table below. In terms of specificity, the second and fourth primer-probe combinations showed non-specific amplification and were excluded. In terms of sensitivity, the first primer-probe combination could detect 1000 copies / mL, which was more sensitive than the third primer-probe combination. In conclusion, the first primer-probe combination was selected for the IS6110 gene.

[0051] Table 3 Detection results of different primer-probe combinations for IS6110

[0052]

[0053] (6) After the above screening and optimization tests, the multiple target gene primers and probes used in this invention to detect Mycobacterium tuberculosis are shown in Table 4.

[0054] Table 4. Primer and probe sequence information for Mycobacterium tuberculosis in this invention.

[0055]

[0056] 2) Primer screening for exogenous endogenous control genes

[0057] (1) Select an artificially designed DNA sequence (without homology to gene sequences in the existing gene sequence database) as the exogenous gene template, and design primers for the exogenous internal control gene. The specific sequences of the exogenous gene and primers are shown in Table 5:

[0058] Table 5 Different primers for exogenous endogenous control genes

[0059]

[0060] (2) Preparation of the reaction system

[0061] Two systems were prepared using primers and probes selected from each gene. Two sets of exogenous internal control gene primers from Table 5 were added to each system. The combined multiplex reaction solution was then validated to screen for the optimal primer-probe combination. The reaction system for the multiplex reaction solution is shown in Table 6.

[0062] Table 6. Reaction solution system for detecting Mycobacterium tuberculosis

[0063]

[0064] (3) DNA template preparation

[0065] Table 7 DNA Template Information

[0066]

[0067] (4) On-machine amplification

[0068] Add the DNA template to the amplification reaction solution, mix thoroughly, and then centrifuge to collect the liquid from the tube wall.

[0069] Place the amplification reaction tube into the real-time fluorescence PCR detection device; set the amplification program as follows: temperature 63℃, amplification cycle number 30 cycles, 1 min per cycle, and collect fluorescence signals in each cycle.

[0070] (5) Experimental results

[0071] The test results are shown in Table 8:

[0072] Table 8 Summary of Test Results

[0073]

[0074] (6) Results Analysis

[0075] The addition of the first set of exogenous internal control primers resulted in no amplification curve at D2, possibly indicating an influence of the exogenous gene primers on the target gene. Therefore, the second set of exogenous internal control primers (see Table 9) was preferred. Analysis of the results after adding the second set of exogenous internal control primers: When detecting positive templates at D1-D2, positive amplification curves were displayed, indicating a positive result (color change in the reaction solution is not considered), consistent with the sample settings. When detecting negative templates at D3, no positive amplification curve was displayed, but the reaction solution color changed significantly, indicating a negative result, consistent with the sample settings. When detecting positive templates at D4, no positive amplification curve was displayed, and the reaction solution color did not change significantly, indicating inhibited amplification and invalid results, consistent with the sample settings. Therefore, the second set of primers was chosen. The above results demonstrate that the method of using color change as an internal control for fluorescent amplification detection of the target is reasonable and effective.

[0076] When using a pH-sensitive dye, if the amplification efficiency is not affected, the amplification reaction causes a change in the pH of the reaction solution, and the reaction solution turns yellowish at the end of the test, indicating that the amplification detection is effective. If the amplification efficiency is affected, the amplification is inhibited, resulting in a smaller change in the pH of the reaction solution, and the color of the reaction solution does not change significantly at the end of the amplification detection (it turns purplish-red), indicating that the amplification detection is invalid.

[0077] Table 9 Primer sequence information for exogenous endogenous control genes in this invention.

[0078]

[0079] Example 2

[0080] Detection and interpretation of samples at different concentrations

[0081] 1. The Mycobacterium tuberculosis culture was serially diluted to form three concentrations of samples: L1, L2, and L3. The specific concentrations are shown in Table 10.

[0082] Table 10. Composition and Concentration of Sample Diluents

[0083]

[0084] 2. Collect 3 clinical samples with low concentrations (200-500 copies / mL) (S1, S2, S3), 2 samples with added chemical inhibitors (S4, S5), and add internal control gene plasmids (50,000 copies / mL) to all samples.

[0085] 3. Select the primers and probes from Tables 4 and 9, prepare the amplification reaction solution according to Table 6, and dispense 40 μL / well into the amplification tubes.

[0086] 4. Perform lysis treatment on samples L1, L2, L3 and S1, S2, S3, S4, S5 at 90℃ for 5 minutes. Add the supernatant (DNA template) of the lysed samples to the amplification reaction solution, mix thoroughly, and then centrifuge to collect the liquid on the tube wall.

[0087] 5. Place the amplification reaction tube into the real-time fluorescence PCR detection device; set the amplification program as follows: temperature 63℃, amplification cycle number 30 cycles, 1 min per cycle, and collect fluorescence signals in each cycle.

[0088] 6. Test Results

[0089] After the reaction is complete, visually inspect the amplification reaction solution. A yellow color indicates effective amplification (e.g., ...). Figure 3 As shown), the results are then interpreted based on the instrument's amplification curve (e.g. Figure 4 As shown in the figure), the interpretation is shown in Table 11 below:

[0090] Table 11 Summary of Test Results

[0091]

[0092] 7. Results Analysis

[0093] As shown in the table above, the amplification sensitivity of the multiplex reaction solution can still reach a concentration of 500 copies / mL (L3), indicating that this method has high sensitivity. When testing low-concentration clinical samples, this method can detect 2 positive and 1 negative results, and the negative result is confirmed to be valid by observing the color. When testing samples containing inhibitors, the detection result (fluorescence signal) is negative, but the lack of significant color change confirms that the negative result is invalid.

[0094] Example 3

[0095] Specificity assay of primer and probe combinations for the detection of Mycobacterium tuberculosis

[0096] 1. This invention uses multiple primer and probe pairs, which may lead to non-specific amplification or cross-reaction. To verify the specificity of this invention, based on gene sequence homology, similarity of clinical symptoms, and proximity of infection sites, we collected Streptococcus pneumoniae, Haemophilus influenzae, Escherichia coli, Staphylococcus epidermidis, Staphylococcus aureus, Nocardia, Candida albicans, Cryptococcus, Pseudomonas aeruginosa, as well as human influenza virus and human parainfluenza virus, and other mycobacteria from the following non-tuberculous mycobacterial complex: Mycobacterium kansas, Mycobacterium marineum, Mycobacterium terrestris, minor mycobacteria, Mycobacterium ulcerativeum, Mycobacterium Gordonum, Mycobacterium bufotae, Mycobacterium avium, Mycobacterium scrofula, Mycobacterium suruganiae, Mycobacterium guilloché, Mycobacterium occulta, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium gastritis, Mycobacterium intracellularis, and Mycobacterium chrysogenum. Including the control group Mycobacterium tuberculosis, a total of 29 pathogens were collected.

[0097] 2. Select the primers and probes from Tables 4 and 9, prepare the amplification reaction solution according to Table 6, and dispense 40 μL / well into the amplification tubes.

[0098] 3. The pathogen used for the cross-reaction verification above was subjected to lysis treatment at 90°C for 5 minutes. The supernatant (DNA template) of the lysed sample was added to the amplification reaction solution, mixed thoroughly, and centrifuged to collect the liquid from the tube wall.

[0099] 4. Place the amplification reaction tube into the real-time fluorescence PCR detection device; set the amplification program as follows: temperature 63℃, amplification cycle number 30 cycles, 1 min per cycle, and collect fluorescence signals in each cycle.

[0100] 5. Test Results

[0101] After the reaction, the amplification reaction solution was visually inspected, and the color of the reaction solution in all reaction wells turned yellow (e.g., ...). Figure 5 As shown), the reaction wells of the positive control showed fluorescence amplification curves, while the detection wells of the cross-reacting pathogens did not (as shown). Figure 6 (As shown).

[0102] 6. Results Analysis

[0103] The above test results indicate that the detection of all samples was effective. This reaction system has no cross-reactivity for the detection of Mycobacterium tuberculosis and has high specificity.

[0104] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements can be made without departing from the principle of the present invention, and these improvements should also be considered within the scope of protection of the present invention.

Claims

1. A real-time fluorescence isothermal amplification detection kit for Mycobacterium tuberculosis with internally controlled amplification efficiency using a colorimetric method, characterized in that, The kit includes isothermal amplification primers and fluorescently modified probes for Mycobacterium tuberculosis, isothermal amplification primers for exogenous internal control genes, pH-sensitive dyes, isothermal amplification enzymes, and ribonucleases.

2. The reagent kit according to claim 1, characterized in that, The pH-sensitive dye is phenol red.

3. The reagent kit according to claim 1, characterized in that, Exogenous endogenous control genes are genes with less than 10% homology to Mycobacterium tuberculosis genes.

4. The reagent kit according to claim 1, characterized in that, The isothermal amplification primers and fluorescently modified probes for Mycobacterium tuberculosis are shown below: F3: CACACAGCTGACCGAGC B3: TGCATCTGGCCACCTCG FIP: TGAGTTCGCCATCGCGCAGCTGTGCCGATCGCCCCA BIP: GGAGCACATCAGCCGCGTCCTCACGGTTCAGGGTTAGCC LF: CTCCCGGTTGATGTGGTCG LB: GCCGCCAACTACGGTGTTT P:CTCrCCGGiBHQ2dTTGATGTGGTCG.

5. The reagent kit according to claim 1, characterized in that, The primers for isothermal amplification of exogenous endogenous control genes are shown below: F3: GCACGCTGACTTGTCAGAC B3: ATGACTCACGTCCGTCGT FIP: GGCATCTGTCTCGGAAAGGCCATTAGCTCTGCGCTGTCAAC BIP: ATTCAATCGCGGGGCGTGAGGGCTTCTGGTGCGTCAAAG LF: TTGCGGTTTCTCCGTGGTG LB: TGCAATGCGTTTCGGTACGTAAG.

6. The use of the kit according to any one of claims 1-5 in the quantitative and / or qualitative detection of Mycobacterium tuberculosis.

7. The application according to claim 6, characterized in that, If fluorescence is detected after amplification, it indicates that the amplification efficiency was not affected and that Mycobacterium tuberculosis is positive. If fluorescence is not detected after amplification, but a change in the color of the reaction solution is observed to the naked eye, it can be judged that the amplification is effective and Mycobacterium tuberculosis is negative. If fluorescence is not detected after amplification and no significant change in the color of the reaction solution is observed to the naked eye, it indicates that the amplification detection is invalid.

Images