Glyphosate fluorescence detection method based on RNase H cycle amplified magnetic bead-aptamer-Cas9 / deoxyribozyme

The magnetic bead-aptamer-Cas9/deoxyribozyme fluorescence detection method, which is amplified by RNase H cycling, solves the problems of instrument dependence and insufficient sensitivity in glyphosate detection, and achieves glyphosate detection with high specificity and high sensitivity. It is suitable for rapid detection in soil, water and agricultural products.

CN121933488APending Publication Date: 2026-04-28JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JILIN UNIVERSITY
Filing Date
2026-02-02
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing methods for detecting glyphosate suffer from problems such as strong instrument dependence, insufficient sensitivity, and poor specificity, making it difficult to meet the need for rapid and accurate detection of trace residues in the environment.

Method used

A fluorescence detection method based on RNase H cyclic amplification using magnetic beads, aptamers, and Cas9/deoxyribonuclease was developed. This method utilizes the binding of glyphosate to the aptamer to release complementary DNA, and leverages the RNase H-mediated cDNA recycling and the signal amplification mechanism of the Cas9 endonuclease, combined with magnetic bead separation, to achieve highly sensitive detection of glyphosate.

Benefits of technology

It enables trace detection of glyphosate with a detection limit reduced to 8.26 ng/L, exhibiting high specificity and sensitivity. It can be rapidly detected in a variety of samples without the need for complex instruments, making it suitable for on-site testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121933488A_ABST
    Figure CN121933488A_ABST
Patent Text Reader

Abstract

The invention discloses a glyphosate fluorescence detection method based on RNase H cycle amplified magnetic bead-aptamer-Cas9 / deoxyribozyme, belongs to the technical field of environmental monitoring and biological detection, and can realize high-sensitivity and rapid quantitative detection of glyphosate residues in soil, water bodies and agricultural products. According to the method, the glyphosate is combined with an aptamer to release complementary DNA (cDNA) combined with the aptamer, then signal cascade amplification is realized through RNase H-mediated cDNA cyclic utilization, the anti-interference advantage brought by magnetic bead separation is combined, and the known characteristics of Cas9 endonuclease and DNAzyme in the aspects of nucleic acid recognition and cutting are used as signal amplification and transduction means, so that the detection sensitivity of the glyphosate is improved, and the detection sensitivity of the glyphosate is improved. Therefore, trace detection of glyphosate is realized. According to the invention, sensitive detection of other targets can be realized by replacing nucleic acid aptamers capable of specifically recognizing other targets and correspondingly adjusting the sequence of cDNA to maintain base pairing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of environmental monitoring and biological detection technology, specifically relating to a glyphosate fluorescence detection method based on RNase H cyclic amplification of magnetic beads-aptamer-Cas9 / deoxyribozyme, which can achieve highly sensitive and rapid quantitative detection of glyphosate residues in soil, water and agricultural products. Background Technology

[0002] Glyphosate (N-(phosphonomethyl)glycine) is the most widely used broad-spectrum herbicide globally. It achieves its weed-control effect by inhibiting the synthesis of aromatic amino acids through the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in plants. However, glyphosate is prone to residues in the environment (its half-life in soil can reach several months), and it can accumulate in the human body through the food chain. Long-term exposure may disrupt the endocrine system, damage the gut microbiota, and even have potential carcinogenicity. Therefore, establishing a sensitive, specific, and convenient method for detecting glyphosate is crucial for environmental safety and human health.

[0003] Existing methods for glyphosate detection mainly include:

[0004] 1. Chromatography (such as HPLC, GC-MS): High sensitivity and accuracy, but dependent on expensive instruments, complex operation, and cumbersome sample pretreatment (requiring derivatization), making it unsuitable for rapid on-site detection;

[0005] 2. Immunoassay (such as ELISA): Based on antigen-antibody reaction, it is easy to operate, but the antibody is easily inactivated by temperature, the detection signal is easily affected by the complex matrix in the actual sample, and the sensitivity is difficult to meet the needs of trace residue detection.

[0006] 3. Traditional aptamer detection method: Aptamers (single-stranded nucleic acids) have high target specificity and good stability, but most methods rely on a simple "recognition-signal direct output" mode, lacking a signal amplification mechanism. The detection limit can only reach the nanomolar to micromolar level, which cannot meet the requirements for low concentration residue detection.

[0007] 4. Traditional Aptamer-CRISPR Gene Editing Detection Method: This method combines the high specificity of aptamers with the targeted cutting capability of the CRISPR gene editing system, achieving a synergistic effect of "specific recognition-targeted cutting" in its technical principle. However, limited by the traditional design, its signal output relies on a linear pattern of "single-round aptamer recognition-single-round CRISPR cutting," lacking an efficient signal amplification mechanism. On the one hand, low concentrations of glyphosate cannot trigger a sufficient cutting response, resulting in weak signal intensity. On the other hand, the unamplified signal is difficult to effectively distinguish from background noise, ultimately causing low concentrations of glyphosate to be undetectable stably, making it difficult to meet the detection requirements for low-dose residues in actual samples.

[0008] In summary, existing methods suffer from problems such as "strong instrument dependence, insufficient sensitivity, and poor specificity." Therefore, developing a glyphosate detection technology that combines high specificity, high sensitivity, and ease of operation is of vital importance for environmental trace residue monitoring and food safety control. Summary of the Invention

[0009] To address the shortcomings of existing glyphosate detection methods, the present invention aims to provide a glyphosate fluorescence detection method based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / DNAzyme. This method releases complementary DNA (cDNA) bound to the aptamer through glyphosate binding, followed by RNase H-mediated cDNA recycling to achieve signal cascade amplification. Combining the anti-interference advantages of magnetic bead separation, the known characteristics of Cas9 endonuclease and DNAzyme in nucleic acid recognition and cleavage are utilized as signal amplification and transduction mechanisms within the designed reaction flow, thereby achieving trace detection of glyphosate.

[0010] The present invention discloses a method for detecting glyphosate fluorescence based on RNase H cyclic amplification using magnetic beads-aptamers-Cas9 / DNAzyme, the steps of which are as follows (unless otherwise specified, all solutions described in this invention are deionized aqueous solutions):

[0011] 1) First, the key enzyme Cas9 required for the detection system was prepared. Its preparation and purification methods are as follows: The plasmid pET-NLS-Cas9-6xHis (Addgene: 62934) expressing the Cas9 protein was transformed into BL21 *E. coli* competent cells, and then plated on LB solid medium containing 50 μg / mL kanamycin (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar in deionized water, pH 7.0) and incubated overnight at 37 ℃. Single colonies were picked and inoculated into LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl in deionized water, pH 7.0) and cultured at 37 ℃ with shaking at 220 rpm. When the OD600 reached 0.6–0.8, 0.2 μg / mL kanamycin was added to a final concentration of 0.2 μg / mL kanamycin. mM isopropyl-β-D-thiogalactoside (IPTG) was added, and then the cells were induced to express recombinant Cas9 protein at 16-20 °C for 16-20 h. The cells were then collected by centrifugation, sonicated, and the supernatant was purified by nickel affinity chromatography. The target protein fraction was collected by elution with different concentrations of imidazole buffer and the purity was verified by SDS-PAGE to be ≥95%. The protein was desalted by ultrafiltration and replaced with Cas9-specific buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, 100 μg / mL bovine serum albumin deionized water, pH 7.9) to a stock solution with a protein concentration of 10 μM. The obtained Cas9 was aliquoted and stored at -80 °C for later use.

[0012] 2) Preparation of Aptamer / cDNA complex: cDNA and biotin-labeled Aptamer aptamer were added to nucleic acid binding buffer (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.05% Tween-20 deionized water, pH 7.5) at a molar ratio of 1:1, heated at 90-95 °C for 3-5 min, and then cooled to room temperature to form Aptamer / cDNA complex;

[0013] Preparation of gRNA / Block-RNA complex: gRNA and Block-RNA were added to nucleic acid binding buffer at a molar ratio of 1:1, heated at 90-95 °C for 3-5 min, and then cooled to room temperature to form gRNA / Block-RNA complex; wherein gRNA is guide RNA and Block-RNA is biotin-labeled blocking RNA.

[0014] Preparation of cA@MB: 1 mg of streptavidin-labeled magnetic beads (MB) and 600 pmol of Aptamer / cDNA complex were added to 400 μL of nucleic acid binding buffer and incubated in a vortex mixer at 37 °C for 1–2 h. Subsequently, the prepared cDNA / Aptamer@MB (abbreviated as cA@MB) was collected by magnetic separation and washed 3–6 times with GLYP reaction buffer (10 mM Tris-HCl, 150 mM NaCl, 10 mM KCl, 22.5 mM MgCl2 deionized water, pH 7.5) and stored at 4 °C for later use.

[0015] Preparation of gB@MB: Add 1 mg of streptavidin-labeled MB and 600 pmol of gRNA / Block-RNA complex to 400 μL of nucleic acid binding buffer, and incubate in a vortex mixer at 37 °C for 1-2 h; then collect the prepared gRNA / Block-RNA@MB (abbreviated as gB@MB) by magnetic separation, wash 3-6 times with GLYP reaction buffer, and store at 4 °C for later use;

[0016] The nucleotide sequence of the biotin-labeled Aptamer aptamer is shown in SEQ ID NO.1, and the specific sequence is: 5'-TTTTTTAGCTTGCTGCAGCGATTCTTGATCGCCACAGAGCT-3';

[0017] The nucleotide sequence of the cDNA is shown in SEQ ID NO.2, and the specific sequence is: 5'-TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAGGTAAATGGCGATCAAGAATCGCTGC-3';

[0018] The nucleotide sequence of the Block-RNA is shown in SEQ ID NO.3, and the specific sequence is: 5'-TTTACCTAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGA-3' (this sequence is RNA, where T represents uracil U in RNA);

[0019] The nucleotide sequence of the gRNA is shown in SEQ ID NO.4, specifically: 5'-GCTAATGAGACAATAGTGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (this sequence is RNA where T represents uracil U in the RNA);

[0020] 3) Weigh out glyphosate standard (purity ≥98%), prepare a 1 mg / L stock solution with GLYP reaction buffer, and then serially dilute with GLYP reaction buffer to obtain glyphosate standard solutions with concentrations of 0.05 μg / L to 1000 μg / L (specific concentrations can be 0.05 μg / L, 0.1 μg / L, 0.5 μg / L, 1 μg / L, 5 μg / L, 10 μg / L, 50 μg / L, 100 μg / L, 500 μg / L, 1000 μg / L).

[0021] 4) Add 40 μg of cA@MB to 150 μL of glyphosate standard solutions of different concentrations, and replenish the reaction system volume to 200 μL with GLYP reaction buffer. After incubation at 37 ℃ for 1~3 h, remove cA@MB by magnetic separation.

[0022] 5) Add 80 μg of gB@MB and 4 U of RNase H to the solution obtained in step 4), and simultaneously add the RNase H reaction buffer (20 mM Tris-HCl, 40 mM KCl, 8 mM MgCl2, 1 mM MTT deionized water solution, pH 7.8) to make up the reaction volume to 500 μL. React at 37 °C for 15-30 min. Then remove gB@MB by magnetic separation. Heat the supernatant at 70-80 °C for 5-10 min to inactivate RNase H.

[0023] 6) Preparation of FL-DNAzyme / Block-DNA complex: FL-DNAzyme and Block-DNA were added to Cas9-specific buffer at a molar ratio of 1:1. The mixture was heated at 90-95 °C for 3-5 min, and then cooled to room temperature to form the FL-DNAzyme / Block-DNA complex. After the solution from step 5) cooled to room temperature, 4 μL of Cas9 protein was added to bring the final concentration to 40 nM. The mixture was then incubated at room temperature for 8-15 min. Subsequently, 80 pmol of the FL-DNAzyme / Block-DNA complex and 160 pmol of a substrate labeled with a fluorescent and quenching group were added. The volume was then increased to 1000 μL with Cas9-specific buffer, and the mixture was reacted at 37 °C for 35-45 min. FL-DNAzyme is a full-length deoxyribonuclease, and Block-DNA is biotin-labeled blocking DNA.

[0024] The nucleotide sequence of the FL-DNAzyme is shown in SEQ ID NO.5, and the specific sequence is: 5'-GCTAATGAGACAATAGTGATAGGAATCCGAGCCGGTTCCGAGCCGGTCGAAAATAGTGAGTA-3';

[0025] The nucleotide sequence of the Block-DNA is shown in SEQ ID NO.6, specifically: 5'-GATTCCTATCACTATTGTCTCATTAGC-3';

[0026] The nucleotide sequence of the Substrate is shown in SEQ ID NO.7, specifically: 5'-TACTCACTATT / rA / GAGATTCCTATC-3';

[0027] 7) Measure the fluorescence intensity of the solution obtained in step 6) at 670 nm using a fluorescence spectrometer. The excitation wavelength for fluorescence detection is 590 nm, the emission wavelength is 670 nm, and the slit width is 5 nm. Perform linear regression with the logarithm of the glyphosate standard solution concentration (logC) as the abscissa and the fluorescence intensity at 670 nm (F-F0) as the ordinate to plot a standard curve of "fluorescence intensity at 670 nm - logarithm of glyphosate standard solution concentration".

[0028] 8) Take 150 μL of the sample solution to be tested (the sample to be tested is soil extract, water sample or agricultural product (soybean, corn, etc.) extract) and perform the operations in steps 4) to 6). Then use a fluorescence spectrometer to measure the fluorescence intensity of the sample solution at 670 nm. Substitute the fluorescence intensity value at 670 nm into the standard curve obtained in step 7) to calculate the concentration of glyphosate in the sample solution, thereby realizing the fluorescence detection of glyphosate in the sample to be tested.

[0029] The principle of this invention is that glyphosate binds to Aptamer, causing the Aptamer / cDNA double strand in cA@MB to dissociate, releasing cDNA into the supernatant. The cDNA in the supernatant forms an RNA-DNA hybrid double strand with Block-RNA in gB@MB, triggering a strand displacement reaction and releasing gRNA. Simultaneously, the added RNase H specifically hydrolyzes the Block-RNA strand in the hybrid double strand, releasing free cDNA. The free cDNA can then bind again to Block-RNA in new gB@MB, initiating the next round of strand displacement and RNase. H-cleavage enables cDNA recycling, significantly increasing gRNA production. The amplified gRNA forms a Cas9 / gRNA complex with the Cas9 protein. Cas9 / gRNA recognizes the adjacent motif (PAM site) in the protospacer region of the FL-DNAzyme / Block-DNA complex and cleaves the FL-DNAzyme / Block-DNA complex, releasing catalytically active DNAzyme. The DNAzyme cleaves the substrate, separating the fluorophore from the quencher, thus restoring fluorescence. The fluorescence intensity is positively correlated with the logarithm of glyphosate concentration, and quantification is achieved through a standard curve.

[0030] This invention utilizes the specific degradation properties of RNase H on the RNA strand in DNA / RNA hybrid double-stranded DNA to construct a cDNA cycling amplification system, achieving efficient signal cycling and cascade amplification. This mechanism differs from previous techniques that only used RNase H for single signal release or hybrid strand cleavage, fundamentally improving amplification efficiency and detection sensitivity, representing a significant improvement over traditional aptamer detection systems. The method described in this invention is universal; by replacing the nucleic acid aptamer that specifically recognizes other targets and adjusting the cDNA sequence accordingly to maintain base pairing, sensitive detection of other targets can be achieved.

[0031] Compared with the prior art, the present invention has the following core advantages:

[0032] 1. High-efficiency cycling amplification: RNase H-mediated cDNA cycling increases gRNA production several times over, reducing the detection limit to 8.26 ng / L, meeting the needs of environmental trace residue detection;

[0033] 2. High specificity: Based on Aptamer's specific recognition of glyphosate and Cas9 / gRNA's sequence-specific cleavage of the FL-DNAzyme / Block-DNA complex, dual protection of specificity is achieved, which can reduce background noise, improve the signal-to-noise ratio, and has no cross-reaction with commonly used herbicides, pesticides and environmental disturbances in agriculture.

[0034] 3. Simple operation and wide applicability: The method described in this invention can detect a variety of samples such as soil, water, and grains. The sample pretreatment process is simple, the reaction does not require complicated instruments, and the detection time is short, which meets the needs of on-site testing. Attached Figure Description

[0035] Figure 1 Transmission electron microscopy (TEM) images of cA@MB and gB@MB obtained in Example 1, with a scale bar of 200 nm;

[0036] Figure 2 Fluorescence spectra of glyphosate at different concentrations in the detection system in Example 2, with fluorescence intensity on the vertical axis and wavelength on the horizontal axis;

[0037] Figure 3 Example 2: Linear fitting graph between different concentrations of glyphosate and fluorescence intensity at 670 nm, with the vertical axis representing fluorescence intensity and the horizontal axis representing the logarithm of glyphosate concentration;

[0038] Figure 4 Example 3 shows the results of fluorescence detection to detect the anti-interference ability of glyphosate. The substances on the horizontal axis are glyphosate, diuron, chlorpyrifos, mesotrione, carbaryl, and acetochlor, respectively. This indicates that Aptamer only reacts with glyphosate to exert its effect. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit its scope. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0040] Example 1

[0041] Preparation and characterization of Cas9 protein, cA@MB, and gB@MB:

[0042] First, the key enzyme Cas9 required for the detection system was prepared. Its preparation and purification methods are as follows: The plasmid pET-NLS-Cas9-6xHis (Addgene: 62934) expressing the Cas9 protein was transformed into BL21 *E. coli* competent cells, then plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37 ℃. Single colonies were picked and inoculated into LB liquid medium, and cultured at 37 ℃ with shaking at 220 rpm. When the OD600 reached 0.7, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.2 mM, and then the culture was transferred to 20 ℃ to induce the expression of 16... h, the recombinant Cas9 protein was obtained; then the bacterial cells were collected by centrifugation, and after sonication, the supernatant was purified by nickel column affinity chromatography; the target protein fraction was collected by elution with imidazole buffer of different concentrations, and the purity was verified by SDS-PAGE ≥95%; the protein was desalted by ultrafiltration and replaced with Cas9-specific buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, 100 μg / mL bovine serum albumin deionized water, pH 7.9) to a stock solution with a protein concentration of 10 μM, and the obtained Cas9 was aliquoted and stored at -80 ℃ for later use;

[0043] Preparation of Aptamer / cDNA complex: cDNA and biotin-labeled Aptamer were added to nucleic acid binding buffer (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.05% Tween-20 deionized water, pH 7.5) at a molar ratio of 1:1, heated at 95 °C for 3 min, and then cooled to room temperature to form Aptamer / cDNA complex.

[0044] Preparation of gRNA / Block-RNA complex: gRNA and Block-RNA were added to nucleic acid binding buffer at a molar ratio of 1:1, heated at 95 °C for 3 min, and then cooled to room temperature to form gRNA / Block-RNA complex.

[0045] Preparation of cA@MB: 1 mg MB and 600 pmol Aptamer / cDNA complex were added to 400 μL of nucleic acid binding buffer and incubated in a vortex mixer at 37 °C for 2 h. Subsequently, the prepared cA@MB was collected by magnetic separation, washed 5 times with GLYP reaction buffer, and stored at 4 °C for later use.

[0046] Preparation of gB@MB: 1 mg MB and 600 pmol of gRNA / Block-RNA complex were added to 400 μL of nucleic acid binding buffer and incubated in a vortex mixer at 37 °C for 2 h. Subsequently, the prepared gB@MB was collected by magnetic separation, washed 5 times with GLYP reaction buffer, and stored at 4 °C for later use.

[0047] The transmission electron microscopy (TEM) characterization results of the prepared cA@MB, gB@MB and the original magnetic bead MB are as follows: Figure 1 As shown, the original magnetic beads (MB), the prepared cA@MB, and gB@MB all exhibited a regular, smooth, near-spherical structure under transmission electron microscopy (TEM). The average diameter of all three remained around 400 nm. The particle size of the magnetic beads did not change significantly before and after coupling with nucleic acid complexes (Aptamer / cDNA or gRNA / Block-RNA), and they were uniformly distributed and highly dispersible within the field of view, with no obvious cross-linking or aggregation observed. This indicates that the modification method used in this invention has good biocompatibility and can ensure the stability of the detection system during the reaction process.

[0048] Example 2

[0049] 1) Preparation of glyphosate standard solution

[0050] Weigh out glyphosate standard (purity ≥98%), prepare a 1 mg / L stock solution with GLYP reaction buffer, and then serially dilute with GLYP reaction buffer to prepare glyphosate standard solutions with concentrations of 0.05 μg / L, 0.1 μg / L, 0.5 μg / L, 1 μg / L, 5 μg / L, 10 μg / L, 50 μg / L, 100 μg / L, 500 μg / L, and 1000 μg / L.

[0051] 2) Testing steps

[0052] (1) Add 40 μg of cA@MB to 150 μL of glyphosate standard solutions of different concentrations, and replenish the reaction system volume to 200 μL with GLYP reaction buffer. After incubation at 37 °C for 1.5 h, remove cA@MB by magnetic separation.

[0053] (2) Add 80 μg of gB@MB and 4 U of RNase H to the solution obtained in step (1), and add RNase H reaction buffer required for RNase H reaction. Make up the reaction volume to 500 μL, react at 37 °C for 20 min, and then remove gB@MB by magnetic separation. Heat the supernatant at 80 °C for 5 min to deactivate RNase H.

[0054] (3) Preparation of FL-DNAzyme / Block-DNA complex: FL-DNAzyme and Block-DNA were added to Cas9 buffer at a molar ratio of 1:1, heated at 95 °C for 5 min, and then cooled to room temperature to form FL-DNAzyme / Block-DNA complex; after the solution in step (2) was cooled to room temperature, 4 μL of Cas9 protein solution was added to make the final concentration 40 nM, and then incubated at room temperature for 10 min. Then 80 pmol of FL-DNAzyme / Block-DNA complex and 160 pmol of Substrate were added, and the volume was supplemented to 1000 μL with Cas9 buffer. The reaction was carried out at 37 °C for 40 min.

[0055] 3) Establishment of standard curve

[0056] The fluorescence intensity of the solution obtained in step 2) was measured at 670 nm using a fluorescence spectrometer. The excitation wavelength for fluorescence detection was 590 nm, the emission wavelength was 670 nm, and the slit width was 5 nm. Figure 2 Fluorescence spectra of glyphosate standard solutions at different concentrations are shown. A significant fluorescence emission peak at 670 nm is clearly observed in the figures. With increasing glyphosate concentration (from 0.05 μg / L to 1000 μg / L), the fluorescence intensity at this peak exhibits a clear, stepwise increasing trend. This phenomenon indicates that as the glyphosate content increases, more aptamers are triggered to detach from the magnetic beads, leading to the release of more free substrate through the RNase H cycle and the Cas9 / deoxyribonuclease cascade reaction, resulting in a synchronous amplification of the fluorescence signal.

[0057] Appendix Figure 3 The linear regression curve is plotted based on the aforementioned fluorescence data. The logarithm of the glyphosate standard solution concentration (logC) is used as the abscissa, and the change in fluorescence intensity at the corresponding concentration (F-F0) is used as the ordinate. The linear fitting results show an excellent linear correlation between the change in fluorescence intensity and the logarithm of concentration over a wide concentration range from 0.05 μg / L to 1000 μg / L. The obtained linear regression equation is: F-F0 = 4006logC + 8563, with a correlation coefficient R² of 0.9908, fully demonstrating the accuracy and reliability of the detection system. The limit of detection (LOD) of this method is calculated to be as low as 8.26 ng / L using the 3-standard deviation method (LOD = 3σ / k). These results indicate that the detection platform constructed in this invention not only has a wide measurement range but also possesses extremely high sensitivity, meeting the quantitative analysis needs for trace glyphosate residues in environmental water bodies and food safety.

[0058] Example 3

[0059] Anti-interference experiment

[0060] 1) Selection of interfering substances

[0061] Other commonly used pesticides in agricultural production were selected: diuron, chlorpyrifos, mesotrione, carbaryl, and acetochlor. They were added at a concentration 10 times that of glyphosate in the control group, which was 1 mg / L.

[0062] 2) The experimental procedure was performed according to the steps in Example 2, and the fluorescence intensity of each group was measured.

[0063] 3) Experimental Results

[0064] As attached Figure 4 As shown, compared with other interfering groups, the glyphosate group showed a significant increase in fluorescence intensity at 670 nm, proving that the detection system has good anti-interference ability.

[0065] Example 4

[0066] The glyphosate detection capability of the testing system was evaluated using the standard spiking method.

[0067] 1) Sample pretreatment

[0068] Soybean and corn samples: Take 1 g of soybean or corn, soak it in 10 mL of GLYP reaction buffer, incubate overnight at 4 ℃, then grind and homogenize, and finally sonicate for 30 min; centrifuge at 5000 ×g for 10 min, take the supernatant and filter it through a 0.22 μM polyvinylidene fluoride (PVDF) filter membrane, take 1 mL of the filtrate and mix it with an equal volume of 1 mg / L or 0.1 mg / L glyphosate solution to use as the test solution;

[0069] Soil sample: Take 1 g of soil sample, add 10 mL of GLYP reaction buffer and mix. Centrifuge at 5000 × g for 10 min. Take the supernatant and filter it through a 0.22 μM PVDF filter membrane. Take 1 mL of the filtrate and mix it with an equal volume of 1 mg / L glyphosate solution to use as the test solution.

[0070] Water sample: Take 10 mL of river water sample and filter it through a 0.22 μM PVDF filter membrane. Take 1 mL of the filtrate and mix it with an equal volume of 1 mg / L glyphosate solution to use as the test solution.

[0071] The prepared test solution was used in the detection method of Example 2;

[0072] 2) Spiked recovery experiment

[0073] The recovery rate was calculated by following the steps in Example 2 (recovery rate = detected concentration / added concentration * 100%).

[0074] 3) Results

[0075] Table 1: Detection results of glyphosate using this method in the standard spiking method

[0076]

[0077] As shown in Table 1, the glyphosate fluorescence detection method of the present invention showed a recovery rate of 100.03-107.94% in spiked actual samples, with a relative standard deviation (RSD) between 2.34-4.71%, all of which demonstrated good feasibility and met the accuracy requirements for environmental testing.

Claims

1. A method for detecting glyphosate fluorescence based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / deoxyribozyme, comprising the following steps: 1) Preparation of Aptamer / cDNA complex: cDNA and biotin-labeled Aptamer aptamer were added to nucleic acid binding buffer at a molar ratio of 1:1, heated at 90-95 °C for 3-5 min, and then cooled to room temperature to form Aptamer / cDNA complex. Preparation of gRNA / Block-RNA complex: gRNA and Block-RNA were added to nucleic acid binding buffer at a molar ratio of 1:1, heated at 90-95 °C for 3-5 min, and then cooled to room temperature to form gRNA / Block-RNA complex. Preparation of cA@MB: 1 mg of streptavidin-labeled magnetic beads (MB) and 600 pmol of Aptamer / cDNA complex were added to 400 μL of nucleic acid binding buffer and incubated in a vortex mixer at 37 °C for 1–2 h. Subsequently, the prepared cDNA / Aptamer@MB, i.e., cA@MB, was collected by magnetic separation, washed 3–6 times with GLYP reaction buffer, and stored at 4 °C for later use. Preparation of gB@MB: 1 mg of streptavidin-labeled MB and 600 pmol of gRNA / Block-RNA complex were added to 400 μL of nucleic acid binding buffer and incubated in a vortex mixer at 37 °C for 1-2 h. Subsequently, the prepared gRNA / Block-RNA@MB, i.e., gB@MB, was collected by magnetic separation, washed 3-6 times with GLYP reaction buffer, and stored at 4 °C for later use. 2) Weigh out glyphosate standard, prepare a 1 mg / L stock solution with GLYP reaction buffer, and then dilute it stepwise with GLYP reaction buffer to prepare glyphosate standard solutions with concentrations of 0.05 μg / L to 1000 μg / L. 3) Add 40 μg of cA@MB to 150 μL of glyphosate standard solutions of different concentrations, and replenish the reaction system volume to 200 μL with GLYP reaction buffer. After incubation at 37 ℃ for 1~3 h, remove cA@MB by magnetic separation. 4) Add 80 μg of gB@MB and 4 U of RNase H to the solution obtained in step 3), and add RNase H reaction buffer to make up the reaction volume to 500 μL. React at 37 °C for 15-30 min. Then remove gB@MB by magnetic separation. Heat the supernatant at 70-80 °C for 5-10 min to inactivate RNase H. 5) Preparation of FL-DNAzyme / Block-DNA complex: FL-DNAzyme and Block-DNA were added to Cas9-specific buffer at a molar ratio of 1:1 and heated at 90-95 °C for 3-5 min, then cooled to room temperature to form the FL-DNAzyme / Block-DNA complex; after the solution in step 4) cooled to room temperature, 4 μL of Cas9 protein was added to make a final concentration of 40 nM, and then incubated at room temperature for 8-15 min. Then, 80 pmol of FL-DNAzyme / Block-DNA complex and 160 pmol of substrate labeled with fluorescent and quenching groups were added, and the volume was made up to 1000 μL with Cas9-specific buffer. The reaction was carried out at 37 °C for 35-45 min. 6) Measure the fluorescence intensity of the solution obtained in step 5) at 670 nm using a fluorescence spectrometer. The excitation wavelength for fluorescence detection is 590 nm, the emission wavelength is 670 nm, and the slit width is 5 nm. Perform linear regression with the logarithm of the concentration of glyphosate standard solution (logC) as the abscissa and the fluorescence intensity at 670 nm (F-F0) as the ordinate to plot a standard curve of "fluorescence intensity at 670 nm - logarithm of concentration of glyphosate standard solution". 7) After performing the operations in steps 3) to 5) on 150 μL of the sample solution to be tested, the fluorescence intensity of the sample solution at 670 nm is measured using a fluorescence spectrometer. The fluorescence intensity value at 670 nm is substituted into the standard curve obtained in step 6) to calculate the concentration of glyphosate in the sample solution, thereby realizing the fluorescence detection of glyphosate in the sample to be tested.

2. The glyphosate fluorescence detection method based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / DNAzyme as described in claim 1, characterized in that: The preparation and purification of Cas9 were as follows: The plasmid pET-NLS-Cas9-6xHi expressing Cas9 protein was transformed into BL21 *E. coli* competent cells, then plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37 °C. Single colonies were picked and inoculated into LB liquid medium, and cultured at 37 °C with shaking at 220 rpm. When the OD600 reached 0.6–0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM, followed by induction at 16–20 °C for 16–20 h to obtain recombinant Cas9 protein. The cells were then collected by centrifugation, sonicated, and the supernatant was purified by nickel column affinity chromatography. Elution was performed using imidazole buffer of different concentrations, and the target protein fraction was collected. SDS-PAGE confirmed a purity ≥95%. The protein was desalted using ultrafiltration and diluted to 10 μL with Cas9-specific buffer. The resulting Cas9 stock solution with a protein concentration of μM was aliquoted and stored at -80 °C.

3. The glyphosate fluorescence detection method based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / DNAzyme as described in claim 1, characterized in that: The nucleic acid binding buffer was a deionized aqueous solution of 10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, and 0.05% Tween-20, pH 7.5; the GLYP reaction buffer was a deionized aqueous solution of 10 mM Tris-HCl, 150 mM NaCl, 10 mM KCl, and 22.5 mM MgCl2, pH 7.5; the RNase H reaction buffer was a deionized aqueous solution of 20 mM Tris-HCl, 40 mM KCl, 8 mM MgCl2, and 1 mM DTT, pH 7.8; and the Cas9-specific buffer was a deionized aqueous solution of 50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, and 100 μg / mL bovine serum albumin, pH 7.

9.

4. The glyphosate fluorescence detection method based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / DNAzyme as described in claim 1, characterized in that: The nucleotide sequences of the biotin-labeled Aptamer aptamer are shown in SEQ ID NO.1; the nucleotide sequences of the cDNA are shown in SEQ ID NO.2; the nucleotide sequences of the Block-RNA are shown in SEQ ID NO.3, where T represents uracil U in the RNA; the nucleotide sequences of the gRNA are shown in SEQ ID NO.4, where T represents uracil U in the RNA; the nucleotide sequences of the FL-DNAzyme are shown in SEQ ID NO.5; the nucleotide sequences of the Block-DNA are shown in SEQ ID NO.6; and the nucleotide sequences of the substrates labeled with fluorescent and quencher groups are shown in SEQ ID NO.

7.

5. The glyphosate fluorescence detection method based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / DNAzyme as described in claim 1, characterized in that: The reaction buffer was serially diluted to prepare glyphosate standard solutions with concentrations of 0.05 μg / L, 0.1 μg / L, 0.5 μg / L, 1 μg / L, 5 μg / L, 10 μg / L, 50 μg / L, 100 μg / L, 500 μg / L, and 1000 μg / L.

6. The glyphosate fluorescence detection method based on RNase H cyclic amplification using magnetic beads-aptamer-Cas9 / DNAzyme as described in claim 1, characterized in that: The sample solution to be tested is a soil extract, a water sample, or an agricultural product extract.