Physical unclonable anti-counterfeiting material based on DNA (Deoxyribose Nucleic Acid) nanostructure as well as preparation method and application thereof
By using flexible double-stranded DNA nanostructures and multispectral fluorescent group modification, the incompatibility between traditional physically non-clonable anti-counterfeiting materials and DNA systems has been solved, achieving multidimensional encryption and biocompatibility. This technology is suitable for information encryption authentication, biomedical authentication, and anti-counterfeiting of DNA storage chips.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
- Filing Date
- 2026-04-02
- Publication Date
- 2026-05-01
AI Technical Summary
Traditional physical, non-clonable anti-counterfeiting materials are incompatible with molecular platforms and lack sufficient encryption capabilities, failing to meet the security authentication requirements of DNA systems.
A multidimensional encrypted structure is formed by using DNA nanostructures, forming DNA trimers through flexible double-stranded connections, and modifying them with fluorophores of different spectra.
It achieves strong biocompatibility and compatibility, possesses multi-dimensional encryption capabilities, can operate stably on various substrates, and meets the needs of information encryption authentication, biomedical authentication, and anti-counterfeiting of DNA storage chips.
Smart Images

Figure CN121950294A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of information security technology and nanobiotechnology, specifically to physically clonable anti-counterfeiting materials based on DNA nanostructures, their preparation methods, and applications. Background Technology
[0002] With the rapid development of the Internet of Things and the digital economy, the demand for secure and tamper-proof identity verification systems is becoming increasingly urgent. Currently, mainstream security solutions include software encryption based on mathematical algorithms and hardware-based, physically unclonable anti-counterfeiting materials based on physical randomness. Software encryption relies on one-way mathematical functions, making it vulnerable to quantum computing and massively parallel attacks; while physically unclonable anti-counterfeiting materials utilize uncontrollable physical fluctuations during microfabrication to generate unique and uncopyable characteristics, possessing advantages against physical cloning and computational modeling attacks.
[0003] However, traditional physically non-clonable anti-counterfeiting materials have significant limitations: First, they rely on random microfabrication processes, resulting in poor scalability and difficulty in integration with emerging platforms such as molecular computing and biosensing; second, most existing physically non-clonable anti-counterfeiting materials are non-biocompatible (such as silicon-based and polymer-based materials), making them unsuitable for scenarios such as DNA computing networks and live bio-authentication; third, they have a single encryption dimension, limited information entropy, and low information security. DNA molecules possess programmable self-assembly properties, achieving significant progress in molecular computing and data storage, and offering advantages such as large-scale parallel processing capabilities and biocompatibility. However, the physical mechanisms of traditional electronically physically non-clonable anti-counterfeiting materials are completely incompatible with the biochemical environment of DNA, failing to meet the security authentication requirements of DNA systems.
[0004] Therefore, there is an urgent need in this field for a biocompatible, scalable, and seamlessly integrated multidimensional physically non-clonable anti-counterfeiting material that can solve the problems of incompatibility and insufficient encryption performance of traditional physically non-clonable anti-counterfeiting materials with molecular platforms, and to provide a new method for information encryption using DNA nanostructures. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention aims to provide a physically unclonable anti-counterfeiting material based on DNA nanostructures. By using DNA nanostructures for information encryption, this invention solves the problems of incompatibility between traditional physically unclonable anti-counterfeiting materials and molecular platforms, as well as insufficient encryption performance.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: A physically unclonable anti-counterfeiting material based on DNA nanostructures comprises a DNA trimer formed by three tetrahedral DNA monomers linked by flexible double strands, each of the tetrahedral DNA monomers being modified with a fluorophore of a different spectrum.
[0007] In some embodiments, each of the three tetrahedral DNA monomers is formed by the self-assembly of eight DNA strands.
[0008] In some embodiments, the three tetrahedral DNA monomers are composed of the following: DNA monomer 1 is composed of sequences SEQ ID No. 1-SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 9; DNA monomer 2 is composed of sequences SEQ ID No. 1-SEQ ID No. 7 and SEQ ID No. 10; and DNA monomer 3 is composed of sequences SEQ ID No. 1-SEQ ID No. 7 and SEQ ID No. 10.
[0009] In some embodiments, the fluorophore is a fluorescent dye capable of being labeled onto a DNA strand.
[0010] Preferably, the fluorophores include cyanine dyes Cy3 and Cy5, and Alexa Fluor dyes AF488, AF561, and AF610.
[0011] The preparation method of the above-mentioned physically clonable anti-counterfeiting material based on DNA nanostructures includes the following steps: S1. Add the DNA strands required for preparing three DNA monomers in equal molar ratios to the reaction system, and anneal them to obtain three solutions containing DNA monomers. One DNA monomer has two segments of specific DNA single strand I extending from its side edge, and the other two DNA monomers have specific DNA single strand II extending from their side edges, which are complementary to the specific single strands. The specific DNA single strand I and the specific DNA single strand II are both partial regions on the DNA single strands that constitute the DNA monomer. S2. The solution containing DNA monomers was purified and concentrated using high performance liquid chromatography. S3. Incubate the three purified and concentrated DNA monomers in an equal molar ratio to allow the specific DNA single strands to hybridize in pairs according to the base complementary pairing principle to form a flexible DNA double strand, thus obtaining a DNA trimer. S4. Randomly modify the three DNA monomers of the DNA trimer with different spectral fluorophores to obtain the physically clonable anti-counterfeiting material.
[0012] Further, the reaction conditions in step S1 are as follows: DNA strands required for preparing three tetrahedral DNA monomers are added to the TM buffer solution in an equimolar ratio, with a final concentration of 1 μM for each DNA strand. The mixture is heated at 95°C for 5-10 min and annealed at 4°C for at least 20 min to obtain three solutions containing DNA monomers. The composition of the TM buffer solution is: 20 mM Tris, 50 mM MgCl2, pH 7.4-8.2.
[0013] Preferably, the reaction conditions in step S1 are as follows: DNA strands required for preparing three tetrahedral DNA monomers are added to the TM buffer solution in an equimolar ratio, with a final concentration of 1 μM for each DNA strand. The mixture is heated at 95°C for 10 min and annealed at 4°C for 20 min to obtain three solutions containing DNA monomers. The composition of the TM buffer solution is: 20 mM Tris, 50 mM MgCl2, pH 8.0.
[0014] Furthermore, the mobile phase buffer solution used for purification in step S2 consists of 25 mM Tris-HCl, 450 mM NaCl, pH 7.0-8.0, and a flow rate of 0.8-1.0 mL / min; concentration is performed using a 30 kDa ultrafiltration tube and centrifuged at 6000 rpm for 15 min.
[0015] Preferably, the mobile phase buffer solution used for purification in step S2 consists of 25 mM Tris-HCl, 450 mM NaCl, pH 7.2, and a flow rate of 0.8 mL / min; concentration is performed using a 30 kDa ultrafiltration tube and centrifugation at 6000 rpm for 15 min.
[0016] Furthermore, the incubation conditions in step S3 are: incubation at 37 ℃ for 1 h.
[0017] The present invention also provides the application of the physically clonable anti-counterfeiting material based on DNA nanostructures as described above, wherein the anti-counterfeiting material is used in information encryption authentication, biomedical authentication, flexible electronic anti-counterfeiting or DNA storage chip anti-counterfeiting.
[0018] Furthermore, when applied to anti-counterfeiting of DNA storage chips, sites where DNA nanostructures are present are defined as "1" in binary ASCII code, and sites without DNA nanostructures are defined as "0" in binary ASCII code, and the anti-counterfeiting material is assembled onto the DNA storage chip.
[0019] The beneficial effects of this invention are as follows: 1) Achieving the unity of deterministic preparation and random features: By combining the deterministic self-assembly of DNA nanostructures with the dynamic flexibility of DNA double strands, the scalability of the preparation is guaranteed, and the PUF is endowed with random and unreplicable geometric fingerprints, breaking through the limitations of traditional PUFs that rely on random manufacturing differences.
[0020] 2) Excellent security performance: The random nanogeometric configuration can effectively resist physical cloning and computational modeling attacks, the integration of multispectral fluorophores realizes multidimensional encryption, and the ultra-high information entropy of 4.3 bits / pixel further enhances the security of the authentication system.
[0021] 3) Strong biocompatibility and compatibility: The material has natural biocompatibility and can be seamlessly compatible with DNA computing systems and DNA data storage systems, expanding application scenarios.
[0022] 4) Wide adaptability: It can operate stably on various substrates such as flexible polymers and biological epidermis, and can meet the needs of multiple fields such as information encryption authentication, biomedical authentication, flexible electronic anti-counterfeiting and DNA storage chip anti-counterfeiting.
[0023] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings. Attached Figure Description
[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, some of the drawings in the following description are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0025] Figure 1 This is a schematic diagram illustrating the assembly principle of the physically clonable anti-counterfeiting material based on DNA nanostructures described in this invention.
[0026] Figure 2 This is a schematic diagram of the DNA trimer structure with three random topological angles as shown in Embodiment 2 of the present invention, and the corresponding atomic force microscope (AFM) images.
[0027] Figure 3 This is an atomic force imaging diagram of the DNA trimer structure synthesized in the solution phase as shown in Example 2 of the present invention.
[0028] Figure 4 This is a schematic diagram illustrating the generation of optical tags with different emission lights from the optically labeled DNA trimer structure shown in Embodiment 3 of the present invention.
[0029] Figure 5 This is an example of the anti-counterfeiting application of a storage chip based on a physically non-clonable anti-counterfeiting material with a DNA nanostructure, as shown in Example 3 of the present invention. Detailed Implementation
[0030] To better describe the present invention, specific embodiments are provided below for further explanation. Unless otherwise specified, the methods in the following embodiments are conventional methods.
[0031] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field; unless otherwise specified, the reagents or materials described are all from commercial sources.
[0032] The following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental conditions not specifically stated in the examples are generally performed under conventional conditions or as recommended by the reagent company; reagents, consumables, etc., used in the following examples are commercially available unless otherwise specified.
[0033] The following examples pertain to the intermediate compounds and final products identified in the specification and synthetic regimens. The preparation of the compounds of the present invention is described in detail using the following examples, but the described chemical reactions are disclosed in accordance with their general applicability to the preparation of the compounds of the present invention. Sometimes, the reactions may not be applicable to every compound within the scope of the present invention as described. Compounds in which this may occur are readily identifiable to those skilled in the art. In these cases, the reactions can be successfully carried out with conventional modifications known to those skilled in the art. In all preparation methods, all starting materials are known or can be readily prepared using known starting materials. All temperatures are given in degrees Celsius, and unless otherwise explicitly stated, all parts and percentages are in moles when referring to yields, and all parts are in volumes when referring to solvents and eluents.
[0034] Example 1: Preparation of DNA Nanostructures 1.1 Experimental Materials and Instruments: Reagents: DNA strands (selected from SEQ ID No. 1-SEQ ID No. 10) required for DNA monomer structure synthesis were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; APTES were purchased from Sigma-Aldrich; other analytical grade inorganic reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.; the solvent used in the experiment was Milli-Q ultrapure water (resistivity 18.25 MΩ·cm). -1 ); TM buffer solution (20 mM Tris, 50 mM MgCl2, pH 8.0); HPLC buffer solution (25 mM Tris, 450 mM NaCl, pH 7.4).
[0035] Instruments: UV-Vis spectrophotometer (Carry-100, Agilent); PCR instrument C100 (Bio-Rad); 100kDa ultrafiltration tubes (Millipore); centrifuge (Eppendorf); Nanodrop (Thermo); gel electrophoresis system PowerPac (Bio-Rad); atomic force microscopy imaging system (AFM, Bruker, MultiMode 8-HR); fluorescence microscope IX73 (Olympus).
[0036] 1.2 Preparation of DNA nanostructures: like Figure 1 As shown, the assembly principle of the physically unclonable anti-counterfeiting material based on DNA nanostructures of the present invention is as follows: Three tetrahedral DNA monomer structures, with their side edges extending into specific DNA single strands, hybridize in pairs through base complementarity pairing to form a thermodynamically flexible DNA double strand. This flexible double strand allows the three monomer structures to exhibit various relative orientations in space, thereby forming a DNA trimer structure with a random nanoscale geometric configuration. This assembly process combines deterministic self-assembly with random configuration characteristics, forming the structural basis for achieving physically unclonable functionality. In this embodiment, it can be prepared according to the following specific steps: (1) Assembly of DNA monomers: Eight DNA strands required for each DNA monomer were selected and added to TM buffer solution in an equimolar ratio to ensure a final concentration of 1 μM for each strand. The above solutions were heated at 95°C for 10 min in a temperature-controlled device (such as a PCR instrument), and then rapidly annealed to 4°C and held for 20 min to obtain solutions containing DNA monomer 1, DNA monomer 2, and DNA monomer 3, respectively. The composition of each DNA monomer is as follows: DNA monomer 1: strands 1-6, 8, and 9; DNA monomer 2: strands 1-7 and 10; DNA monomer 3: strands 1-7 and 10.
[0037] (2) Purification: The above solution was purified using the AKTA fully automated nucleic acid extraction and purification system. The mobile phase buffer solution was 25 mM Tris-HCl and 450 mM NaCl, pH 7.2, the flow rate was 0.8 mL / min, and the absorption wavelength was 260 nm. The column was first equilibrated with Milli-Q ultrapure water for 1 h, and then equilibrated with the mobile phase for 30 min. 500 μL of the above solution was injected into the syringe, and the eluent corresponding to the second peak (uniformly dispersed DNA nanostructures) was collected. This process was repeated three times.
[0038] (3) Concentration and quantification: The collected liquid was concentrated using a 0.5 mL 30 kDa ultrafiltration tube and centrifuged at 6000 rpm for 15 min. 1 μL of the concentrated liquid was added to 49 μL of TM buffer solution, and the DNA nanostructure was quantified using Nanodrop.
[0039] (4) Preparation of DNA trimers: The three quantified DNA monomer structures were incubated at 37°C for 1 h in an equimolar ratio to obtain DNA trimer structures. The trimers were linked by DNA double strands and had thermodynamic flexibility. Among them, the sequences of strands 8 and 9 that make up DNA monomer 1 both include pairing region ①, whose sequence is: GTGCTTGGTAACATAGGTGCACAGCTACCGGCTTT; the sequences of strands 10 that make up DNA monomer 2 and DNA monomer 3 include pairing region ② that is complementary to pairing region ①, whose sequence is: AAAGCCGGTAGCTGTGCACCTATGTTACCAAGCAC. Pairing regions ① and ② form flexible double strands after incubation.
[0040] The DNA strand sequence required for the synthesis of DNA monomer structures is as follows: Chain 1 sequence (5'-3'): SEQ ID No. 1: CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG; Chain 2 sequence (5'-3'): SEQ ID No. 2: CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG; Chain 3 sequence (5'-3'): SEQ ID No. 3: CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG; Chain 4 sequence (5'-3'): SEQ ID No. 4: CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGGACGGCAGGC; Chain 5 sequence (5'-3'): SEQ ID No. 5: GCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG; Chain 6 sequence (5'-3'): SEQ ID No. 6: CGGTATTATTCTCATGGGTTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG; Chain 7 sequence (5'-3'): SEQ ID No. 7: GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC; Chain 8 sequence (5'-3'): SEQ ID No. 8: GTGCTTGGTAACATAGGTGCACAGCTACCGGCTTTGCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC; Chain 9 sequence (5'-3'): SEQ ID No. 9: GTGCTTGGTAACATAGGTGCACAGCTACCGGCTTCGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC; Chain 10 sequence (5'-3'): SEQ ID No. 10: AAAGCCGGTAGCTGTGCACCTATGTTACCAAGCACCGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC.
[0041] Example 2 Characterization of Physically Unclonable Anti-counterfeiting Materials Based on DNA Nanostructures 2.1 The DNA trimer structure was imaged and verified using atomic force microscopy (AFM): (1) Sample preparation: Take 30 μL of 0.5% APTES solution and drop it onto the surface of the freshly peeled mica substrate. Let it stand for 2 min. Rinse the surface of the mica substrate with Milli-Q ultrapure water and then dry it with pure N2. Take 10 μL of 10 nM DNA trimer solution and drop it onto the dried mica substrate. After incubating for 5 min, add 20 μL of TM buffer.
[0042] (2) AFM imaging: A Bruker Multimode atomic force microscope was used, configured in peak force mode, and a Fluid+ AFM probe was used for imaging detection.
[0043] like Figure 2 As shown, AFM imaging results revealed that the DNA trimer structure exhibited three typical random topological angle configurations on the mica surface (approximately 60°, 90°, and 120°, respectively), and each configuration could be clearly imaged by AFM, verifying that the flexible DNA double-strand connection method endows the trimer structure with random geometric configuration characteristics at the nanoscale.
[0044] like Figure 3 As shown, the DNA trimer structure synthesized in the solution phase was further confirmed by AFM imaging. The trimers are connected by flexible DNA double strands, and the overall structure exhibits diverse spatial orientations. The morphology of individual trimers shows asymmetric and non-reproducible characteristics, which proves its physical non-cloning at the microscopic level.
[0045] 2.2 Optical Marking and Multidimensional Encryption: 1) To verify that DNA trimer nanostructures can be used for multidimensional optical encryption, fluorophores with different spectra were randomly modified at the vertices of the DNA monomer structures used to assemble the DNA trimer, giving them different emission colors.
[0046] 2) such as Figure 4 As shown, by fluorescently labeling the DNA trimer structure, two fluorophores, Cy3 (green) and Cy5 (red), were introduced to label the DNA monomers on both sides of the DNA trimer structure. Due to the randomness of the angle between the DNA trimer structures, the linear distance between the Cy3 and Cy5 fluorophores is uncontrollable. Furthermore, due to the distance-dependent fluorescence resonance energy transfer (FRET) effect between Cy3 and Cy5, the fluorescence signal generated by each trimer structure is random. Figure 4 (Right half). When Cy3 and Cy5 fluorophores are modified at specific locations in rigid nanostructures (e.g., DNA origami structures), the FRET effect is determined because the linear distance between the fluorophores is fixed. Therefore, the fluorescence signal generated by the fluorophores labeled with rigid structures does not have randomness.
[0047] 3) Further, in other embodiments, other fluorophores with different emission spectra, such as Alexa488, can be introduced. Since the modification positions and combinations of fluorophores are random, each trimer structure can generate a unique optical tag, thereby achieving multi-dimensional optical encryption. Specifically, based on three different fluorophore modifications, 20 fluorescence combinations can be obtained (R, G, B, RR, GG, BB, RG, RB, GB, RRR, GGG, BBB, RRG, RRB, RGG, RBB, GGR, GRR, RGB, and None without fluorescence modification, where R represents Cy5 modification, G represents Cy3 modification, and B represents Alexa488 fluorescence modification). According to the Shannon entropy calculation formula: ,in Let be the probability of any given fluorescent combination occurring. n Given the number of fluorescent combinations, an ultra-high information entropy of 4.3 bits / pixel can be calculated.
[0048] Example 3: Application of Physically Unclonable Anti-counterfeiting Materials Based on DNA Nanostructures Taking DNA storage chip anti-counterfeiting as an example, this study verifies that DNA trimer nanostructures can be applied to the anti-counterfeiting of DNA storage chips: (1) Randomly modify the DNA monomer structure apex of the DNA trimer with fluorophores of different spectra to give it different emission colors; (2) The site where DNA nanostructure exists is defined as "1" in binary ASCII code, and the site where DNA nanostructure does not exist is defined as "0" in binary ASCII code. The anti-counterfeiting material is then assembled onto the DNA storage chip accordingly. (3) such as Figure 5 As shown, the two DNA storage chips store the same content, with the binary information being "1111110110...1000010011" (read from left to right and top to bottom). However, because each DNA nanostructure exhibits a different fluorescent color, the fluorescent pattern on each chip is random and unique. The binary information and optical anti-counterfeiting pattern can be read simultaneously using a fluorescence microscope, successfully realizing an anti-counterfeiting application of a non-cloneable optical storage chip based on a random optical tag with a DNA trimer structure.
[0049] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0050] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A physically clonable anti-counterfeiting material based on DNA nanostructures, characterized in that, It includes a DNA trimer formed by three tetrahedral DNA monomers linked by flexible double strands, each of which is modified with a fluorophore of a different spectrum; The flexible double strand is formed by base complementation of a portion of the DNA strand that constitutes the DNA monomer.
2. The physically clonable anti-counterfeiting material based on DNA nanostructures as described in claim 1, characterized in that, Each of the three tetrahedral DNA monomers is formed by the self-assembly of eight DNA strands.
3. The physically clonable anti-counterfeiting material based on DNA nanostructures as described in claim 2, characterized in that, The three tetrahedral DNA monomers are composed of the following sequences: DNA monomer 1 is composed of sequences SEQ ID No. 1-SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 9; DNA monomer 2 is composed of sequences SEQ ID No. 1-SEQ ID No. 7 and SEQ ID No. 10; and DNA monomer 3 is composed of sequences SEQ ID No. 1-SEQ ID No. 7 and SEQ ID No.
10.
4. The physically clonable anti-counterfeiting material based on DNA nanostructures as described in claim 1, characterized in that, The fluorophore is a fluorescent dye that can be labeled onto the DNA strand.
5. The physically clonable anti-counterfeiting material based on DNA nanostructures as described in claim 4, characterized in that, The fluorophores include cyanine dyes Cy3 and Cy5, and Alexa Fluor dyes AF488, AF561, and AF610.
6. A method for preparing a physically clonable anti-counterfeiting material based on DNA nanostructures as described in any one of claims 1-5, characterized in that, Includes the following steps: S1. Add the DNA strands required for preparing three DNA monomers in equal molar ratios to the reaction system, and anneal them to obtain three solutions containing DNA monomers. One DNA monomer has two segments of specific DNA single strand I extending from its side edge, and the other two DNA monomers have specific DNA single strand II extending from their side edges, which are complementary to the specific single strands. The specific DNA single strand I and the specific DNA single strand II are both partial regions on the DNA single strands that constitute the DNA monomer. S2. The solution containing DNA monomers was purified and concentrated using high performance liquid chromatography. S3. Incubate the three purified and concentrated DNA monomers in an equal molar ratio to allow the specific DNA single strands to hybridize in pairs according to the base complementary pairing principle to form a flexible DNA double strand, thus obtaining a DNA trimer. S4. Randomly modify the three DNA monomers of the DNA trimer with different spectral fluorophores to obtain the physically clonable anti-counterfeiting material.
7. The preparation method according to claim 6, characterized in that, The reaction conditions in step S1 are as follows: DNA strands required for preparing three tetrahedral DNA monomers are added to TM buffer solution in an equimolar ratio, with a final concentration of 1 μM for each DNA strand. The mixture is heated at 95°C for 5-10 min and annealed at 4°C for at least 20 min to obtain three solutions containing DNA monomers. The composition of the TM buffer solution is: 20 mM Tris, 50 mM MgCl2, pH 7.4-8.
2.
8. The preparation method according to claim 6, characterized in that, The mobile phase buffer solution used for purification in step S2 consisted of 25 mM Tris-HCl, 450 mM NaCl, pH 7.0-8.0, and a flow rate of 0.8-1.0 mL / min. Concentration was performed using a 30 kDa ultrafiltration tube and centrifuged at 6000 rpm for 15 min.
9. The preparation method according to claim 6, characterized in that, The incubation conditions in step S3 are: 37 ℃ for 1 h.
10. The application of a physically clonable anti-counterfeiting material based on a DNA nanostructure prepared by any one of claims 1-5 or any one of claims 6-9, characterized in that, The anti-counterfeiting material is used in information encryption authentication, biomedical authentication, flexible electronic anti-counterfeiting, or DNA storage chip anti-counterfeiting.
Citation Information
Patent Citations
Tetrahedral DNA-mediated assembly fluorescent nano biological probe, preparation method and application
CN110066851A
Multi-color fluorescent probe based on DNA nanostructure as well as preparation method and application of multi-color fluorescent probe
CN111440610A
Dual-mode biosensor for in-situ detection of coding single nucleotide polymorphism and preparation method of dual-mode biosensor
CN117887818A
Biosensor as well as preparation method and application thereof
CN119020471A
Molecular identity authentication system and method based on layered assembly of DNA origami framework
CN121580379A