Yak intestinal tract source pediococcus acidilactici in Tibetan Namji county and fat reducing application thereof

Abstract

The invention relates to the technical field of probiotics, in particular to intestinal tract source pediococcus acidilactici of Yanqu county in Tibet and fat reducing application thereof. The pediococcus acidilactici disclosed by the invention is preserved in the China General Microbiological Culture Collection Center on April 29, 2025, and the preservation number is CGMCC NO.34406; the strain has the characteristics of acid resistance, cholate resistance and stress resistance, and has high survival rate and planting efficiency; the strain is free of hemolysis, free of toxic factors and high in safety; the strain can secrete short-chain fatty acid and antibacterial peptide, inhibit pathogenic bacteria and promote intestinal barrier repair; short-chain fatty acid generated by metabolism of most of carbon water by the strain can be directly absorbed by intestinal epithelial cells, and can be used as an energy substance to replace partial glucose demand, so that the metabolism energy consumption is reduced, the energy conversion rate of feed is improved, the feed conversion is promoted, and the effects of reducing fat and weight and improving the non-alcoholic fatty liver disease are achieved.

Description

Technical Field

[0001] This invention relates to the field of probiotics technology, and in particular to a type of Pyotrophic lateral scab derived from the intestinal tract of yaks in Nagqu County, Tibet, and its application in weight loss. Background Technology

[0002] Studies on gut probiotics in Tibetan yaks have shown their potential to improve breeding efficiency and food safety. Lactic acid bacteria can also improve the uterine environment in cows. These findings provide new ideas for antibiotic alternatives and provide foundational data for the development of probiotic supplements. Tibetan yaks (Bos grunniens) are ancient livestock adapted to the harsh environment of the Qinghai-Tibet Plateau, and their gut microbiota has a significant impact on health and production performance. Microbial diversity and composition affect the immune system, nutrient absorption, and growth performance. They are mainly composed of bacteria, fungi, and archaea, with Firmicutes and Bacteroidetes being the dominant phyla. These microorganisms form an ecosystem through interactions and metabolism, maintaining host physiological balance and health. The composition of the yak gut microbiota is influenced by diet, season, and environment. Studies show significant differences in gut bacteria under different seasonal feed types. Under nutrient-rich diets, Firmicutes and Bacteroidetes dominate, increasing bacterial diversity and abundance, and affecting nutrient metabolism and immune regulation.

[0003] The gut microbiota of highland yaks plays an ecological role in nutrient metabolism, immune regulation, and disease resistance. High-altitude environmental factors, including altitude, temperature, and feed availability, significantly influence the composition and function of the yak gut microbiota. Under varying nutritional stress conditions, the gut microbiota dynamically changes to adapt to its environment. During winter when feed is scarce, microbiota diversity declines, potentially leading to weakened metabolic function and health problems. Feed management tailored to environmental changes and probiotic supplementation can help improve gut health and production performance, supporting the development of highland animal husbandry.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of Pyocortisone lactis from the intestinal tract of yaks in Nagqu County, Tibet, and its fat-reducing application. This strain is a probiotic with excellent probiotic properties selected after being isolated, screened, and identified from yak feces, providing a new candidate strain for animal feed additives.

[0006] In a first aspect, the present invention provides a Pediococcus acidilactici strain from the intestinal tract of yak in Nagqu County, Tibet, named ZX-22. The Pediococcus acidilactici strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.34406 and deposit date of April 29, 2025.

[0007] Through extensive testing, this invention has isolated a probiotic from yak feces, namely Pediococcus lactis ZX-22, which is derived from the intestinal tract of yaks in Nagqu County, Tibet. This Pediococcus lactis not only has acid and bile salt resistance, but also does not hemolyze and has no toxic factors, thus exhibiting high safety.

[0008] The 16S rRNA sequence of *Pediococcus lactis* ZX-22 of the present invention is shown in SEQ ID NO: 1.

[0009] Preferably, the *Pediococcus lactis* of the present invention is in biologically pure culture form.

[0010] Optionally, the lactic acid cocci can be in live cell form or non-live cell form, with the live cell form being preferred.

[0011] A second aspect of the invention provides a mutant or variant of the said *Pediococcus lactis* ZX-22.

[0012] Preferably, the mutant or variant can be genetically modified or naturally occurring.

[0013] A third aspect of the present invention provides a method for culturing Pediococcus lactis, comprising the following steps: Fresh yak dung samples were added to MRS liquid culture medium and incubated at 37°C for 48 hours. The bacterial culture was diluted with PBS, spread on MRS solid medium, and then anaerobically cultured at 37°C for 24-48 hours. Select colonies that are smooth and white or milky white in appearance; Three streak purifications were performed on MRS solid medium. Single colonies were picked and inoculated into MRS liquid medium. After anaerobic culture at 37°C for 12-24 hours, the bacterial culture was shaken to mix thoroughly. The culture was then mixed with glycerol at a 1:1 ratio and stored at -80°C.

[0014] In a fourth aspect, the present invention provides a microbial preparation containing the aforementioned Pediococcus lactis.

[0015] Preferably, the content of Pediococcus lactis in the microbial preparation is 1x10⁻⁶. 6CFU / mL or higher; more preferably, the viable count of Pediococcus lactis in the microbial preparation is 1 x 10⁻⁶. 6 CFU / mL or higher.

[0016] Preferably, the content of Pediococcus lactis in the microbial preparation is 1 x (10^6)^6. 6 -10 8 More preferably, the viable count of Pediococcus lactis in the microbial preparation is 1 x (10⁻⁶ CFU / mL); 6 -10 8 CFU / mL.

[0017] Preferably, the dosage form of the microbial preparation includes any one of liquid dosage forms (suspension, syrup, etc.) and solid dosage forms (capsules, microcapsules, tablets, granules, powders, lozenges, pills, suppositories, etc.).

[0018] A fifth aspect of the present invention provides the application of the aforementioned Pediococcus lactis or microbial preparations in the field of animal husbandry.

[0019] The application of probiotics in the field of animal husbandry has the following effects: (1) Improve feed conversion rate The use of probiotics improves feed conversion rates, enabling animals to more effectively convert feed into growth and production, and improves feed digestibility and nutrient absorption. They improve gut health by balancing the gut microbiota, reducing competition from harmful bacteria, and thus increasing the number of beneficial bacteria.

[0020] The application of probiotics can further optimize feed utilization efficiency by regulating the animal's immune response and metabolic processes. By influencing the composition of the gut microbiota, probiotics can promote the growth and repair of intestinal epithelial cells, improve the gut's absorption capacity, and thus effectively enhance overall feed conversion rate.

[0021] (2) Improve animal health Probiotics can enhance an animal's immunity and reduce the incidence of disease through various mechanisms. For example, they can inhibit the growth of pathogenic bacteria and improve the balance of gut microbiota, which is particularly important for preventing intestinal diseases such as diarrhea.

[0022] In addition, probiotics can reduce inflammatory responses caused by infection or environmental stress, thus improving the overall health of animals.

[0023] (3) Reduce antibiotic use Probiotics are gaining increasing attention as an alternative to antibiotics. By promoting gut health and enhancing immunity, probiotics can effectively reduce animals' dependence on antibiotics. Livestock farming programs using probiotics can, to some extent, replace antibiotics in the prevention and treatment of animal diseases, thereby reducing the overall use of antibiotics.

[0024] Probiotics can further reduce the need for antibiotics by inhibiting the growth of pathogens and reducing the risk of infection. In summary, the application of probiotics in improving feed conversion rates, enhancing animal health, and reducing antibiotic use demonstrates their potential and importance as an emerging technology in animal husbandry.

[0025] (4) Reduce lipid accumulation Probiotics can increase the abundance of beneficial bacteria (such as Lactobacillus and Bifidobacterium), inhibit the growth of opportunistic pathogens, improve intestinal barrier function, reduce endotoxin entry into the bloodstream, and alleviate chronic inflammation caused by metabolic endotoxemia, thereby improving insulin sensitivity and lipid metabolism. Fermented dietary fiber produces short-chain fatty acids such as propionic acid and butyric acid. These metabolites can participate in regulating the secretion of appetite-related hormones (such as GLP-1 and PYY), suppressing appetite; inhibiting lipoprotein lipase activity, reducing peripheral fat storage; and simultaneously promoting fat breakdown and energy consumption by regulating the expression of genes such as PPAR-γ and UCP-2. Probiotics affect the enterohepatic circulation of bile acids, promoting the conversion of primary bile acids to secondary bile acids, activating FXR and TGR5 receptors, regulating glucose and lipid metabolism balance, and reducing the accumulation of triglycerides in the liver and blood.

[0026] In a sixth aspect, the present invention provides the application of the above-described Pediococcus lactis or microbial preparations in the field of fermented foods.

[0027] The application of probiotics in the field of weight-loss foods has the following effects: (1) Development of functional foods The use of probiotics can not only improve gut health, but also prevent chronic diseases such as obesity and diabetes by influencing metabolic processes.

[0028] (2) Improved food safety By inhibiting the growth of pathogenic microorganisms, probiotics can effectively reduce the risk of food contamination. In fermented foods, probiotics can inhibit the proliferation of pathogenic bacteria by producing antimicrobial substances and altering the intestinal environment, thereby improving food safety. Furthermore, probiotics can improve food shelf life and extend its shelf life.

[0029] (3) Probiotic fermented products Fermentation not only enhances the nutritional value of food but also improves its flavor and texture. The fermentation process can increase the content of certain bioactive components, such as short-chain fatty acids, which play an important role in regulating metabolism and immune function.

[0030] A seventh aspect of the present invention provides the application of the above-described Pediococcus lactis or microbial preparations in the pharmaceutical field.

[0031] The application of probiotics in the medical field has the following effects: (1) Prevention and treatment of intestinal diseases Probiotics can improve gut health through various mechanisms, including regulating gut microbiota balance, enhancing intestinal barrier function, and inhibiting the growth of pathogenic bacteria. In particular, probiotics have shown significant efficacy in the treatment of antibiotic-associated diarrhea, inflammatory bowel disease, and irritable bowel syndrome. Furthermore, probiotics are also used as adjunctive therapy for patients with chronic inflammatory bowel disease, helping to alleviate symptoms and improve quality of life.

[0032] Probiotics can alleviate symptoms of intestinal diseases to some extent by enhancing the integrity and function of the intestinal mucosa, promoting the regeneration of intestinal epithelial cells, and reducing intestinal permeability. Simultaneously, probiotics can regulate the intestinal environment and inhibit the growth of harmful bacteria by producing metabolites such as short-chain fatty acids. Furthermore, the anti-inflammatory effects of probiotics provide a theoretical basis for their application in the treatment of intestinal diseases. Therefore, probiotics are not only an effective tool for preventing intestinal diseases but also an important supplementary strategy for treating intestinal-related conditions.

[0033] (2) Regulation of the immune system Probiotics enhance the host's immune response by interacting with the gut immune system. They stimulate immune cells in the gut, thereby promoting enhanced specific and non-specific immune responses. This process not only helps fight off infections but also reduces the risk of allergic reactions and autoimmune diseases.

[0034] Probiotics also influence immune responses by regulating cytokine secretion, thereby modulating inflammatory responses in the body. Furthermore, the presence of probiotics in the gut helps maintain the stability of the gut microbiota, further promoting a balanced immune system.

[0035] Probiotics, as an immunomodulator, have shown positive effects in preventing upper respiratory tract infections and allergic diseases. Regular intake of probiotics can significantly improve the body's immune function, reduce the incidence of infection, and enhance resistance to disease. Therefore, probiotics have broad application prospects in immune system regulation.

[0036] (3) Improve obesity Specific probiotic preparations can effectively reduce weight, body fat percentage, and waist circumference. These findings provide a scientific basis for using probiotics as an adjunct intervention strategy for obesity and related metabolic diseases, demonstrating promising application prospects. Probiotics can regulate the composition of the gut microbiota, increasing the abundance of beneficial bacteria such as lactobacilli and bifidobacteria while inhibiting the growth of opportunistic pathogens. This regulatory effect helps improve intestinal barrier function, reduces the entry of endotoxins into the bloodstream, thereby alleviating the chronic inflammatory state caused by metabolic endotoxemia, and ultimately improving insulin sensitivity and lipid metabolism balance. In terms of metabolic regulation, short-chain fatty acids (such as propionic acid and butyric acid) produced by probiotic fermentation of dietary fiber can not only regulate the secretion of appetite-related hormones (such as GLP-1 and PYY) and inhibit appetite, but also activate the AMPK signaling pathway, promoting fatty acid oxidation and energy consumption. Meanwhile, certain probiotic strains can inhibit lipoprotein lipase activity and reduce peripheral fat storage by regulating FIAF expression, and promote fat breakdown by regulating the expression of genes such as PPAR-γ and UCP-2. Probiotics also participate in the regulation of bile acid metabolism, affecting the enterohepatic circulation of bile acids, promoting the conversion of primary bile acids to secondary bile acids, thereby activating FXR and TGR5 receptors and regulating the balance of glucose and lipid metabolism throughout the body. By regulating the levels of intestinal immune and systemic inflammatory factors (such as TNF-α and IL-6), probiotics can also reduce obesity-related chronic low-grade inflammation and improve adipose tissue function.

[0037] (4) Clinical application of probiotics Probiotics are effective in improving gut health, enhancing immune function, and alleviating allergy symptoms. Particularly in the treatment of intestinal diseases, probiotic intervention can significantly improve patients' clinical symptoms and quality of life. Clinical trials in the elderly, children, and immunosuppressed patients have shown that probiotics can effectively reduce the incidence of intestinal diseases and improve the composition of the gut microbiome in these populations. In summary, probiotics, as an emerging therapeutic approach, are providing new ideas and methods for the advancement of modern medicine.

[0038] An eighth aspect of the present invention provides an animal feed in which the aforementioned Pediococcus lactis or the aforementioned microbial preparation is added.

[0039] Preferably, the animal includes, but is not limited to, yak.

[0040] In a ninth aspect, the present invention provides a fermented food product obtained by fermentation using the aforementioned Pediococcus lactis or the aforementioned microbial preparation.

[0041] In a tenth aspect of the invention, the use of the microbial preparation of the aforementioned *Pediococcus lactis* in improving fatty liver in animals, particularly in improving non-alcoholic fatty liver disease.

[0042] In an eleventh aspect, the present invention provides a biological therapeutic agent comprising the aforementioned *Pediococcus lactis* or the aforementioned microbial preparation.

[0043] The *Pediococcus lactis* derived from the intestinal yak gut of Nagqu County, Tibet, present in this invention has the following beneficial effects: (1) High survival rate and planting efficiency Acid and bile salt resistance: Through in vitro screening that simulates the gastrointestinal environment (such as treatment with gastric acid at pH 3.0 and 0.3% bile salts), the survival rate of the strain in the host digestive tract is ensured (>90%), significantly improving its colonization ability in the intestine.

[0044] (2) Precise functional regulation Non-hemolytic and non-toxic factors: Safety is verified through genomic analysis (such as virulence gene screening) and phenotypic experiments (such as hemolysis test) to avoid host cell damage or abnormal immune response.

[0045] Targeted metabolic function: secretes short-chain fatty acids (SCFA) and antimicrobial peptides (such as bacteriocins), inhibits pathogens and promotes intestinal barrier repair. The functional effects can be quantified through an in vitro co-culture model.

[0046] (3) Enhance feed nutrient decomposition efficiency Enzymatic digestion enhancement: Short-chain fatty acids produced from the metabolism of most carbohydrates can be directly absorbed by intestinal epithelial cells, serving as an energy source to replace part of the glucose requirement, reducing metabolic energy consumption, improving feed energy conversion rate, and promoting feed conversion. Attached Figure Description

[0047] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0048] Figure 1 This invention provides a colony morphology diagram of bacteria isolated from yak dung. Figure 2 A diagram of a Gram-positive bacterial strain provided by this invention; Figure 3 The growth tolerance curves of eight lactic acid bacteria to acid provided by this invention; Figure 4 Growth tolerance curves of three types of lactic acid bacteria to bile salts provided by this invention; Figure 5 The image shows the hemolysis test results of the ZX-22 strain provided by this invention. Figure 6This is a quality control banding result diagram of the ZX-22 strain provided by the present invention; Figure 7 This is a diagram showing the Genebank registration information of strain ZX-22 provided by the present invention; Figure 8 A diagram showing the GC distribution of strain ZX-22 provided by this invention; Figure 9 The diagram shows the homology analysis results of the ZX-22 strain provided by this invention. Figure 10 This is a phylogenetic tree diagram of the ZX-22 strain provided by the present invention; Figure 11 COG classification bar chart of strain ZX-22 provided by the present invention; Figure 12 A bar chart illustrating the GO functional classification of strain ZX-22 provided by this invention; Figure 13 A bar chart illustrating the KEGG functional classification of strain ZX-22 provided by this invention; Figure 14 Functional similarity of virulence factors of the ZX-22 strain provided by this invention; Figure 15 This is a diagram illustrating the transmembrane proteins of strain ZX-22 provided by the present invention. Figure 16 A diagram illustrating the transsignal peptide cleavage sites of strain ZX-22 provided by this invention; Figure 17 A statistical chart of lipoprotein prediction results for ZX-22 provided by this invention; Figure 18 A comparative graph of body weight changes in mice in each group provided by the present invention (the horizontal axis dates start from the first day after successful model establishment and drug administration). Figure 19 This is a comparison chart of liver fat content in different groups of mice provided by the present invention; Figure 20 The graph shows the comparison of fecal fat content in each group of mice provided by this invention (the horizontal axis dates from the first day after successful modeling and drug administration). Detailed Implementation

[0049] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0050] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0051] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0052] Example 1: Isolation of Pediococcus lactis (1) Sample collection Gently wipe the anus and surrounding skin of a yak in Nagqu County, Tibet with an alcohol swab (ensuring at least 30 seconds of contact time), then gently wipe the anus and surrounding skin with gauze moistened with warm saline to remove any alcohol residue. Aseptically collect approximately 2g of the sample into a sterile sampling tube by inserting a swab deep into the rectum. Deliver the sample to the laboratory within 2 hours for further processing.

[0053] (2) Isolation, purification and preservation of lactic acid bacteria Take 0.5g of fresh yak manure sample and add it to a 15mL centrifuge tube containing 9.5mL MRS liquid medium. Incubate at 37℃ for 48h. Dilute the bacterial suspension with sterile PBS, and spread it onto MRS solid medium at an appropriate dilution. Incubate anaerobically at 37℃ for 24-48h. Select colonies that are smooth and white or milky white in appearance. Figure 1 As shown.

[0054] (3) Probiotic isolation and culture The bacterial strain was purified by streak plating three times on MRS solid medium. Finally, a single colony was picked and inoculated into MRS liquid medium. After anaerobic incubation at 37°C for 12-24 hours, the bacterial culture was shaken to mix thoroughly and then mixed with 50% sterile glycerol at a 1:1 ratio. The culture was then stored at -80°C. Before use, the strain needs to be activated at least three times.

[0055] Example 2 Hydrogen peroxide contact test Perform Gram staining and microscopic examination. Add 2% hydrogen peroxide to a glass slide, mix a single colony, and observe bubble formation. Bubble formation indicates a positive reaction; otherwise, it is negative. Catalase-negative strains cannot break down H2O2 themselves. Therefore, through evolutionary selection, these strains typically balance oxidative stress by producing low levels of H2O2 or relying on antioxidant systems (such as glutathione) provided by the host / commensal bacteria, thereby reducing potential damage to the intestinal mucosa. Strains that are catalase-negative and Gram-positive should be selected. Figure 2 As shown.

[0056] Example 3 Acid Resistance Test Adjust the bacterial concentration to 1x10 8 CFU / mL. Take 100 μL of the above bacterial culture and inoculate it into 9.9 mL of hydrochloric acid-acidified MRS liquid medium (pH 3.0). Use unacidified MRS medium as a control. Incubate anaerobically at 37°C. At 0 h and 2 h, take 100 μL of the test bacterial culture and add it to 0.9 mL of sterile physiological saline for serial dilution (10 CFU / mL). -1 ~10 -6 For each dilution, 200 μL was evenly spread onto MRS solid medium. Each dilution was repeated three times. The culture was carried out at 37°C for 24 hours under anaerobic conditions. The bacteria were counted using the plate count method. The acid tolerance of the bacteria was determined based on the survival rate of the bacteria after 2 hours of culture in acidified medium.

[0057] The formula for calculating survival rate is: Survival rate (%) = A1 / A0 Note: A1 is the number of viable bacteria after culturing in acidified (pH 3.0) MRS medium for 2 hours; A0 represents the number of viable bacteria after 0 hours of culture in acidified (pH 3.0) MRS medium. For example... Figure 3 As shown, under acidic conditions (pH 3.0), the eight lactic acid bacteria isolated from the samples exhibited varying degrees of growth tolerance.

[0058] Example 4: Bile Salt Tolerance Test The three types of probiotics obtained from the acid tolerance test were inoculated into MRS liquid medium containing 0.3% bile salts and cultured for 4 hours. The bile salt tolerance of the test bacteria was then calculated.

[0059] The formula for calculating bile salt survival rate is: Survival rate (%) = B1 / B0 Note: B1 is the number of viable bacteria after the test bacteria were cultured in MRS medium containing 0.3% bovine bile salt for 4 hours; B0 represents the number of viable bacteria after culturing the test bacteria in MRS medium containing 0.3% bovine bile salt for 0 hours.

[0060] Repeated bile salt tolerance tests showed that all isolated strains were sensitive to 0.3% bile salts, with viable cell counts detected after 4 hours. Figure 4 As shown, only one strain (ZX-22) of the three acid-resistant test strains survived after 4 hours of culture in MRS medium containing 0.3% bile salts, with a survival rate of 20.3%.

[0061] Example 5 Hemolysis Test Strawberry strain ZX-22 was streaked onto blood agar plates and incubated at 37°C for 24 hours. The presence or absence of α-hemolysis, β-hemolysis, and γ-hemolysis was used to determine if the strain exhibited hemolytic activity. Figure 5 As shown, the hemolysis test results indicated no hemolysis.

[0062] Example 6 Molecular biological identification DNA was extracted from the ZX-22 strain using the Solarbio Bacterial Genomic DNA Extraction Kit. 16S sequencing identification was performed using universal bacterial primers: upstream primer 27F: GAGAGTTGATCCTGGCTCAG (SEQ ID NO: 2), and downstream primer 1492R: TACGGCTACCTTGTTACGAC (SEQ ID NO: 3). The PCR reaction mixture consisted of 50 μL: 5 μL TaqReaction Buffer (10×), 5 μL PCRDye, 1 μL dNPTs, 0.5 μL TaqDymerase, 2 μL DNA template, 2 μL 27F, 2 μL 1492R, and dd water (double-distilled water) to a final volume of 50 μL. The PCR amplification steps were as follows: First, a pre-denaturation treatment was performed at 95°C for 5 minutes. Then, 30 cycles were performed, each cycle consisting of three steps: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 90 seconds. The PCR products were then extended at 72°C for 7 minutes, followed by a final extension at 20°C for 3 minutes. PCR products were detected using 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotech's Beijing branch for sequencing.

[0063] The bacterial genome of the isolated strains was extracted and amplified by PCR to obtain target bands of approximately 1500 bp (see...). Figure 6 The PCR product met the sequencing requirements, and was sent to Shanghai Sangon Biotech's Beijing branch for sequencing. Based on the returned sequencing results, homology comparison with the NCBI database was performed to determine the bacterial species. The sequencing results compared with the NCBI database showed: *Pediococcus acidilactici*. *Pediococcus acidilactici* meets the requirements of the feed additive catalog. The bacterial sequence was submitted to GenBank, and the accession number obtained was PQ812418.1. Figure 7 As shown. It was designated ZX-22 and further research was conducted.

[0064]

[0065] 16S rRNA genes are sequences present in the genomes of all bacteria. Constructing phylogenetic trees based on 16S rRNA has several important implications: identification and classification of microorganisms. Due to the high conservation and species specificity of 16S rRNA sequences in bacteria, comparison of 16S rRNA sequences can determine the classification and identification of microorganisms, as well as determine the phylogenetic position of unknown microorganisms; it is also used to explore microbial evolution and understand the phylogenetic relationships and evolutionary processes between different microorganisms. Constructing phylogenetic trees based on 16S rRNA is of great significance for microbial classification and evolution. The genes were compared in the NCBI database with the parameter `identify>95`. Then, 20 16S rRNA sequences with high similarity were selected, and after sequence alignment using MEGA11 software, a phylogenetic tree was constructed.

[0066] The significance of gene element prediction lies in understanding important functional elements in the genome, such as promoters, transcription factor binding sites, splicing sites, and enhancers. These elements play a crucial role in gene expression and regulation. Gene element prediction can also be used to identify disease-related sites, thereby helping researchers understand the molecular mechanisms of disease pathogenesis. Furthermore, gene element prediction can be used to design and optimize gene editing and gene therapy strategies, as well as to develop new drugs and diagnostic methods. The COG (Clusters of Orthologous Groups) database is a gene function classification database used to identify conserved domains in protein sequences across different species and cluster these proteins into functionally related groups. The COG database contains protein sequences screened from the entire genome and divided into 25 different COG categories, each representing a different protein function. By comparing protein sequences from different species, proteins with similar functions are identified and clustered into COGs. The CAZy (Carbohydrate-Active Enzymes Database) is an online database designed to collect and provide information on carbohydrate-active enzymes (CAZymes) in biological macromolecules. This database collects information on CAZyme families and subfamilies from various biological species (bacteria, fungi, plants, and animals), currently containing data on over 140 CAZyme families and over 4100 CAZyme subfamilies. Each family and subfamily in the database has its own nomenclature and definition, making it easy to identify and classify. The VFDB (Virulence Factors of Pathogenic Bacteria) database is a reference database on bacterial virulence factors (VFs). VFs are molecules that help bacteria infect the host and evade or suppress the host's immune response. The VFDB database includes VFs of various bacterial pathogens and provides convenient searching and comparison of the bacterial sequence with the VFDB database to comprehensively analyze the potential genes of the bacterium.

[0067] like Figure 8 As shown, by observing the correlation between GC distribution and sequencing depth, the reliability of sequencing data is ensured, providing a basis for subsequent analyses such as genome assembly and variant detection.

[0068] The framework diagram further reveals the properties of this strain. NR library alignment annotation, through comparison with the NR library, shows the similarity of the species' transcriptional sequence to similar species. For example, it shows a 94.3% similarity to *Pediococcus acidilactici*. Figure 9As shown; its phylogenetic tree also shows it as Pediococcus lactis, such as Figure 10 As shown.

[0069] By comparing protein sequences from different species, proteins with similar functions were identified and clustered into COGs, revealing that their main functions are enriched in carbohydrate metabolism, such as... Figure 11 As shown, it reveals that it can improve feed conversion rate.

[0070] According to GO annotation classification statistics, the three most prevalent categories in biological processes are metabolic processes and cellular processes. Within cellular components, catalyst-related functional genes are the most abundant in terms of molecular function. KEGG enrichment results show that carbohydrate metabolism pathways have the highest enrichment count among metabolic branches, followed by membrane transport pathways and environmental information processing; lipid metabolism and amino acid metabolism are also highly enriched, such as... Figure 12-13 As shown.

[0071] The sequence of this bacterium was compared with the VFDB database. Among the 1896 proteins of this gene, no related virulence genes were detected when the gene similarity was greater than or equal to 80%, demonstrating the high safety of this bacterium. Figure 14 As shown. The ClpP gene is a serine protease involved in proteolysis, primarily functioning to degrade or remove improperly synthesized, damaged, or useless proteins within bacterial cells. Recent studies have shown that bacterial ClpP assists pathogens in survival, reproduction, and dissemination within the host, playing a crucial role in bacterial pathogenesis. The Hyaluronicacidcapsule, ClpE, and MsrAB capsule genes are mainly associated with bacterial adhesion and invasion. However, adhesion ability also plays an important beneficial role in bacterial colonization and site occupation.

[0072] A comparison of the bacterial sequence with a transmembrane protein library revealed that as many as 28.57% of the protein molecules were transmembrane proteins (such as...). Figure 15 (As shown); a signal peptide is a short (5-30 amino acid) polypeptide chain that guides the translocation of newly synthesized proteins into the secretory pathway. The sequence of signal peptides may differ among proteins, but they share similar compositional characteristics. During protein translation, the N-terminal signal peptide binds to the recognition site on the cell membrane, causing local changes in the cell membrane that allow the protein polypeptide to cross the cell membrane (e.g., ...). Figure 16 (As shown). The signal peptide protein accounts for 1.7% of the total protein; therefore, this bacterium can be considered as a therapeutic carrier to transport the molecule across the biological membrane through specific folding and bending mechanisms of transmembrane proteins "responsible for transport".

[0073] Its lipoprotein distribution accounts for, for example Figure 17As shown, the CYP group accounts for as high as 78.49% of lipoproteins, which is associated with many enzymes, carriers, structural proteins, antigens, and adhesins. This is a lipoprotein motif containing cysteine ​​and specific threonine residues, which, as surface-exposed ligands, regulates immune responses by binding to host intestinal epithelial cell receptors (such as DC-SIGN or TLR4). It may participate in the adaptive responses of lactic acid bacteria to bile salts, low pH, or oxidative stress. For example, by regulating membrane permeability or secreting antioxidant enzymes; it can also act as acyltransferases or fatty acid-binding proteins, assisting lactobacilli in utilizing host-derived lipids (such as cholesterol esters) in the intestine, indirectly affecting the host's lipid metabolism homeostasis.

[0074] Example 7 Metabolic capacity detection As shown in Table 1, the broad carbon source metabolism capability exhibited by this *Pediococcus lactis* ZX-22 is its core competitive advantage. It can efficiently utilize more than 15 carbon sources such as glucose, maltose, and fructose, giving it the adaptability to rapid proliferation in complex ecological environments (such as fermentation substrates and the gastrointestinal tract). Through homolactic fermentation, it converts various carbohydrates into D-lactic acid and synthesizes bacteriocins (such as pediococcin), which can not only effectively inhibit the growth of putrefactive and pathogenic bacteria, but also makes it of great application value in food fermentation preservation, probiotic preparation development and other fields. However, it should be noted that its metabolic defects in specific organic acids such as citric acid and hippuric acid may limit its biological activity in highly acidic environments such as citrus fruits.

[0075] Table 1

[0076] Example 8: Fat Loss Capacity Test Twenty mice were randomly divided into a probiotic group, a simvastatin group, a hyperlipidemia group (high-fat diet group), and a blank control group, with five mice in each group. After being fed a normal diet for one week, the probiotic group, simvastatin group, and hyperlipidemia group were fed the HFD diet for 28 consecutive days. The weight of the mice in each group was measured daily during the period.

[0077] HFD diet preparation: 20 g lard, 10 g cholesterol, 1 g propylthiouracil, 10 mL Tween-80, 20 mL propylene glycol, 20 mL 10% sodium deoxycholate aqueous solution, and diluted to 100 mL with purified water. Heat and stir continuously until the solution becomes a milky white, viscous consistency without any crystalline particles; this is the successful preparation of the emulsion. After refrigeration, it will become a solid gel. Before use, it needs to be heated to melt it into a more fluid emulsion.

[0078] Treatment regimen: Mice with successfully induced fatty liver were administered saline via gavage daily in the blank control group and the hyperlipidemia group; the probiotic group received 10... 9ZX-22 bacterial suspension, resuspended in physiological saline at a concentration of CFU / mL, was administered by gavage at a dose of 0.1 mL / kg; the simvastatin group was given 10 mg / kg simvastatin daily for 14 days in all groups.

[0079] like Figure 18 As shown in the test results, the weight of mice in the probiotic group, simvastatin group and hyperlipidemia group after successful fatty liver modeling was significantly higher than that of the control group. The weight of mice in the probiotic group and simvastatin group was significantly lower than that of the hyperlipidemia group after drug administration.

[0080] Detection of liver fat in mice: Tissue fixation and dehydration: The liver was fixed in fixative for at least 24 hours. The liver tissue removed from 4% paraformaldehyde was placed in a 15% sucrose solution and dehydrated at 4°C until it sank to the bottom. It was then transferred to a 30% sucrose solution and dehydrated again at 4°C until it sank to the bottom of the container. OCT embedding: The dehydrated liver tissue was trimmed and placed on a sample holder with the cut surface facing up. OCT embedding medium was then applied around the tissue, and the sample holder was placed on a cryostat for rapid freezing and embedding. Sectioning was performed after the embedding medium turned white and hardened. Liver sectioning: The sample holder containing liver tissue was fixed on a microtome and sectioned to a thickness of 8-10 μm. The sections were then transferred to clean glass slides and fixed in 4% paraformaldehyde for 15 minutes. After rinsing with tap water, the sections were air-dried. Oil red staining: The dried sections were immersed in Oil red staining solution for 10 minutes. Then, the differentiated tissue background was sequentially immersed in two tanks of 60% isopropanol for differentiation, 3 seconds and 5 seconds respectively. The sections were then sequentially immersed in two tanks of pure water for 10 seconds each. For hematoxylin staining: after removing the differentiated sections and holding them for 3 seconds, they were immersed in hematoxylin staining solution for counterstaining for 5 minutes, followed by rinsing with three tanks of pure water for 5 seconds, 10 seconds, and 30 seconds respectively. Then, differentiation was performed using a differentiation solution with 60% alcohol as the solvent for 5 seconds, followed by rinsing with two tanks of distilled water for 10 seconds each, and then blueing with a blueing solution for 1 second. The sections were then gently immersed in two tanks of tap water for 5 seconds and 10 seconds respectively, and the staining effect was examined under a microscope. For mounting: sections were mounted using glycerol gelatin mounting medium. The sections were observed under a microscope, and images were acquired for analysis. Figure 19 The results showed that after Oil Red staining, the hyperlipidemia group had the highest fat content, appearing as large, dense red lipid droplets. After simvastatin treatment, the number of lipid droplets significantly decreased, consistent with actual clinical treatment effects. Although the ZX-22 treatment in the probiotic group was not as effective as the simvastatin group, the number of lipid droplets also significantly decreased. These experimental results indicate that ZX-22 can be used to improve non-alcoholic fatty liver disease.

[0081] Detection of free fatty acids in mouse feces: First, collect mouse fecal samples and process them appropriately to obtain samples suitable for testing. This step includes washing, drying, and grinding the samples. Dilution of standards: Dilute the original standards to different concentrations according to the kit instructions to obtain standard solutions for subsequent standard curve preparation. Sample addition: Set up standard wells, blank wells, and sample wells on the ELISA plate. Add standard solutions of different concentrations to the standard wells and add processed fecal samples to the sample wells. When adding samples, ensure the sample is placed at the bottom of the well, avoiding contact with the well walls, and gently shake to mix. Add enzyme: Add enzyme-labeled reagent to each well, except for the blank wells. Incubation: After sealing the plate with the sealing film, incubate the ELISA plate at 37°C to allow the free fatty acids in the sample to fully react with the reagent. Washing: After incubation, carefully remove the sealing film, discard the liquid, and shake dry. Then, add washing buffer to each well, let it stand for a period of time, and discard. Repeat this process several times to remove unbound substances. Color Development: Add colorimetric reagent A and colorimetric reagent B to each well, gently shake to mix, and then develop the color at 37°C in the dark for a period of time. The intensity of the color reaction is positively correlated with the concentration of free fatty acids in the sample. Termination: After the color development reaction is complete, add stop solution to each well to terminate the reaction. Measurement: Use an ELISA reader to measure the absorbance (OD value) of each well at a specific wavelength. Result Calculation: Import the data measured in the table into GraphPad to obtain the following graph. Plot a standard curve based on the OD values ​​and concentrations of the standards, and then find the corresponding concentration on the standard curve based on the OD value of the sample to be tested; this is the content of free fatty acids in the sample. Figure 20 As shown, the fecal free fatty acid content in the hyperlipidemia group mice remained almost unchanged; the fecal free fatty acid content in the simvastatin and probiotic groups showed a significant decreasing trend. The fecal fatty acid content in the probiotic group was slightly higher than that in the simvastatin group, but significantly lower than that in the hyperlipidemia group. These experimental results indicate that ZX-22 can be used to improve non-alcoholic fatty liver disease.

[0082] In summary, strain ZX-22 exhibits acid and bile salt tolerance and stress resistance, demonstrating high survival and colonization efficiency. This strain is non-hemolytic and lacks virulence factors, ensuring high safety. It secretes short-chain fatty acids and antimicrobial peptides, inhibiting pathogens and promoting intestinal barrier repair. The short-chain fatty acids produced from the metabolism of most carbohydrates can be directly absorbed by intestinal epithelial cells, serving as an energy source to partially replace glucose requirements, reducing metabolic energy consumption, improving feed energy conversion rate, and promoting feed conversion. Furthermore, it has the effects of reducing fat and weight and improving non-alcoholic fatty liver disease.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A type of Pediococcus acidilactici, derived from the intestinal tract of yak in Nagqu County, Tibet, characterized in that... The preservation number of the lactic acid cocci is CGMCC NO.34406.

2. The *Pediococcus lactis* according to claim 1, characterized in that, The 16S rRNA sequence of the lactic acid cocci is shown in SEQ ID NO:

1.

3. The *Pediococcus lactis* according to claim 1, characterized in that, The lactic acid cocci were isolated from yak dung.

4. The method for culturing *Pediococcus lactis* according to any one of claims 1-3, characterized in that, Includes the following steps: Fresh yak dung samples were added to MRS liquid culture medium and incubated at 37°C for 48 hours. The bacterial culture was diluted with PBS, spread on MRS solid medium, and then anaerobically cultured at 37°C for 24-48 hours. Select colonies that are smooth and white or milky white in appearance; Three streak purifications were performed on MRS solid medium. Single colonies were picked and inoculated into MRS liquid medium. After anaerobic culture at 37°C for 12-24 hours, the bacterial culture was shaken to mix thoroughly. The culture was then mixed with glycerol at a 1:1 ratio and stored at -80°C.

5. A microbial preparation, characterized in that, The microbial preparation contains Pediococcus lactis as described in any one of claims 1-3.

6. The microbial preparation according to claim 5, characterized in that, The content of Pediococcus lactis in the microbial preparation is 1x10. 6 CFU / mL or higher.

7. The use of the lactic acid cocci according to any one of claims 1-3 or the microbial preparation according to any one of claims 5-6 in animal husbandry, weight loss, and medicine.

8. The use of the *Pediococcus lactis* according to any one of claims 1-3 or the microbial preparation according to any one of claims 5-6 in improving fatty liver in animals.

9. An animal feed, characterized in that, The animal feed contains Pediococcus lactis as described in any one of claims 1-3 or a microbial preparation as described in any one of claims 5-6.

10. A biological therapeutic agent, characterized in that, The biotherapy agent comprises the *Pediococcus lactis* as described in any one of claims 1-3 or the microbial preparation as described in any one of claims 5-6.

Images