Nucleic acid molecule targeting circPTP4A2 as well as application and kit thereof

Abstract

The invention discloses a circPTP4A2 targeting nucleic acid molecule, a pharmaceutical composition, application and a detection kit. The nucleic acid molecule can be in specific complementary pairing with circPTP4A2, and the expression quantity of circPTP4A2 in cells is reduced; the siRNA is preferably siRNA, and the nucleotide sequence of the siRNA comprises SEQ ID NO: 1. When the nucleic acid molecule is used for non-small cell lung cancer cells, circPTP4A2 can be down-regulated and miR-127-5p up-regulation and / or SMC3 down-regulation can be caused, so that the nucleic acid molecule is related to anti-tumor effects of inhibiting tumor cell proliferation, migration / invasion and promoting apoptosis. The invention further provides a pharmaceutical composition containing the nucleic acid molecule and a pharmaceutically acceptable carrier, application of the nucleic acid molecule in preparation of a medicine for inhibiting the progress of the non-small cell lung cancer, and a detection kit which at least comprises a corresponding primer pair so as to realize matched detection and evaluation of a specific molecular axis.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and molecular biology, specifically to a nucleic acid intervention molecule targeting circPTP4A2, a pharmaceutical composition containing the nucleic acid intervention molecule, and a kit for in vitro detection. Background Technology

[0002] Lung cancer is one of the most common malignant tumors worldwide, seriously threatening human health. It has long been the leading cause of cancer-related deaths globally. Based on pathological type, lung cancer can be divided into two main categories: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). Although some progress has been made in the diagnosis and treatment of lung cancer, over 80% of NSCLC cases have a high metastatic potential and are accompanied by drug resistance, leading to poor clinical outcomes. Therefore, despite significant advances in recent years, the diagnosis and treatment of lung cancer remain inadequate, and a deeper understanding of lung cancer, early diagnosis, and the exploration of new therapeutic targets remain urgent.

[0003] Circular RNAs (circRNAs) are a class of non-coding RNAs characterized by a covalently linked 3' and 5' end formed by back-splicing. Most circRNAs originate from a non-classical alternative splicing process, mediated by the spliceosome or by class I and II ribozymes. Whole-genome analysis of RNA sequencing data shows that circRNAs are evolutionarily conserved and abundant in cells. circRNAs can be generated from exons (called exon-type circular RNAs), introns (called intron-type circular RNAs), or a mixture of both (also called circRNAs). Because some circRNAs contain miRNA binding sites, they can act as "sponges," adsorbing miRNAs and inhibiting their activity; therefore, they are considered to act as endogenous miRNA sponges. Furthermore, circRNAs can also act as "isolation / sealing" factors for RNA-binding proteins (RBPs) and as transcriptional regulators to regulate gene expression. Increasing evidence suggests that circRNAs are closely related to human diseases (especially tumors) and, due to their high abundance and stability, they hold promise as superior biomarkers.

[0004] However, current technologies still have several shortcomings in the research and application of NSCLC-related circRNAs. First, there are numerous types of tumor-associated circRNAs, and while some candidate molecules show differential expression, whether they are involved in key regulatory pathways affecting tumor phenotype needs further clarification. Results of expression differences or correlations alone are often insufficient to reveal their actual role and direction in cell phenotype changes. Second, there is a lack of systematic validation of the mechanisms of action of circRNAs, making it difficult to establish clear, stable, and reproducible mechanistic chains, thus affecting the reliability of subsequent target evaluation and intervention design. Finally, in terms of detection and evaluation, current technologies often lack a complete and standardized detection system built around the same regulatory pathway, resulting in insufficient consistency and comparability of results from different sample sources and experimental platforms, and hindering a unified evaluation of target relevance and intervention effects.

[0005] Therefore, the field still needs a technical solution that can clarify the role of key circRNAs in NSCLC and establish a reliable verification and detection evaluation system around the circRNA-miRNA-target gene regulatory link, so as to provide a technical foundation for the study of the molecular mechanism of NSCLC, target evaluation and the development of related detection and intervention tools. Summary of the Invention

[0006] In view of the above problems, the present invention provides a nucleic acid intervention molecule that can stably and reproducibly target circPTP4A2, and provides a primer set and kit for in vitro detection of circPTP4A2 and its related miR-127-5p and SMC3 molecular axes, thereby realizing the intervention and evaluation of this molecular axis and providing an implementable technical basis for lung cancer-related research and drug development.

[0007] According to a first aspect of the present invention, a nucleic acid molecule targeting circPTP4A2 is provided, the nucleic acid molecule being specifically complementary to circPTP4A2 and reducing the expression level of circPTP4A2 in cells; wherein, circPTP4A2 is hsa_circ_0007364.

[0008] In some technical solutions, the nucleic acid molecule is siRNA, and the nucleotide sequence of the siRNA includes any of the following: (1) The nucleotide sequence as shown in SEQ ID NO:1; (2) The nucleotide sequence as shown in SEQ ID NO:2; (3) A nucleotide sequence that has at least 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2, and can still reduce the expression level of circPTP4A2.

[0009] In some technical solutions, when the nucleic acid molecule is used in non-small cell lung cancer cells, it can downregulate the expression of circPTP4A2, increase the expression of miR-127-5p, and / or decrease the expression of SMC3.

[0010] In some technical solutions, the non-small cell lung cancer cells include SPCA1 and / or H1299.

[0011] According to a second aspect of the invention, a pharmaceutical composition is further provided, comprising the above-described nucleic acid molecule, and a pharmaceutically acceptable carrier, diluent, and / or excipient.

[0012] According to a third aspect of the invention, the use of the above-described nucleic acid molecules in the preparation of a medicament for inhibiting the progression of non-small cell lung cancer is further provided.

[0013] In some technical solutions, the inhibition of non-small cell lung cancer progression includes one or more of the following: inhibiting tumor cell proliferation, inhibiting migration and / or invasion, and promoting cell apoptosis.

[0014] In some technical solutions, the application is based on the circPTP4A2 / miR-127-5p / SMC3 molecular axis: the downregulation of circPTP4A2 by the nucleic acid molecule causes upregulation of miR-127-5p and / or downregulation of SMC3, thereby producing an anti-tumor effect.

[0015] According to a fourth aspect of the present invention, a detection kit is further provided, comprising at least: (a) Primer pair used to amplify circPTP4A2; (b) Primer pair used for detecting miR-127-5p; (c) Primer pairs used to amplify SMC3; And (d) one or more optional components: RNA extraction reagent, reverse transcription reagent, qPCR reaction system reagent, internal control detection component, positive control and / or negative control.

[0016] In some technical solutions, the primer pair contains at least the following sequences: circPTP4A2 primer pair: Forward GGAGTGACGACTTTGGTTCG, ReverseTGTCAGCGAAAATGCTGTGC, amplification product 169bp; miR-127-5p primer pair: Forward GGAAGATCTGTAGTCCTGTCTGTTGGTCAG, ReverseCCCAAGCTTCCTGAAGAACTGCTTCCGCC, amplification product 160bp; SMC3 primer pair: Forward ATCTTCGTCCAGAACAGCGG, Reverse GTGCTGTTGCCATCTGGTTG, amplification product 288bp.

[0017] The present invention, by employing the above technical solution, has at least the following beneficial effects: 1. This invention provides a nucleic acid molecule capable of specifically downregulating circPTP4A2, and further provides a specific siRNA sequence (SEQ ID NO:1 and its isomorphic variants), which can be directly used for targeted intervention and repeated implementation in cell and drug development scenarios.

[0018] 2. This invention links the antitumor effect to the circPTP4A2 / miR-127-5p / SMC3 molecular axis. Downregulation of circPTP4A2 in nucleic acid molecules can lead to upregulation of miR-127-5p and / or downregulation of SMC3, thereby corresponding to phenotypic improvements such as inhibition of proliferation, inhibition of migration / invasion, and promotion of apoptosis, thus improving the understandability and verifiability of the technical solution.

[0019] 3. This invention provides a primer set and detection kit that simultaneously covers circPTP4A2, miR-127-5p and SMC3, which can be used for the detection and evaluation of molecular axis related indicators, thereby improving the consistency and comparability of detection under different samples and experimental conditions, and facilitating the objective quantification of intervention effects. Attached Figure Description

[0020] Figure 1 The results show the expression of CircPTP4A2 in 50 pairs of non-small cell lung cancer tissues and normal tissues using qRT-PCR technology. Figure 2 The results of a Kaplan-Meier analysis of 50 patients with non-small cell lung cancer; Figure 3 The results show the expression of circPTP4A2 in lung cancer cell lines CALU3, SPCA1, A549, H1299, and human bronchial epithelial cells 16HBE, detected by qRT-PCR. Figure 4 The results of qRT-PCR analysis of circPTP4A2 expression levels in SPCA1 and H1299 cells treated with RNase R; Figure 5To detect the changes in circPTP4A2 expression levels before and after siRNA treatment in SPCA1 and H1299 cell lines using quantitative real-time polymerase chain reaction; Figure 6 The results show the cell viability after circPTP4A2 knockout was determined using the CCK-8 assay. Figure 7 To evaluate the proliferative capacity of non-small cell lung cancer cell lines after circPTP4A2 knockout using a cell colony formation assay; Figure 8 The results show the migration ability of non-small cell lung cancer cells after circPTP4A2 knockout, as detected by flow cytometry. Figure 9 The results of Western blot analysis were used to detect the expression levels of apoptosis-related markers after circPTP4A2 knockout. Figure 10-12 Results of in vivo tumor formation experiment: A mouse tumor model was established by injecting H1299 cells transfected with sh-circPTP4A2. The tumor size, tumor volume and tumor weight were detected on day 35 after injection. Figures 13-20 The results verify the direct binding relationship between circPTP4A2 and miR-127-5p; among which, Figures 13-14 The results show the subcellular localization of circPTP4A2 detected by nuclear and cytoplasmic separation experiments and fluorescence in situ hybridization (FISH) experiments, in which circPTP4A2 is mainly distributed in the cytoplasm; Figure 15 This is the complementary binding site between miR-127-5p and circPTP4A2 wild-type (WT) predicted based on online bioinformatics analysis; Figure 16 To use dual-luciferase reporter assays for Figure 15 The results of the verification of the predicted binding sites; Figure 17 To detect the interaction between miR-127-5p and circPTP4A2 using a biotinylated RNA pull-down assay, the amount of miR-127-5p enriched in the circPTP4A2 probe group was increased compared with the control probe group (p < 0.01). Figure 18 The results of quantitative real-time polymerase chain reaction (qRT-PCR) were used to detect the changes in the relative expression level of miR-127-5p in H1299 and SPCA1 cells after circPTP4A2 knockdown. The relative expression level of miR-127-5p increased (p < 0.01). Figure 19 The results of qRT-PCR detection of miR-127-5p expression level in non-small cell lung cancer (NSCLC) tissues showed that its expression was decreased compared with the control (p < 0.01). Figure 20 The results of the correlation analysis between miR-127-5p and circPTP4A2 expression levels in 50 NSCLC tissue samples (p < 0.01). Figures 21-25 This is the validation result of miR-127-5p binding to the 3′ untranslated region (3′UTR) of SMC3 and inhibiting SMC3 expression; among which, Figure 21 This is a schematic diagram of the complementary binding sites between miR-127-5p and SMC3 3′UTR, as predicted by miRBD. Figure 22 To use dual-luciferase reporter assays for Figure 21 The results of the verification of the predicted binding sites; Figure 23 The results show that the enrichment of miR-127-5p and SMC3 mRNA in the Ago2 complex was detected by RNA immunoprecipitation (RIP) combined with quantitative real-time polymerase chain reaction (qRT-PCR). Compared with the IgG control, the content of miR-127-5p and SMC3 mRNA in the Ago2 immunoprecipitation product was increased. Figure 24 The results of SMC3 mRNA expression level detection by qRT-PCR in 50 non-small cell lung cancer tissue samples show that the SMC3 mRNA level was increased in non-small cell lung cancer tissue compared with adjacent normal tissue (p<0.01). Figure 25 The correlation analysis results of SMC3, circPTP4A2 and miR-127-5p expression levels in non-small cell lung cancer (NSCLC) tissues (p < 0.01). Figures 26-30 This provides validation results regarding the regulation of non-small cell lung cancer cell phenotype by circPTP4A2 through the miR-127-5p / SMC3 pathway; among which, Figure 26 To detect the changes in SMC3 mRNA expression levels under circPTP4A2 knockdown, miR-127-5p inhibition, and SMC3 overexpression treatment in SPCA1 and H1299 cell lines using quantitative real-time polymerase chain reaction (qRT-PCR); Figure 27The results of Western blot analysis were used to detect changes in the expression levels of SMC3-related proteins under conditions of circPTP4A2 knockdown, miR-127-5p inhibition, or SMC3 overexpression. Figure 28 To evaluate the effect of circPTP4A2 knockdown on cell viability and the recovery of this effect under miR-127-5p inhibition or SMC3 overexpression conditions using the CCK-8 assay; Figure 29 The results of colony formation assay were used to detect changes in the proliferation capacity of non-small cell lung cancer cell lines after treatment with circPTP4A2 knockdown, miR-127-5p inhibition, and SMC3 overexpression. Figure 30 The results of flow cytometry analysis showed the effects of miR-127-5p inhibition or SMC3 overexpression on the apoptosis rate induced by circPTP4A2 knockdown. The results indicated that miR-127-5p inhibition or SMC3 overexpression reduced the increase in apoptosis rate induced by circPTP4A2 knockdown (p < 0.01). Detailed Implementation

[0021] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar to those skilled in the art. Furthermore, any method similar to or equivalent to the described content can be applied to the methods of the present invention. The preferred embodiments described herein are for illustrative purposes only.

[0022] It should be understood that the "inhibition" or "downregulation" of circPTP4A2 expression described in this invention refers to reducing the relative expression level of circPTP4A2 compared to the control group through nucleic acid intervention molecules, which may be a partial or significant reduction; T in the relevant sequences represents U (RNA). The "sample" described in this invention includes, but is not limited to, cell samples, tissue samples, blood samples, plasma / serum samples or their exosome samples; the detection and evaluation described in this invention are preferably performed in vitro.

[0023] This invention provides an feasible engineered technical solution centered around the circPTP4A2—miR-127-5p—SMC3 molecular axis: on the one hand, it provides nucleic acid molecules targeting circPTP4A2 to reduce circPTP4A2 expression, thereby affecting miR-127-5p / SMC3 expression and tumor-associated cell phenotypes; on the other hand, it provides primer sets and kits for in vitro detection of circPTP4A2, miR-127-5p and SMC3, providing tool support for evaluating the effectiveness of targeted intervention, molecular stratification and mechanism verification.

[0024] Example 1: Expression of circPTP4A2 in NSCLC clinical samples and its correlation with prognosis (corresponding to Figure 1-2 ) Fifty NSCLC patients admitted to Changhai Hospital, affiliated with Naval Medical University, were included in this study. All patients were newly diagnosed and had not received anti-tumor treatment before admission. Patients with a history of malignant tumors or multiple clinical diseases were excluded. Tumor tissue and paired non-tumor tissue were obtained through lung biopsy. After histopathological confirmation, the tissue was immediately stored at -80°C. Informed consent was obtained from all subjects. The study was approved by the Ethics Committee of Haian People's Hospital.

[0025] Total RNA was extracted using Trizol Reagent, and cDNA was prepared using the PrimeScript reverse transcription kit. qPCR was performed on a StepOne Plus Real-Time PCR System using TB Green Premix Ex Taq, with 18S rRNA and GAPDH as internal controls. A 2^(-ΔΔC) assay was used. t ) Calculate the relative expression level of RNA.

[0026] circPTP4A2 expression was detected in the above 50 pairs of tissue samples, and the results showed that it was significantly higher in tumor tissues than in paired tissues. Figure 1 (p<0.01); Fifty NSCLC patients were divided into high-expression and low-expression groups based on the median circPTP4A2 expression, and survival curve analysis was performed using KM-plotter. Overall, patients in the high circPTP4A2 expression group had lower survival rates and worse prognoses, and the differences were statistically significant (p<0.01). Figure 2 (log-rank p=0.0499).

[0027] Example 2: Verification of the circularity of circPTP4A2 and its expression in cell lines (corresponding to...) Figure 3-4 ) Normal human bronchial epithelial cell line 16HBE and various NSCLC cell lines (CALU3, SPCA1, A549, H1299) were selected. The expression of circPTP4A2 was detected using the qRT-PCR method described in Example 1. The results showed that circPTP4A2 expression was significantly higher in various NSCLC cell lines than in 16HBE. Figure 3 (p<0.01).

[0028] To verify the stability of the circular structure of circPTP4A2, total RNA extracted from H1299 and SPCA1 cells was treated with RNase R: 5 μg of total RNA was incubated with 10 U of RNase R at 37°C for 15 min, and RT-PCR was performed to assess target RNA expression after treatment. The results showed no significant difference in circPTP4A2 expression before and after RNase R treatment, while linear PTP4A2 expression was significantly reduced. Figure 4 (p<0.01), thus proving that circPTP4A2 has the typical exonuclease resistance characteristics of circular RNA.

[0029] Example 3: siRNA molecules targeting circPTP4A2, transfection and knockdown efficiency (corresponding) Figure 5 ) Provides siRNA targeting circPTP4A2 and negative control Si-NC. Specifically, the siRNA sequence is at least one of SEQ ID NO:1 and SEQ ID NO:2, in conjunction with reference. Figure 5 Si-circPTP4A2-1 corresponds to SEQ ID NO:1, and its nucleotide sequence is AGGAATCCACGTTCTAGTTTT; Si-circPTP4A2-2 corresponds to SEQ ID NO:2, and its nucleotide sequence is ATCCACGTTCTAGTTTTTCGT.

[0030] SPCA1 and H1299 cells were cultured in DMEM containing 10% FBS and transfected with DharmaFECT1 according to the manufacturer's instructions; all cell experiments were independently repeated 3 times.

[0031] After transfection, circPTP4A2 expression was detected by qRT-PCR as described in Example 1. The results showed that this siRNA could effectively downregulate circPTP4A2 in SPCA1 and H1299 cells. Figure 5 (p<0.01).

[0032] Example 4: Effects of circPTP4A2 knockdown on NSCLC cell proliferation, colony formation, migration / invasion, and apoptosis (corresponding to...) Figure 6-9 ) The cells transfected in Example 3 were used for functional experiments: (1) Proliferation experiment: Cell viability was detected by CCK-8 assay. The results showed that knockdown of circPTP4A2 inhibited the proliferation of NSCLC cell lines. Figure 6 (p<0.01).

[0033] (2) Colony formation: After transfection, cells were seeded at a density of 500 cells per well in 6-well plates and incubated at 37°C with 5% humidity. Cultured under the specified conditions. After 14 days, fixed and stained with 0.1% crystal violet solution. After washing twice with PBS (phosphate buffer, Invitrogen), the number of clones was counted manually; the number of clones in the knockdown group was significantly reduced ( Figure 7 (p<0.01).

[0034] (3) Migration / Invasion: Transwell assay with Matrigel was used: First, the Transwell chamber (Corning, New York, USA) was coated with 200 mg / mL Matrigel (BD Biosciences, San Jose, USA) overnight at 4°C. Then, approximately 5× Transfected SPCA1 or H1299 cells were resuspended in serum-free RPMI 1640 medium. 200 μL of cell suspension was added to the upper chamber, and 500 μL of RPMI 1640 medium containing 10% FBS was added to the lower chamber. After incubation for 24 h, uninvaded cells on the upper chamber membrane surface were gently wiped away with a cotton swab. Cells were fixed and stained with 0.1% crystal violet buffer, and the number of cells that had penetrated the membrane was counted under a phase-contrast microscope (Olympus, Tokyo, Japan). The migration assay (without Matrigel) was performed in the same manner, except that the Matrigel coating step in the upper chamber was omitted.

[0035] (4) Apoptosis: Flow cytometry showed that knockdown of circPTP4A2 significantly increased the apoptosis rate of SPCA1 and H1299 cells. Figure 8 ); Western blot analysis also showed that knocking down circPTP4A2 increased the proportion of apoptosis in SPCA1 and H1299 cells. Figure 9 ).

[0036] Example 5: Validation of the tumor-suppressive effect of circPTP4A2 knockdown in an in vivo xenograft tumor model (corresponding to...) Figure 10-12 ) Four-week-old female BALB / c nude mice (10–18 g) purchased from the Shanghai National Laboratory Animal Center were used. 1×10⁻⁶ mice stably expressing oligo or sh-circPTP4A2 were injected. 7Six H1299 cells were subcutaneously injected into the right abdomen of 4-week-old female nude mice, with six mice per group. Tumor growth was monitored weekly, and tumor volume was calculated using the formula: Volume (mm³) = (length × width²) / 2. Mice were humanely sacrificed via cervical dislocation after 35 days. All animal experiments were approved by the Ethics Committee of Haian People's Hospital and strictly followed the "Guidelines for the Care and Use of Laboratory Animals" of Haian People's Hospital.

[0037] The results showed that, compared with the NC group, the average volume and weight of harvested tumors were smaller in the circPTP4A2 low expression group, especially on day 35 after subcutaneous inoculation of si-circPTP4A2 transfected H1299 cells. Figure 10-12 (p<0.01). This result suggests that knocking down circPTP4A2 can effectively reduce the tumorigenicity of H1299 cells in xenograft mice.

[0038] Example 6: Subcellular localization of circPTP4A2 and its direct binding to miR-127-5p (corresponding to...) Figure 13-20 ) (1) Subcellular localization: Nuclear RNA and cytoplasmic RNA were extracted from SPCA1 and H1299 cells using NE-PER Reagent (Thermo Scientific) according to the manufacturer's instructions. Subsequently, qRT-PCR was used to quantify the expression level of circPTP4A2 in each component. U6 and GAPDH were used as control markers for nuclear RNA and cytoplasmic RNA, respectively. The results showed that circPTP4A2 was mainly localized in the cytoplasm (…). Figure 13 FISH experiments further provided direct evidence of the cytoplasmic localization of circPTP4A2. Figure 14 ).

[0039] (2) Dual-luciferase reporter: circinteractome was used to predict the existence of a binding site for circPTP4A2 that can directly bind to miR-127-5P, and the binding site sequence of circPTP4A2 and miR-127-5P was displayed; based on this, a luciferase reporter vector containing this sequence and its mutant sequence was constructed. Figure 15 To verify the prediction results, we used luciferase reporter vectors containing the circPTP4A2WT or MUT sequence for reporter gene experiments. The constructed wild-type and mutant reporter vectors were transfected into 293T cells and co-transfected with miR-NC or miR-127-5P, respectively. In the wild-type reporter system, overexpression of miR-127-5P significantly inhibited luciferin signaling compared to miR-NC; while in the mutant reporter system, luciferin signaling was unaffected. Figure 16 (p<0.01).

[0040] (3) RNA pull-down: The biotin-labeled circPTP4A2 probe formed a complex with streptavidin magnetic beads, which was then incubated with SPCA1 / H1299 lysis buffer and eluted. qRT-PCR was used to detect miR-127-5p in the enriched fraction; the results showed that the circPTP4A2 probe could effectively enrich miR-127-5p ( Figure 17 ).

[0041] (4) Expression and correlation: The expression of miR-127-5p in SPCA1 and H1299 cells after circPTP4A2 knockdown was detected by qRT-PCR. The results showed that knockdown of circPTP4A2 significantly upregulated miR-127-5p ( Figure 18 ); qRT-PCR was performed on 50 pairs of NSCLC patient cancer tissue and adjacent normal tissue samples, and the results showed that miR-127-5P expression was significantly reduced in cancer tissue ( ); Figure 19 The expression relationship between circPTP4A2 and miR-127-5P in 50 NSCLC cases was analyzed using Pearson correlation coefficient analysis. The results showed that the two showed a significant negative correlation trend. Figure 20 (p<0.01).

[0042] Example 7: miR-127-5p targeting SMC3 and its inhibitory effect (corresponding) Figure 21-25 ) (1) Target prediction: miRDB was used to predict the target mRNA of miR-127-5p, suggesting that it can bind to the 3'UTR of SMC3.

[0043] (2) Dual-luciferase validation: Wild-type SMC3 sequence and mutant sequence with mutations at two binding sites were constructed and co-transfected into 293T cells with miR-NC or miR-127-5P, respectively. In the wild-type reporter system, overexpression of miR-127-5P significantly inhibited reporter signaling compared to miR-NC; while in the mutant reporter system, reporter signaling was unaffected. Figure 21-22 ).

[0044] (3) RIP interaction: RIP was performed using the Magna RIP kit to detect the enrichment of miR-127-5p and SMC3 mRNA in Ago2 immunoprecipitates. The enrichment was significantly higher than that of IgG. Figure 23 (p<0.01).

[0045] (4) Clinical expression correlation: SMC3 expression in cancerous tissues and adjacent tissues of 50 NSCLC patients was detected by qRT-PCR. The results showed that SMC3 expression in NSCLC tissues was significantly upregulated compared with control (adjacent) tissues. Figure 24(p<0.01), and its expression was positively correlated with the expression level of circPTP4A2 in NSCLC tissues ( Figure 25 (p<0.01). Meanwhile, the expression of miR-127-5P in NSCLC was negatively correlated with the expression of SMC3 (…). Figure 25 (p<0.01).

[0046] Example 8: Molecular axis rescue experiment of circPTP4A2 / miR-127-5p / SMC3 (corresponding to) Figure 26-30 ) SPCA1 and H1299 cells were transfected with si-circPTP4A2, a miR-127-5P inhibitor, or an SMC3 overexpression vector, respectively, for rescue experiments. qRT-PCR results showed that si-circPTP4A2 knockdown significantly downregulated SMC3 mRNA expression, while inhibition of miR-127-5P or overexpression of SMC3 could "rescue" this change. Figure 26 (p<0.01). Consistently, Western blot analysis showed that SMC3 protein expression was decreased in SPCA1 and H1299 cells after circPTP4A2 knockdown, but SMC3 expression was restored after co-transfection or overexpression with miR-127-5P inhibitor. Figure 27 CCK8 results showed that co-transfection with a miR-127-5p inhibitor or overexpression of SMC3 on the basis of circPTP4A2 knockdown could effectively reverse the decrease in cell viability caused by circPTP4A2 knockdown. Figure 28 Furthermore, we examined changes in colony-forming ability after circPTP4A2 knockdown and co-transfection with a miR-127-5p inhibitor or overexpression of SMC3. The results showed that co-transfection with a miR-127-5p inhibitor or overexpression of SMC3 effectively reversed the decline in colony-forming ability caused by circPTP4A2 knockdown. Figure 29 Meanwhile, flow cytometry analysis showed that co-transfection with a miR-127-5P inhibitor or overexpression of SMC3 on the basis of circPTP4A2 knockdown could effectively reverse the increased apoptosis rate caused by circPTP4A2 knockdown. Figure 30 ).

[0047] Example 9: Primer set and kit for the detection of circPTP4A2 / miR-127-5p / SMC3

[0048] (2) Kit composition: including at least (a) the primer set mentioned above; (b) RNA extraction reagent (e.g., Trizol); (c) reverse transcription reagent (e.g., PrimeScript RT); (d) qPCR system (e.g., TB Green Premix Ex Taq); (e) internal control system: 18sRNA / GAPDH and U6; (f) positive / negative control; and (g) optional RNase R processing module for circularity verification.

[0049] (3) Usage method: Extract total RNA from the sample to be tested and reverse transcribe it. Perform qPCR with circPTP4A2, miR-127-5p, SMC3 and internal control primers respectively, according to 2^(-ΔΔC t Calculate the relative expression level; for circPTP4A2, an optional RNase R treatment control can be added to distinguish linear transcript interference.

[0050] This article uses specific examples to illustrate the principles and implementation methods of the present invention. The descriptions of the above embodiments are only for the purpose of helping to understand the method and core ideas of the present invention, including the best mode, and also to enable any person skilled in the art to practice the present invention, including manufacturing and using any device or system, and implementing any combined method. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid molecule targeting circPTP4A2, characterized in that, The nucleic acid molecule can specifically complement circPTP4A2 and reduce the expression level of circPTP4A2 in cells; wherein, circPTP4A2 is hsa_circ_0007364.

2. The nucleic acid molecule according to claim 1, characterized in that, The nucleic acid molecule is siRNA, and the nucleotide sequence of the siRNA includes any of the following: (1) The nucleotide sequence as shown in SEQ ID NO:1; (2) The nucleotide sequence as shown in SEQ ID NO:2; (3) A nucleotide sequence that has at least 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2, and can still reduce the expression level of circPTP4A2.

3. The nucleic acid molecule according to claim 1 or 2, characterized in that, When the nucleic acid molecule is used in non-small cell lung cancer cells, it can downregulate the expression of circPTP4A2, increase the expression of miR-127-5p, and / or decrease the expression of SMC3.

4. The nucleic acid molecule according to claim 3, characterized in that, The non-small cell lung cancer cells include SPCA1 and / or H1299.

5. A pharmaceutical composition, characterized in that, It comprises the nucleic acid molecule as described in any one of claims 1 to 4, and a pharmaceutically acceptable carrier, diluent, and / or excipient.

6. Use of the nucleic acid molecule according to any one of claims 1 to 4 in the preparation of a medicament for inhibiting the progression of non-small cell lung cancer.

7. The use according to claim 6, characterized in that, The inhibition of non-small cell lung cancer progression includes one or more of the following: inhibiting tumor cell proliferation, inhibiting migration and / or invasion, and promoting apoptosis.

8. The use according to claim 6, characterized in that, The application is based on the circPTP4A2 / miR-127-5p / SMC3 molecular axis: downregulation of circPTP4A2 in the nucleic acid molecule causes upregulation of miR-127-5p and / or downregulation of SMC3, thereby producing an anti-tumor effect.

9. A test kit, characterized in that, At least including: (a) Primer pair used to amplify circPTP4A2; (b) Primer pair used for detecting miR-127-5p; (c) Primer pairs used to amplify SMC3; And (d) one or more optional components: RNA extraction reagent, reverse transcription reagent, qPCR reaction system reagent, internal control detection component, positive control and / or negative control.

10. The detection kit according to claim 9, characterized in that, The primer pair contains at least the following sequences: circPTP4A2 primer pair: Forward GGAGTGACGACTTTGGTTCG, ReverseTGTCAGCGAAAATGCTGTGC; miR-127-5p primer pair: Forward GGAAGATCTGTAGTCCTGTCTGTTGGTCAG, ReverseCCCAAGCTTCCTGAAGAACTGCTTCCGCC; SMC3 primer pair: Forward ATCTTCGTCCAGAACAGCGG, Reverse GTGCTGTTGCCATCTGGTTG.

Images