Rice iron deficiency tolerance gene OsIDT1 and application thereof in improving iron utilization efficiency

Abstract

The invention discloses application of a rice iron deficiency tolerance gene OsIDT1 (Oryza sativa L. iron deficiency tolerance gene 1). The sequence of the iron-deficiency tolerance gene OsIDT1 is as shown in SEQ ID NO. 1. The gene can be applied in multiple aspects of promoting the iron element to be transferred from mature tissues to new tissues, improving the iron utilization efficiency of the rice and the like. The biological function of the iron-deficiency tolerance gene OsIDT1 in rice is found through a large number of experiments, and the iron element can be prevented from being transferred from a mature tissue to a new tissue by knocking out the gene, so that the iron utilization efficiency, the yield, the grain iron content and the like of the rice are reduced; the over-expression of the gene can promote the iron element to be transferred from mature tissues to new tissues, so that the iron utilization efficiency, the yield, the grain iron content and the like of the rice are improved.

Description

OsIDT1, a rice iron deficiency tolerance gene, and its application in improving iron utilization efficiency. Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology and relates to the application of the rice iron deficiency tolerance gene OsIDT1. Background Technology

[0002] Iron (Fe) is one of the essential nutrients for plant growth and development. Firstly, iron participates in the synthesis of chlorophyll (Terry et al., 1986). Therefore, when plants are deficient in iron, they initially exhibit symptoms such as yellowing of leaf veins, leaf shrinkage, and stunted growth, which in turn affects plant growth and development, leading to impaired fruit quality and reduced yields of economic crops. Iron also participates in plant respiration, being a component of some respiration-related enzymes, such as catalase and peroxidase (Hinchliffe et al., 2005). Furthermore, iron is a cofactor for iron-sulfur proteins and heme proteins, assisting in redox reactions (Hansch et al., 2009). Iron also participates in the assimilation and utilization of other nutrients. Therefore, exploring the molecular mechanisms of iron absorption, transport, and utilization in plants has long been a focus of attention in the botanical community.

[0003] Although iron is abundant in soils, it exists mostly as iron oxide and hydroxides, with poor solubility and low bioavailability (Colombo et al., 2014). Its bioavailability is particularly suppressed in alkaline and calcareous soils. 3+ The concentration of ions is usually only 10. -14 Up to 10 -17 M (White et al., 1999). For plants to maintain normal growth and development, the ideal range for iron ion concentration in the soil should be 10. -4 Up to 10 -9 M (Garrido et al., 2006) is far higher than the available iron levels in alkaline soils. Based on this data analysis, botanists believe that approximately one-third of the world's arable land may currently have potential iron deficiency (Narwal et al., 2017; Vose 1982), making crop iron deficiency a critical problem that urgently needs to be addressed.

[0004] Iron is an essential micronutrient that is easily deficient in humans and animals. Iron deficiency in the soil leads to a decrease in the iron content of crop grains, which in turn directly affects the nutritional status of humans and animals. When the amount of iron absorbed from the diet is insufficient to meet physiological needs, people are prone to nutritional iron deficiency. This is not only due to the low absolute value of iron intake in the diet, but also to the low ratio of heme iron to non-heme iron in the intake. Consuming appropriate meat products and ascorbic acid is beneficial for the body's absorption of non-heme iron; conversely, phytates, tannins, phenolic substances, and calcium can interfere with this absorption process (Rani et al., 2010). Phytic acid is widely found in cereal and legume seeds, accounting for about 1-2% of the dry weight of the grain. Therefore, choosing cereal foods as an iron source is a poorly effective way to supplement iron, and people who rely on cereal crops (rice, wheat, corn, etc.) as their staple food are also prone to iron deficiency anemia (Feizollahi et al., 2021; Gupta et al., 2015). The resulting iron deficiency and "hidden hunger" has become a global problem.

[0005] Today, with increasing emphasis on balanced nutrition, numerous iron supplements have appeared on the market, effectively replenishing iron in oral or injectable form to prevent and treat iron-deficiency anemia. However, iron supplements are only one part of the treatment for iron-deficiency anemia. Given their high price and side effects, people should focus more on adjusting their daily diet and increasing their intake of iron-rich foods. Therefore, the most fundamental way to improve human iron nutrition is to address the problem of iron deficiency in crops. As botanists delve deeper into the molecular mechanisms of iron absorption, transport, and utilization in plants, more and more key genes for iron homeostasis are being discovered. Coupled with advancements in genetic engineering and biotechnology, increasing the iron content of rice grains through biofortification and breeding new iron-rich rice varieties has become one of the effective strategies for addressing the global problem of "hidden hunger." Summary of the Invention

[0006] The purpose of this invention is to address the aforementioned problems in the prior art and to provide an application for the rice iron deficiency tolerance gene OsIDT1. The accession number for OsIDT1 in GenBank is PX136074.

[0007] The first objective of this invention is to provide the application of the rice iron deficiency tolerance gene OsIDT1 in regulating rice iron utilization efficiency. Overexpression of the rice gene OsIDT1 increases rice iron utilization efficiency, while knockout or knockdown of the OsIDT1 gene decreases rice iron utilization efficiency.

[0008] Furthermore, the genomic nucleotide sequence of the rice iron deficiency tolerance gene OsIDT1 is shown in SEQ ID NO.1, and the CDS sequence of the rice iron deficiency tolerance gene OsIDT1 is shown in SEQ ID NO.2.

[0009] A second objective of this invention is to provide a knockout vector for the rice iron deficiency tolerance gene OsIDT1.

[0010] Furthermore, the knockout vector is obtained by assembling the sgRNA expression cassette OsU6a-T1-sgRNA containing the target sequence T1 of the rice iron deficiency tolerance gene OsIDT1 as shown in SEQ ID NO.3, and the sgRNA expression cassette OsU6a-T2-sgRNA containing the rice iron deficiency tolerance gene OsIDT1 as shown in SEQ ID NO.4, between the BsaI-BsaI restriction sites of the basic vector, based on the pYLCRISPR / Cas9Pubi-H vector as the base vector.

[0011] The third objective of this invention is to provide an overexpression vector for the aforementioned rice iron deficiency tolerance gene OsIDT1.

[0012] Furthermore, the overexpression vector is obtained by inserting the CDS sequence of the iron deficiency tolerance gene OsIDT1 shown in SEQ ID NO.2 between the BamHI-SacI restriction sites of the base vector, based on the pUN1301-eGFP vector.

[0013] A fourth objective of this invention is to provide the application of the aforementioned overexpression vector in improving iron utilization efficiency in rice.

[0014] Furthermore, the aforementioned overexpression vector was introduced into rice to obtain rice that overexpressed the iron deficiency tolerance gene OsIDT1, thereby improving the iron utilization efficiency of rice.

[0015] Furthermore, the present invention improves the iron utilization efficiency of rice by increasing the rice's tolerance to iron deficiency, increasing the rice's plant height under iron deficiency conditions, promoting the redistribution of iron from mature tissues to new tissues under iron deficiency conditions, increasing rice yield, and increasing the iron content of rice grains.

[0016] The fifth objective of this invention is to provide the application of the aforementioned knockout vector in reducing iron utilization efficiency in rice. By introducing the knockout vector into rice, rice with the iron deficiency tolerance gene OsIDT1 knocked out is obtained, thereby reducing the iron utilization efficiency of rice. The reduction in iron utilization efficiency of rice is to reduce the tolerance of rice to iron deficiency environment, reduce rice plant height, reduce rice yield, and reduce the iron content of rice grains.

[0017] The beneficial effects of this invention are as follows: 1. Through systematic research, this invention provides for the first time a biological function of the iron deficiency tolerance gene OsIDT1 in improving iron utilization efficiency in rice.

[0018] 2. Knocking out the iron deficiency tolerance gene OsIDT1 significantly reduced the iron content in new rice leaves, thereby reducing iron utilization efficiency.

[0019] 3. Knockout material for the iron deficiency tolerance gene OsIDT1 was constructed.

[0020] 4. Overexpression of the iron deficiency tolerance gene OsIDT1 significantly increased the iron content in new rice leaves, thereby improving iron utilization efficiency.

[0021] 5. Overexpression material of the iron deficiency tolerance gene OsIDT1 was constructed.

[0022] The application of the iron deficiency tolerance gene OsIDT1 provided by this invention can effectively promote the transport of iron from mature tissues to new tissues, thereby improving the iron utilization efficiency of rice. Attached Figure Description

[0023] Figure 1 shows the heterologous expression effect of the rice iron deficiency tolerance gene OsIDT in yeast.

[0024] Figure 2 shows the iron deficiency tolerance experiment of the OsIDT1 knockout mutant in rice; where: A: phenotypic and plant height statistics of wild-type JNSM seedlings and OsIDT1 knockout mutant seedlings after 3 weeks of treatment with different iron concentrations; B: phenotypic and leaf tip chlorophyll content statistics of the top leaf of wild-type JNSM seedlings and OsIDT1 knockout mutant seedlings after 3 weeks of treatment with different iron concentrations.

[0025] Figure 3 shows the iron content statistics of rice seedlings with the OsIDT1 knockout mutant gene; where: A: Sampling diagram; B: Comparison of root iron content between OsIDT1 knockout mutant seedlings and wild-type JNSM seedlings; C: Comparison of iron content in the first leaf from the bottom between OsIDT1 knockout mutant seedlings and wild-type JNSM seedlings; D: Comparison of iron content in the second leaf from the bottom between OsIDT1 knockout mutant seedlings and wild-type JNSM seedlings; E: Comparison of iron content in the third leaf from the bottom between OsIDT1 knockout mutant seedlings and wild-type JNSM seedlings; F: Comparison of iron content in the fourth leaf from the bottom between OsIDT1 knockout mutant seedlings and wild-type JNSM seedlings.

[0026] Figure 4 shows the iron deficiency tolerance experiment of rice overexpression material of the iron deficiency tolerance gene OsIDT1; where: A: phenotypic and plant height statistics of wild-type ZH11 seedlings and OsIDT1 overexpression material seedlings after 3 weeks of treatment with different iron concentrations; B: phenotypic and leaf tip chlorophyll content statistics of the top leaf of wild-type ZH11 seedlings and OsIDT1 overexpression material seedlings after 3 weeks of treatment with different iron concentrations.

[0027] Figure 5 shows the iron content statistics of rice seedlings overexpressing the iron deficiency tolerance gene OsIDT1; where: A: Sampling diagram; B: Comparison of root iron content between OsIDT1 overexpression seedlings and wild-type ZH11 seedlings; C: Comparison of iron content in the first leaf from the bottom between OsIDT1 overexpression seedlings and wild-type ZH11 seedlings; D: Comparison of iron content in the second leaf from the bottom between OsIDT1 overexpression seedlings and wild-type ZH11 seedlings; E: Comparison of iron content in the third leaf from the bottom between OsIDT1 overexpression seedlings and wild-type ZH11 seedlings; F: Comparison of iron content in the fourth leaf from the bottom between OsIDT1 overexpression seedlings and wild-type ZH11 seedlings.

[0028] Figure 6 shows pot experiments of rice iron deficiency tolerance gene OsIDT1 knockout mutant and overexpression material; where: A: Maturity growth phenotype of wild-type plants, rice iron deficiency tolerance gene OsIDT1 knockout mutant plants and overexpression material plants under different soil conditions; B: Comparison of yield between OsIDT1 knockout mutant plants and wild-type ZH11 plants; C: Comparison of grain iron content between OsIDT1 knockout mutant plants and wild-type ZH11 plants; D: Comparison of yield between OsIDT1 overexpression material plants and wild-type ZH11 plants; E: Comparison of grain iron content between OsIDT1 overexpression material plants and wild-type ZH11 plants. Detailed Implementation

[0029] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0030] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. Example 1

[0031] The heterologous expression of the iron deficiency tolerance gene OsIDT1 in yeast was carried out as follows: (1) RNA was extracted from the aboveground part of maize seedling B73 and then reverse transcribed to obtain cDNA; using cDNA as a template, the full-length coding region sequence (CDS sequence) of ZmYS1 (a gene with Fe(III)-DMA transport activity, used as a positive control) was amplified using pDR196-YS1-F / pDR196-YS1-R as primers; (2) RNA was extracted from the aboveground part of rice variety Jinong Simiao (JNSM) and then reverse transcribed to obtain cDNA; using cDNA as a template, the full-length coding region sequence (CDS sequence) of OsIDT1 was amplified using pDR196-IDT1-F / pDR196-IDT1-R as primers.

[0032] (3) Using the pDR196 vector as the backbone, the vector was double-digested with restriction endonucleases XhoI and EcoRI. The resulting linearized vector fragment was then homologously recombined with the CDS fragments of ZmYS1 and OsIDT1, respectively. (4) The recombinant product was transformed into E. coli and cultured overnight at 37°C. Single colonies were then picked for sequencing verification. (5) Plasmids were extracted from the successfully sequenced single colonies. The ZmYS1-pDR196 plasmid, OsIDT1-pDR196 plasmid, and pDR196 plasmid were then transformed into yeast strain Δfet3fet4 and cultured for 5 days in a 30°C biochemical incubator. (6) Single colonies of each transformed strain were picked and inoculated into 3 ml of SD-Ura liquid medium and cultured overnight in a shaker at 30°C / 200 rpm. (7) The OD of the three bacterial cultures was adjusted using sterile ddH2O. 600 nm The concentration of the bacterial culture was initially set at 1.0, and then serially diluted to 10 at a ratio of 10. -4 Then, using a multi-pipette, 3 μl of the suspension was applied sequentially to SD / -Ura solid medium containing 20 μM Fe(III)-DMA and 0 μM Fe. The medium was then placed in a 30℃ biochemical incubator for cultivation. After 4 days, the growth status of the yeast was recorded by photograph.

[0033] The sequences of the amplification primers are as follows: pDR196-YS1-F: 5'- CGGGCCCCCCCTCGAGATGGACCTTGCACGGAGCG-3' (SEQ ID NO.5); pDR196-YS1-R: 5'- CGGGCTGCAGGAATTCCTAGCTTCCAGGAGTGAAC-3' (SEQ ID NO.6).

[0034] pDR196-IDT1-F: 5'- CGGGCCCCCCCTCGAGATGGAGTCGGTCGGCG -3' (SEQ ID NO. 7); pDR196-IDT1-R: 5'- CGGGCTGCAGGAATTCTCATCCAGCTTTAGC -3' (SEQ ID NO. 8).

[0035] The results showed that in iron-free solid culture medium, the growth status of yeast strains transformed with OsIDT1 and those transformed with the known iron transporter encoding gene ZmYS1 was no different from that of yeast strains transformed with the empty vector pDR196. However, in solid culture medium containing 20 μM Fe(III)-DMA, the growth status of yeast strains transformed with OsIDT1 and those transformed with ZmYS1 was significantly stronger than that of yeast strains transformed with the empty vector pDR196. Empty represents yeast strains transformed with vector pDR196, ZmYS1 represents yeast strains transformed with the recombinant vector pDR196-ZmYS1, and OsIDT1 represents yeast strains transformed with the recombinant vector pDR196-OsIDT1 (Figure 1). Example 2

[0036] The preparation of the OsIDT1 knockout mutant, a rice iron deficiency tolerance gene, was carried out as follows: 1) OsIDT1 was knocked out using CRISPR / Cas9 gene editing technology. The sequences TCCGTCGACGGCCCATCCCG (SEQ ID NO.3) and CTGGTCGAGCAGGCGCGTCC (SEQ ID NO.4) in the CDS region of OsIDT1 shown in SEQ ID NO.2 were selected as editing target sites T1 and T2, and primers for constructing the knockout vector were designed.

[0037] The primer sequences are as follows: gRT1: 5'-TCCGTCGACGGCCCATCCCGGTTTTAGAGCTAGAAAT-3' (SEQ ID NO.9); OsU6aT1: 5'-CGGGATGGGCCGTCGACGGACGGCAGCCAAGCCAGCA-3' (SEQ ID NO.10); gRT2: 5'-CTGGTCGAGCAGGCGCGTCCGTTTTAGAGCTAGAAAT-3' (SEQ ID NO. 11); OsU6bT2: 5'-GGACGCGCCTGCTCGACCAGCAACACAAGCGGCAGC-3' (SEQ ID NO. 12).

[0038] 2) Using plasmids pYLsgRNA-OsU6a and pYLsgRNA-OsU6b as templates, sgRNA expression cassette fragments containing T1 and T2 were amplified by PCR.

[0039] The amplification system was as follows: 10 μl Mix buffer; 2 μl plasmid; 0.5 μl each of the primers shown in SEQ ID NO. 9~12; 7 μl ddH2O; the amplification program was as follows: (1) 95℃, 3 min; (2) 95℃, 15 s; (3) 58℃, 15 s; (4) 72℃, 20 s; (5) 72℃, 5 min; (6) 4℃, 5 min; steps (2)-(4) were repeated for 35 cycles.

[0040] 3) Using the sgRNA expression cassette fragment from 2) as a template, the complete sgRNA expression cassettes OsU6a-T1-sgRNA and OsU6a-T2-sgRNA were further amplified.

[0041] The amplification system consisted of: 10 μl Mix buffer; 2 μl expression cassette fragment; 0.5 μl each of the primers shown in SEQ ID NO. 9~12; and 7 μl ddH2O. The amplification program was as follows: (1) 95℃, 3 min; (2) 95℃, 15 s; (3) 58℃, 15 s; (4) 72℃, 20 s; (5) 72℃, 5 min; and (6) 4℃, 5 min. Steps (2)-(4) were repeated for 35 cycles.

[0042] 4) Assemble the sgRNA expression cassettes OsU6a-T1-sgRNA and OsU6a-T2-sgRNA between the BsaI-BsaI restriction sites of the pYLCRISPR / Cas9Pubi-H knockout vector.

[0043] 5) Transform the verified pYLCRISPR / Cas9Pubi-H plasmid into rice. The specific transgenic process is as follows: (1) Transform the pYLCRISPR / Cas9Pubi-H plasmid into Agrobacterium (EHA105); (2) Use rice variety Jin Nong Simiao (JNSM) seeds as material, peel off the shells, disinfect them and place them on the induction medium to induce callus tissue; (3) Infect the callus tissue with Agrobacterium bacterial solution, then wash it three times with sterile ddH2O and place it on the selection medium to screen out resistant callus tissue; (4) Transfer the resistant callus tissue to the differentiation medium and the rooting medium in sequence, and obtain transgenic T0 generation plants after induction differentiation and rooting.

[0044] 6) Plant T0 generation plants in the field, sequence them to identify whether the OsIDT1 coding region has mutated, select homozygous mutant single plants, and harvest T1 generation seeds.

[0045] The identification primers were: CRISPR-OsIDT1-F: 5'-ATCGACCATCACTTGCATGC-3′ (SEQ ID NO.13); CRISPR-OsIDT1-R: 5'-ATCGTTCCACCGCATGAAG-3′ (SEQ ID NO.14); Upon testing, three knockout mutants of the iron deficiency tolerance gene OsIDT1 with different editing patterns, KO-1, KO-2, and KO-3, were obtained in this example. Example 3

[0046] The preparation of OsIDT1 overexpression material in rice was carried out as follows: (1) RNA was extracted from the aboveground parts of rice variety Zhonghua 11 (ZH11) and then reverse transcribed to obtain cDNA; using cDNA as a template, the full-length coding region sequence (CDS sequence) of OsIDT1 was amplified using pUN1301-IDT1-F / pUN1301-IDT1-R primers. Then, using pUN1301 vector as a template, the full-length sequence of GFP was amplified using pUN1301-GFP-F / pUN1301-GFP-R primers.

[0047] (2) Using the pUN1301-eGFP vector as the backbone, the vector was double-digested with restriction endonucleases BamHI and SacI. The resulting linearized vector fragment was then homologously recombined with the CDS fragment and GFP fragment of OsIDT1 to obtain the pUN1301-OsIDT1 plasmid.

[0048] (3) The recombinant product was transformed into Escherichia coli and cultured overnight at 37°C. Single colonies were then selected for sequencing verification. (4) The verified pUN1301-OsIDT1 plasmid was transformed into rice. The specific transgenic process was as follows: ① The pUN1301-OsIDT1 plasmid was transformed into Agrobacterium (EHA105). ② Using seeds of the rice variety Zhonghua 11 (ZH11) as material, the seeds were shelled, disinfected, and placed on an induction medium to induce callus tissue. ③ The callus tissue was infected with Agrobacterium bacterial solution, then washed three times with sterile ddH2O and placed on a selection medium to screen for resistant callus tissue. ④ The resistant callus tissue was transferred sequentially to differentiation medium and rooting medium. After induction of differentiation and rooting, transgenic T0 generation plants were obtained.

[0049] ⑤ Plant T0 generation plants in the field, identify whether OsIDT1 is overexpressed, select the correctly identified individual plants, and harvest T1 generation seeds.

[0050] The sequences of the amplification primers are as follows: pUN1301-IDT1-F: 5'- GGTGGAGGCGGTTCAATGGAGTCGGTCGGC-3' (SEQ ID NO.15); pUN1301-IDT1-R: 5'- CGATCGGGGAAATTCGAGCTCGGATACAGAATGCTG-3' (SEQ ID NO.16).

[0051] pUN1301-GFP-F: 5'-TCTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3' (SEQ ID NO. 17); pUN1301-GFP-R: 5'-TGAACCGCCTCCACCCTTGTACAGCTCGTCCATGCC-3' (SEQ ID NO. 18). Example 4

[0052] Example 2 describes the experiment on different iron concentration treatments of the OsIDT1 knockout mutants KO-1, KO-2, and KO-3, prepared in Example 2. The specific implementation process is as follows: 1) Seed soaking: After washing rice seeds with clean water to remove the empty and shriveled glumes floating on the surface, soak them at room temperature for 1 day, and then germinate them in a 37℃ biochemical incubator until they show white sprouts. Once the seeds show white sprouts, sow them on a small black net secured with foam boards around the edges. Place them in a greenhouse for cultivation in the dark for 3 days.

[0053] 2) Initial culture: After one week of culture under normal light, add 1 / 2 Kimura B nutrient solution and continue culture. Adjust the pH of the nutrient solution to 5.6 and change the nutrient solution every 3 days.

[0054] 3) Different iron concentration treatments: After culturing for 2 weeks under normal conditions, add the required volume of 20 mM EDTA-NaFe stock solution (1000X) to a freshly replaced 1 / 2 Kimura B nutrient solution in a transfer chamber. Shake the treatment solution with a glass rod until the final concentration is 0 μM Fe or 20 μM Fe. Treat for 3 weeks, changing the treatment solution every 2 days. Carefully observe the seedling growth during the treatment period.

[0055] 4) Determine plant height and chlorophyll content of the tip of the first leaf from the bottom: During the treatment period, the plant height and chlorophyll content of the tip of the first leaf from the bottom of wild-type JNSM seedlings and OsIDT1 knockout mutant seedlings were measured once a week.

[0056] The results showed that after 3 weeks of treatment with 20 μM Fe, the plant height of the OsIDT1 knockout mutant seedlings was significantly lower than that of the wild-type JNSM seedlings. After 3 weeks of treatment with 0 μM Fe, the plant height of the OsIDT1 knockout mutant seedlings was also significantly lower than that of the wild-type JNSM seedlings, and the difference was widening (Figure 2A). After 3 weeks of treatment with 20 μM Fe, the chlorophyll content at the leaf tip of the OsIDT1 knockout mutant seedlings was basically not significantly different from that of the wild-type JNSM seedlings. After 3 weeks of treatment with 0 μM Fe, the chlorophyll content at the tip of the bottom leaf of the OsIDT1 knockout mutant seedlings was significantly lower than that of the wild-type JNSM seedlings (Figure 2B). This example demonstrates that knocking out the iron deficiency tolerance gene OsIDT1 reduces the iron deficiency tolerance of rice. Example 5

[0057] The iron content of the iron deficiency tolerance gene OsIDT1 knockout mutants KO-1, KO-2, and KO-3 prepared in Example 2 was determined as follows: 1) After Example 4, samples of wild-type ZH11 seedlings and iron deficiency tolerance gene OsIDT1 knockout mutant seedlings were collected from different parts of the plant. The parts included: roots, the first leaf from the bottom, the second leaf from the bottom, the third leaf from the bottom, and the fourth leaf from the bottom.

[0058] 2) Dry in an oven at 42℃ until constant weight, weigh, and digest using a graphite furnace. Then, use ICP-MS to determine the iron content of each part.

[0059] The results showed that after 3 weeks of treatment with 20 μM Fe, the iron content in the roots of OsIDT1 knockout mutant seedlings was not significantly different from that in wild-type JNSM seedlings, but the iron content in the first and second leaves from the bottom was significantly lower than that in wild-type JNSM seedlings. After 3 weeks of treatment with 0 μM Fe, the iron content in the roots, first and second leaves from the bottom of OsIDT1 knockout mutant seedlings was significantly lower than that in wild-type JNSM seedlings, but the iron content in the third leaf from the bottom was significantly higher than that in wild-type JNSM seedlings (Figure 3). This example shows that mutation of the iron deficiency tolerance gene OsIDT1 hinders the redistribution of iron from mature tissues to new tissues, thereby reducing the iron utilization efficiency of rice. Example 6

[0060] The experiment on different iron concentration treatments of OE-1, OE-2 and OE-3, the iron deficiency tolerance gene OsIDT1 overexpression materials prepared in Example 3, was carried out in the same manner as in Example 4.

[0061] The results showed that after 3 weeks of treatment with 20 μM Fe, the plant height of OsIDT1 overexpression seedlings was not significantly different from that of wild-type ZH11 seedlings. After 3 weeks of treatment with 0 μM Fe, the plant height of OsIDT1 overexpression seedlings was significantly higher than that of wild-type ZH11 seedlings (Figure 4A). After 3 weeks of treatment with 20 μM Fe, the chlorophyll content at the leaf tip of OsIDT1 overexpression seedlings was not significantly different from that of wild-type ZH11 seedlings. After 3 weeks of treatment with 0 μM Fe, the chlorophyll content at the tip of the bottom leaf of OsIDT1 overexpression seedlings was significantly higher than that of wild-type ZH11 seedlings (Figure 4B). This example demonstrates that overexpression of the iron deficiency tolerance gene OsIDT1 improves iron deficiency tolerance in rice. Example 7

[0062] The iron content of OE-1, OE-2 and OE-3, the iron deficiency tolerance gene OsIDT1 overexpression materials prepared in Example 3, was determined in the same manner as in Example 5.

[0063] The results showed that after 3 weeks of treatment with 20 μM Fe, the iron content in all parts of the OsIDT1 overexpression seedlings was not significantly different from that of wild-type JNSM seedlings; after 3 weeks of treatment with 0 μM Fe, the iron content in the roots, the first leaf from the bottom, and the second leaf from the bottom of the OsIDT1 overexpression seedlings was slightly higher than that of wild-type JNSM seedlings, but the difference was not statistically significant (Figure 5). This example demonstrates that overexpression of the iron deficiency tolerance gene OsIDT1 promotes the redistribution of iron from mature tissues to newly formed tissues, thereby improving the iron utilization efficiency of rice. Example 8

[0064] Example 2 shows the pot experiment of the iron deficiency tolerance gene OsIDT1 knockout mutants KO-1, KO-2, and KO-3, and the overexpression materials OE-1, OE-2, and OE-3. The specific implementation process is as follows: 1) After germinating wild-type JNSM seeds and T1 generation homozygous seeds of mutants KO-1 and KO-2, wild-type ZH11 seeds and overexpression materials OE-1 and OE-2 at 37℃ for 3 days, the seeds were sown on a plastic black net suspended on tap water. Cardboard was covered on the black net for shading to promote rooting. After 3 days, the cardboard was removed and the plants were placed under normal light to grow.

[0065] 2) One week later, the wild-type and genetically modified seedlings were transferred to a black plastic bucket containing 1 / 2 Kimura B nutrient solution and allowed to continue growing for another week, with the nutrient solution being changed every 3 days.

[0066] 3) Prepare alkaline soil. Divide the paddy soil into 4 kg portions, for a total of 24 portions. Place 12 portions of soil in a normal plastic bucket, then water them with deionized water (adjusting the pH to 7.0) until the soil is submerged, for normal soil cultivation treatment; add 2.5 g of CaO to each of the other 12 portions of soil, mix well, place them in a drainable plastic bucket, then water them with 1000 ml of deionized water (adjusting the pH to 9.0) until the soil is moist but no excess water seeps out, for soil cultivation treatment at pH 9.0.

[0067] 4) Select wild-type JNSM seedlings and mutant KO-1 and KO-2 seedlings with uniform growth and transplant them into plastic buckets. Transplant 6 buckets under normal flooding conditions and 6 buckets under high pH drainage conditions, with one wild-type JNSM seedling, one KO-1 seedling, and one KO-2 seedling per bucket. Select wild-type ZH11 seedlings and overexpression materials OE-1 and OE-2 seedlings with uniform growth and transplant them into plastic buckets. Transplant 6 buckets under normal flooding conditions and 6 buckets under high pH drainage conditions, with one wild-type ZH11 seedling, one OE-1 seedling, and one OE-2 seedling per bucket. Place the plastic buckets in a greenhouse, and apply fertilizer and control pests and diseases as usual throughout the rice growth period in ordinary field.

[0068] 5) After maturity, the yield of each line was counted. The kernels on the tip of the main spike of each single plant were harvested, dried in an oven, the husks were removed, the kernels were weighed, and the kernels were digested in a graphite furnace. Then, the iron content was determined using ICP-MS.

[0069] The results showed that under flooded conditions, the yield of OsIDT1 knockout mutant plants was significantly lower than that of wild-type JNSM plants, but their grain iron content was not significantly different from that of wild-type JNSM. The yield of OsIDT1 overexpression material plants was significantly higher than that of wild-type ZH11 plants, but their grain iron content was not significantly different from that of wild-type ZH11. Under high pH drainage conditions, the yield of OsIDT1 knockout mutant plants was still significantly lower than that of wild-type JNSM plants, and their grain iron content was slightly lower than that of wild-type JNSM. The yield of OsIDT1 overexpression material plants was still significantly higher than that of wild-type ZH11 plants, and their grain iron content was slightly higher than that of wild-type ZH11 (Figure 6).

[0070] This embodiment shows that when rice is grown in an environment with low iron availability, mutation of the iron deficiency tolerance gene OsIDT1 can reduce rice yield and grain iron content, while overexpression of this gene can increase rice yield and grain iron content.

[0071]

Claims

1. The application of the rice iron deficiency tolerance gene OsIDT1 in regulating iron utilization efficiency in rice, characterized by: Overexpression of the rice gene OsIDT1 improves iron utilization efficiency in rice, while knockout or knockdown of the OsIDT1 gene reduces iron utilization efficiency in rice.

2. The application according to claim 1, characterized in that, The genomic nucleotide sequence of the rice iron deficiency tolerance gene OsIDT1 is shown in SEQ ID NO.1, and the CDS sequence of the rice iron deficiency tolerance gene OsIDT1 is shown in SEQ ID NO.

2.

3. The knockout vector of the rice iron deficiency tolerance gene OsIDT1 as described in claim 1.

4. The knockout carrier according to claim 3, characterized in that, The knockout vector is based on the pYLCRISPR / Cas9Pubi-H vector, and is obtained by assembling the sgRNA expression cassette OsU6a-T1-sgRNA containing the target sequence T1 of the rice iron deficiency tolerance gene OsIDT1 as shown in SEQ ID NO.3, and the sgRNA expression cassette OsU6a-T2-sgRNA containing the rice iron deficiency tolerance gene OsIDT1 as shown in SEQ ID NO.4, between the BsaI-BsaI restriction sites of the basic vector.

5. The overexpression vector of the rice iron deficiency tolerance gene OsIDT1 as described in claim 1.

6. The overexpression vector according to claim 5, characterized in that, The overexpression vector was obtained by inserting the CDS sequence of the iron deficiency tolerance gene OsIDT1 shown in SEQ ID NO.2 between the BamHI-SacI restriction sites of the base vector using the pUN1301-eGFP vector as the base vector.

7. The application of the overexpression vector according to claim 5 or 6 in improving iron utilization efficiency in rice.

8. The application according to claim 7, characterized in that, Introducing the overexpression vector as described in claim 5 or 6 into rice yields rice that overexpresses the iron deficiency tolerance gene OsIDT1, thereby improving the iron utilization efficiency of rice.

9. The application according to claim 1 or claim 8, characterized in that, Improving iron utilization efficiency in rice involves enhancing rice's tolerance to iron deficiency, increasing plant height under iron deficiency conditions, promoting the redistribution of iron from mature to new tissues in iron-deficient environments, increasing rice yield, and increasing the iron content of rice grains.

10. The application of the knockout carrier according to claim 3 or 4 in reducing iron utilization efficiency in rice, characterized in that, The knockout vector described in claim 3 is introduced into rice to obtain rice with the iron deficiency tolerance gene OsIDT1 knocked out, thereby reducing the iron utilization efficiency of rice. The reduction in iron utilization efficiency of rice means reducing the tolerance of rice to iron deficiency environment, reducing rice plant height, reducing rice yield, and reducing the iron content of rice grains.

Images