Application of artificially designed and synthesized small peptide AV5P-1 in prevention and treatment of plant RNA virus
The artificially designed and synthesized small peptide AV5P-1 solves the problems of insufficient permeability and targeting of existing anti-plant RNA virus agents, achieving the effect of effectively inhibiting viral replication and spread after viral infection, and providing an efficient and environmentally friendly virus prevention and control solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NINGBO UNIV
- Filing Date
- 2026-04-08
- Publication Date
- 2026-05-05
AI Technical Summary
Existing technologies struggle to develop efficient, environmentally friendly, and broad-spectrum antiviral agents against plant RNA viruses, especially after viral infection, as they are difficult to effectively inhibit viral replication and spread. Traditional agents suffer from poor permeability, insufficient targeting, low design efficiency, and in vivo validation.
A synthetic small peptide, AV5P-1, was designed and, through artificial intelligence-assisted design, targets and inhibits viral replication enzymes. It has a small molecular weight and good permeability, and can block viral replication and spread after viral infection. It can be effective by external spraying.
The small peptide AV5P-1 significantly inhibits viral replication and spread after viral infection. It is simple, environmentally friendly, applicable to a variety of crops, and does not affect the normal growth of plants, providing a new, highly efficient, and low-residue virus control solution.
Smart Images

Figure CN121974979A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of an artificially designed and synthesized small peptide AV5P-1 in the prevention and control of plant RNA viruses. Background Technology
[0002] Plant viral diseases are a significant factor restricting agricultural production. Potato virus Y (PVY) viruses, in particular, are a class of widely spreading RNA viruses that can infect various important economic crops such as tobacco and wheat, causing symptoms such as leaf yellowing, vein necrosis, and growth retardation, severely reducing crop yield and quality. Currently, the control of these viruses mainly relies on chemical agents and traditional antiviral breeding. However, these methods have significant limitations: chemical agents often pose a risk of environmental residue, and some agents only provide preventative protection before viral infection; once the virus has invaded plant tissue, their application often fails to effectively inhibit viral replication and spread. Traditional disease-resistant breeding is time-consuming, costly, and unable to cope with rapid viral mutations. Therefore, the development of highly efficient, environmentally friendly, and broad-spectrum antiviral agents has become an urgent need in the field of plant protection.
[0003] Small peptides, composed of 2-100 amino acids, possess characteristics such as high activity, ease of synthesis, and the ability to penetrate plant tissues, demonstrating potential application value in plant stress resistance and immune regulation. Traditionally, screening antiviral small peptides from plant sources has relied heavily on large-scale experimental validation, a time-consuming and labor-intensive process. Furthermore, the obtained peptides often exhibit limited activity or unclear targets, making effective intervention in viral replication difficult. In recent years, with the development of artificial intelligence in drug design, obtaining small peptides with specific targeting functions through computational simulation and rational design has become possible, providing new insights for developing novel antiviral agents against plants. However, current technologies lack successful examples of directly applying artificially designed small peptides to the control of plant RNA viruses, especially in targeting viral replicase and blocking their activity, where challenges remain such as low peptide design efficiency and insufficient in vivo validation.
[0004] Furthermore, existing antiviral agents have significant drawbacks in their application methods: most agents must be applied before viral infection to be effective, and their inhibitory effect on already infected plants is minimal. This limitation stems from the difficulty in penetrating plant tissues or in precisely targeting key viral replication sites within the plant. Therefore, designing a small peptide molecule that can efficiently enter plant cells, specifically bind to viral replication enzymes, and inhibit their function has become a key challenge in solving these problems. Although artificial intelligence-aided design has provided new avenues for small peptide development, multiple technical bottlenecks remain in practical applications, including peptide stability, broad-spectrum activity, and host safety, which urgently require breakthroughs through innovative design and experimental verification. Summary of the Invention
[0005] The purpose of this invention is to provide an application of artificially designed and synthesized small peptide AV5P-1 in the control of plant RNA viruses, thereby solving the problems existing in the prior art. The artificially designed small peptide AV5P-1 provided by this invention has a small molecular weight and good permeability, and can target and inhibit viral replication enzyme activity. It can effectively block viral replication and spread after viral infection, overcoming the shortcomings of traditional agents that are limited to prevention. This small peptide is simple to prepare, environmentally friendly, and can exert a significant antiviral effect on crops through exogenous spraying without affecting normal plant growth, providing a novel solution for developing highly efficient and low-residue plant virus control agents.
[0006] To achieve the above objectives, the present invention provides the following solution: The present invention provides a small peptide, the amino acid sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides the application of the small peptide described herein in the preparation of a drug for treating plant RNA virus infection.
[0008] Optionally, the RNA virus includes turnip mosaic virus and tomato mosaic virus.
[0009] The present invention also provides a drug for resisting plant RNA virus infection, the active ingredient of which includes the small peptides mentioned above.
[0010] The present invention also provides a method for preventing and controlling plant RNA virus infection, comprising the step of spraying the small peptide or the drug described above onto the plant exogenously.
[0011] Optionally, the spraying site is the leaves, and the concentration of the small peptide is 500 μM during the spraying process.
[0012] Optionally, the plant includes tobacco.
[0013] The present invention also provides a method for improving the resistance of plants to RNA viruses, comprising the step of exogenously spraying the small peptide or the drug described herein onto the plant.
[0014] Optionally, the spraying site is the leaves, and the concentration of the small peptide is 500 μM during the spraying process.
[0015] Optionally, the plant includes tobacco.
[0016] The present invention discloses the following technical effects: This invention utilizes artificial intelligence to design a small peptide, AV5P-1, and experimentally verifies its broad-spectrum anti-plant RNA virus activity. This peptide has a small molecular weight and suitable hydrophilicity, enabling it to efficiently penetrate plant tissues, directly target viral replication enzymes, and inhibit their activity. Therefore, it can effectively block viral replication and spread even after viral infection, overcoming the technical shortcomings of existing antiviral agents that are only effective before infection and have poor efficacy against already infected plants.
[0017] The small peptide AV5P-1 of this invention is simple to prepare and environmentally friendly. It exhibits significant antiviral effects in various crops, including tobacco, through exogenous spraying without affecting normal plant growth. The design and application strategy of this small peptide provides a novel approach and reliable technical solution for developing highly efficient, low-residue novel plant virus control agents. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 Figures showing the viral infection status in the control and treatment groups under ultraviolet light; Figure 2 The image shows the WB test results of viral protein accumulation in the treatment and control groups of TuMV (A) and ToMV (B) viruses. Figure 3 The graph shows the qRT-PCR detection levels of viral RNA in the treatment and control groups of TuMV (A) and ToMV (B) viruses. Detailed Implementation
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0025] The small peptide described in this invention is a 5-peptide designed and screened by the inventors using artificial intelligence-assisted drug design and high-throughput virtual screening technology based on protein structure (as described in the reference "Pingzhi Zhao, et al. Targeted MYC2 stabilizationconfers citrus Huanglongbing resistance. Science, 2025.04.11"). It is named Anti-virus five peptide 1 (AV5P-1), with the amino acid sequence KWLRR (SEQ ID NO.1). The small peptide AV5P-1 has a molecular weight of 757.92, an average hydrophilicity coefficient of -2.000, and a theoretical isoelectric point of 12.003. The small peptide AV5P-1 can be synthesized through sequence chemistry.
[0026] Example 1. Preparation of AV5P-1 working solution Take AV5P-1 powder (purity ≥98%), use sterile water as solvent, and mix thoroughly with a vortex mixer to prepare a 500μM AV5P-1 working solution; after preparation, filter it through a 0.22μm sterile filter membrane for sterilization, store it in a 4℃ refrigerator for later use, and bring it to room temperature before use.
[0027] 2. Construction of viral infectious clonal recombinant plasmids and Agrobacterium-mediated transformation 2.1 PCR cloning of full-length viral cDNA Based on the full-length cDNA sequences of TuMV (GenBank: MH735112.1) and ToMV (GenBank: AJ417701.1), specific primers were designed (the upstream primer contains an XbaⅠ restriction site, and the downstream primer contains a BamHI restriction site; the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.): TuMV-specific primers (SEQ ID NO.2-3): F:TCTAGAAAAAATATAAAAACTCAACACAACATACAC, SEQ ID NO.2; R-: GGATCCGTCCCTTGCATCCTATCAAATGTTAAGGCA, SEQ ID NO.3; ToMV-specific primers (SEQ ID NO.4-5): F: TCTAGAGTATTTTTACAACAATTACCAACAA, SEQ ID NO.4; R-: GGATCCTGGGCCCCAACCGGGGGTTCCGGGG, SEQ ID NO. 5.
[0028] Using the cDNA of each virus as a template, PCR amplification was performed (reaction system: 2×Taq Master Mix 25μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, cDNA template 1μL, sterile water 20μL; reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension (TuMV: 3.5 min, ToMV: 3 min), for a total of 35 cycles; 72℃ final extension for 10 min).
[0029] 2.2 Construction of Recombinant Plasmids The full-length viral fragments obtained by PCR amplification and the vector pCB301-GFP (containing the 35S promoter) were double-digested with XbaⅠ and BamHI, respectively.
[0030] Enzyme digestion system: 10 μL vector / fragment, 2 μL 10× digestion buffer, 1 μL Xba I, 1 μL BamH I, 6 μL sterile water, incubated at 37℃ for 2 h.
[0031] After the enzyme digestion products were separated by agarose gel electrophoresis (1% agarose, 120V electrophoresis for 30 min), the target fragment and the vector fragment were recovered using a gel recovery kit; and ligation was performed using T4 DNA ligase.
[0032] Ligation system: 3 μL vector fragment, 6 μL target fragment, 1 μL 10×T4 ligation buffer, 1 μL T4 DNA ligase, ligated overnight at 16℃ to construct recombinant plasmids pCB301-TuMV-GFP and pCB301-ToMV-GFP, respectively.
[0033] 2.3 Agrobacterium-mediated electroporation transformation Take 100 μL of Agrobacterium GV3101 competent cells, add 1 μg of the above pCB301-TuMV-GFP and pCB301-ToMV-GFP recombinant plasmids respectively, mix gently and transfer to a 0.2 cm electroporation cuvette (pre-cooled); place the electroporation cuvette in an electroporation transducer, set the parameters (voltage 2.5 kV, capacitance 25 μF, resistance 200 Ω) for electroporation; immediately after electroporation, add 1 mL of YEP liquid medium (antibiotic-free), and culture at 28℃ with shaking (150 rpm) for 1 h.
[0034] Spread 200 μL of culture onto YEP solid medium containing 50 μg / mL rifampicin (Rif) and 50 μg / mL kanamycin (Kan), and incubate upside down at 28°C for 24-36 h. Pick single colonies and verify them by colony PCR. After confirming positive clones, inoculate them into YEP liquid medium containing 50 μg / mL Rif and 50 μg / mL Kan, and incubate at 28°C with shaking (200 rpm) for 16 h. Add 50% glycerol (final concentration 20%) and store at -80°C for later use.
[0035] 3. Preparation and concentration adjustment of Agrobacterium-mediated bacterial suspension Take Agrobacterium positive clones containing pCB301-TuMV-GFP and pCB301-ToMV-GFP stored at -80℃, and inoculate them into 2 mL of YEP liquid medium containing 50 μg / mL Rif and 50 μg / mL Kan, respectively. Incubate at 28℃ with shaking (200 rpm) for 12-16 h until the bacterial culture reaches OD. 600 The value was 0.8-1.0; the cultured bacterial solution was transferred to a 1.5 mL centrifuge tube and centrifuged at 5000 rpm for 2 min at room temperature, discarding the supernatant; 1 mL of Agrobacterium infection solution (10 mM MES (pH 5.6), 10 mM MgCl2, 200 μM acetylsyl syringone) was added to the centrifuge tube, the bacterial cells were gently resuspended by pipetting, and centrifuged at 5000 rpm for 2 min at room temperature, discarding the supernatant; the above washing steps were repeated once; finally, the bacterial cells were resuspended in Agrobacterium infection solution, and the OD was measured by UV spectrophotometer. 600 The value was adjusted to OD using the infection solution. 600 =0.001, let stand at room temperature for 30 minutes before use.
[0036] 4. Selection of *Fumica benthamiana* and Agrobacterium infiltration inoculation Healthy plants (Nicotiana benthamiana) that have grown for 4-6 weeks, are free from pests and diseases, have a uniform height (15-20cm), and have the same number of leaves (6-8) were selected. Before the experiment, they were placed in an artificial culture room at 22℃, 16h light / 8h dark, and 60%-70% relative humidity for 3 days to adapt.
[0037] Selected Nicotiana benthamiana plants after adaptation and culture, and healthy leaves (3rd-4th leaves) from the middle of each plant were selected. Circular injection areas with a diameter of 1.5 cm were marked symmetrically on both sides of the leaf using a marker (ensuring the left and right areas were of the same size, ≥1 cm from the leaf edge, and without a midrib). Agrobacterium-mediated bacterial suspension (corresponding to TuMV and ToMV) was taken and loaded into 1 mL sterile syringes (needle removed). The syringe needle was placed close to the lower epidermis of the marked circular area on the leaf, and the bacterial suspension was slowly injected until the circular area was completely infiltrated (approximately 0.2 mL of bacterial suspension per area). Each Nicotiana plant was inoculated with only one type of Agrobacterium-mediated bacterial suspension, and three biological replicates were set up for each virus. A blank control was also included.
[0038] 5. AV5P-1 spraying treatment and cultivation condition control After Agrobacterium infiltration inoculation, the *Fumiganthus benthamianus* was transferred to an artificial culture room at 22°C, 16 hours light / 8 hours dark, and 60%-70% relative humidity; 6 hours after virus inoculation, AV5P-1 spraying treatment was performed. Control group: Sterile water was sprayed onto the circular marked area on the left half of the leaf using a small sprayer (nozzle diameter 0.5 mm, pressure 0.2 MPa). The amount of water sprayed should be such that a uniform water film is formed on the leaf surface but does not drip (0.5 mL / area). Treatment group: The prepared 500 μM AV5P-1 working solution was sprayed onto the circular marked area on the right half of the leaf, with the same spraying amount as the control group. During the spraying process, a sterile plastic baffle (0.1 mm thick, 3 cm × 5 cm in size) was used to separate the left and right areas of the leaf to prevent ADG solution from drifting to the control group area. After the spraying was completed, the Nicotiana benthamiana was placed in the above-mentioned culture room for 24 h. After 24 h, the sterile water (control group) and 500 μM AV5P-1 (treatment group) were sprayed once again according to the above method. After the repeated spraying, the culture was continued until the leaves showed symptoms of viral disease (about 3-4 days after inoculation).
[0039] 6. Ultraviolet observation and activity assessment of virus accumulation After the leaves of *Tobacco Benzovia* showed symptoms of viral infection, on the fourth day of the disease, the circular marked areas on the left and right sides of the leaves were irradiated with a handheld ultraviolet lamp in a dark room to observe and record the GFP fluorescence signal (GFP fluorescence intensity directly reflects the amount of virus accumulation); the fluorescence images of the leaves were taken with a digital camera under the same exposure parameters, and the image numbers corresponded to the treatment group, the control group and the number of days of culture.
[0040] Observation results are shown in Figure 1 ( Figure 1 In the diagram, H2O represents the sterile water control group on the left half of the leaf, and AV5P-1 represents the 500 μM AV5P-1 treatment group on the right half of the leaf. Compared with the control group, the GFP fluorescence intensity in the circular marked area of the leaf in the treatment group was significantly reduced, indicating that AV5P-1 treatment can significantly reduce the accumulation of TuMV and ToMV in the leaves of Nicotiana benthamiana and has inhibitory activity against both RNA viruses.
[0041] 7. Preparation and Western blot detection of plant protein samples 7.1 Protein Sample Preparation On the 4th day of viral infection, leaf tissue from the circularly marked areas of the control and treatment groups was collected. Three biological replicates were taken from each sample, and 0.2g of fresh tissue was taken from each replicate. The tissue was placed in a mortar and ground rapidly into powder with liquid nitrogen. The powder was then transferred to a 2mL sterile centrifuge tube, and 0.2mL of pre-chilled cell lysis buffer (200mM NaCl, 1.0mM EDTA, 1.0mM MTT, 20mM...) was added. Tris-HCl (adjust pH to 7.4 with HCl) was used to mix the protein in the centrifuge tube. The mixture was vortexed for 1 min and then placed on ice for 20 min (vortexed every 5 min for 10 s each time). The centrifuge tube was then placed in a refrigerated centrifuge at 4°C and centrifuged at 14000g for 10 min. The supernatant (approximately 0.15 mL) was carefully aspirated into a new 2 mL sterile centrifuge tube. 0.2 mL of supernatant (if insufficient, add cell lysis buffer to bring the total to 0.2 mL) was accurately aspirated into a 1.5 mL sterile centrifuge tube. 50 μL of loading buffer was added, and the mixture was gently pipetted 10 times to obtain the protein mixture. The protein mixture was heated in a boiling water bath for 5 min, then immediately transferred to an ice bath and allowed to stand for 5 min. The mixture was then centrifuged at 4°C and 14000g for 10 min. A small amount of precipitate at the bottom was discarded to obtain a clear protein sample, which was then placed on ice for later use.
[0042] 7.2 Western blot detection SDS-PAGE electrophoresis: Take 20 μL of protein sample and add it to the loading well of the SDS-PAGE gel. Electrophore at 120V for 30 min (stack gel), and then adjust the voltage to 150V for 60 min (separating gel). Transfer: After electrophoresis, the proteins on the gel were transferred to a PVDF membrane (0.45 μm pore size) using a semi-dry transfer apparatus. The transfer conditions were: 200 mA constant current and 90 min transfer time. Blocking and incubation: After transfer, place the PVDF membrane in 5% skim milk powder (prepared with TBST buffer) and incubate on a shaker at room temperature for 1 hour; discard the blocking solution, wash the membrane three times with TBST buffer for 10 minutes each time; add diluted GFP primary antibody (1:5000, prepared with TBST), and incubate overnight on a shaker at 4°C; the next day, discard the primary antibody, wash the membrane three times with TBST buffer for 10 minutes each time; add diluted HRP-labeled GFP secondary antibody (1:10000, prepared with TBST), and incubate on a shaker at room temperature for 1 hour; discard the secondary antibody, and wash the membrane three times with TBST buffer for 10 minutes each time; Color development and detection: Mix solution A and solution B in the ECL chemiluminescence kit at a 1:1 ratio, add the mixture evenly to the PVDF membrane, expose and detect it in a gel imaging system, and record the chemiluminescence signal of the GFP protein (signal intensity reflects the level of viral protein accumulation). Test results are shown Figure 2 ( Figure 2 In the figure, H2O represents the control group, AV5P-1 represents the treatment group, and Ponceau S (PS) staining represents the sample loading amount, i.e., the internal reference protein: Compared with the control group, the chemiluminescence signal intensity of GFP protein in the AV5P-1 treatment group was significantly reduced, and the reduction in GFP signal of the two viruses was similar, indicating that AV5P-1 treatment can significantly inhibit the protein accumulation of TuMV and ToMV in tobacco leaves.
[0043] 8. qRT-PCR detection of viral RNA levels 8.1 Extraction of total RNA On the 4th day of viral infection, leaf tissue from the circularly marked areas of both the control and treatment groups was collected. Three biological replicates were taken from each sample, with 0.2g of fresh tissue collected from each replicate. Total RNA was extracted from the samples using a plant total RNA extraction kit. The extraction process was strictly performed according to the instructions to ensure the integrity and purity of the RNA. RNA concentration and purity were determined using a spectrophotometer, and RNA samples with an A260 / A280 ratio between 1.8 and 2.1 were selected for subsequent analysis.
[0044] 8.2 Reverse transcription reaction An equal amount of total RNA (1 μg) was used as a template, and a reverse transcription kit was used to synthesize first-strand cDNA. Random primers can be used during reverse transcription, and the resulting cDNA is used as a template for qRT-PCR.
[0045] 8.3 qRT-PCR amplification detection Using synthesized cDNA as a template, primers targeting the coat protein-specific gene were designed for real-time quantitative PCR amplification (qToMV-CP-F: 5′-TCCGAGTTTGGTGATGT-3′, qToMV-CP-R: 5′-AGCACCAGCAATATGGT-3′, tuMV-CP-F: 5′-GGTTTGACAGACGAGCA-3′, tuMV-CP-R: 5′-AGAGGTTCCAGCGTTT-3′). The plant internal control gene Actin was used as an internal control. SYBR Green Mix real-time PCR reagent was added to the qRT-PCR reaction system, and amplification was performed on a real-time PCR instrument according to the reagent instructions. The Ct values of each sample were recorded using 2^(2π / T). -ΔΔCt The relative expression levels of viral RNA were calculated. By comparing the relative accumulation levels of viral RNA in different treatment groups and the control group, the effects of the corresponding treatments on viral replication or accumulation were assessed.
[0046] Test results as follows Figure 3 As shown, compared with the control group treated with H2O, the accumulation levels of TuMVCP and ToMVCP RNA in leaf cells treated with AV5P-1 were significantly reduced, indicating that AV5P-1 significantly inhibited the accumulation of TuMV and ToMV.
[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A small peptide, characterized in that, The amino acid sequence of the small peptide is shown in SEQ ID NO.
1.
2. The use of the small peptide according to claim 1 in the preparation of a drug for resisting plant RNA virus infection.
3. The application according to claim 2, characterized in that, The RNA viruses include turnip mosaic virus and tomato mosaic virus.
4. A drug for combating plant RNA virus infection, characterized in that, The active ingredient includes the small peptide described in claim 1.
5. A method for preventing and controlling plant RNA virus infection, characterized in that, The method includes the step of exogenously spraying the plant with the small peptide of claim 1 or the drug of claim 4.
6. The method according to claim 5, characterized in that, The spraying site is the leaves, and the concentration of the small peptide is 500 μM during the spraying process.
7. The method according to claim 5, characterized in that, The plant mentioned includes tobacco.
8. A method for improving the resistance of plants to RNA viruses, characterized in that, The method includes the step of exogenously spraying the plant with the small peptide of claim 1 or the drug of claim 4.
9. The method according to claim 8, characterized in that, The spraying site is the leaves, and the concentration of the small peptide is 500 μM during the spraying process.
10. The method according to claim 8, characterized in that, The plant mentioned includes tobacco.
Citation Information
Patent Citations
Method using synergistic effect of arabidopsis thaliana PEPR2 protein and AtPep1 small peptide to inhibit geminivirus infection
CN109913492A
Antiviral polypeptide and preparation method and application of antiviral polypeptide
CN110526960A
Application of solanaceae plant coded PABP protein in prevention and treatment of tobacco mosaic virus
CN119639799A
Immunosuppressive agents and their use in therapy
WO2015067712A1
Novel antiviral composition, and method for controlling plant viruses by using same
WO2016089166A1