Bacillus amyloliquefaciens for producing abinogen from corn steep liquor and application of bacillus amyloliquefaciens

By mutating and replacing the promoter of Bacillus amyloliquefaciens TF28, the engineered strain TF29 was constructed, which solved the problems of high cost and low corn steep liquor utilization efficiency in the production of Fengyuansu, and realized the high-efficiency and low-cost production of Fengyuansu.

CN121991858APending Publication Date: 2026-05-08INST OF MICROBIOLOGY HEILONGJIANG ACADEMY OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF MICROBIOLOGY HEILONGJIANG ACADEMY OF SCI
Filing Date
2026-03-25
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

In existing technologies, the production of Fengyuansu relies on high-cost carbon and nitrogen sources such as glucose and peptone, and conventional Bacillus strains cannot efficiently utilize the nutrients in corn steep liquor, resulting in high fermentation costs and a lack of effective strain modification strategies.

Method used

By randomly screening Bacillus amyloliquefaciens TF28 for mutations, a mutant strain TF29 with strong growth capacity was obtained. The natural promoter Pfen upstream of the nutrient synthesis operon was replaced by the tandem strong promoters PsigW and PnarK, thereby achieving targeted enhancement of the nutrient synthesis operon.

Benefits of technology

The engineered strain TF29 can effectively utilize corn steep liquor as the main nitrogen source and part of the carbon source, significantly improving the synthesis level of nutrient, reducing the cost of fermentation medium, and realizing the low-cost industrial production of nutrient.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121991858A_ABST
    Figure CN121991858A_ABST
Patent Text Reader

Abstract

The invention relates to bacillus amyloliquefaciens for producing abinogen by using corn steep liquor and application of the bacillus amyloliquefaciens, and belongs to the technical field of microbial fermentation and genetic engineering. In order to solve the technical problems that the cost of a culture medium is too high and the corn steep liquor cannot be utilized to efficiently synthesize the abinogen in the existing strain for fermentation production of the abinogen, the bacillus amyloliquefaciens TF28 is subjected to random mutation, and a bacillus amyloliquefaciens mutant strain with strong growth capability in the corn steep liquor is obtained through screening; on the basis of the mutant strain, an original promoter is replaced by series connection of strong promoters so as to directionally strengthen the expression of the abundant primordium synthetic operon. The modified bacillus amyloliquefaciens engineering bacteria can effectively utilize the corn steep liquor to grow and synthesize the high-level abrumogen, and is expected to be used for industrial production of the abrumogen.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation and genetic engineering technology, specifically relating to a Bacillus amyloliquefaciens that produces nutrient by utilizing corn steep liquor and its application. Background Technology

[0002] Fengycin is a lipopeptide with strong antifungal activity, formed by the chemical bonding of lipid molecules and amino acids. Bacillus is the most common source of fengycin synthesis. Currently, fengycin can only be synthesized through bio-fermentation, relying on carbon and nitrogen sources such as glucose and peptone. Its yield is limited by the levels of fatty acids and amino acids in the bacterial cells, resulting in high fermentation costs and significant production difficulties. Corn steep liquor, a waste product from corn starch production, is inexpensive and contains abundant nutrients such as short peptides and amino acids, as well as a rich nitrogen source, which can meet the needs of bacterial growth and metabolism. However, due to the inherent characteristics of the bacterial strains, conventional Bacillus can only utilize a small amount of nutrients from corn steep liquor for fengycin synthesis. Current technology has not systematically elucidated the transport and synthesis pathways of fengycin production from nutrients in corn steep liquor, and there is a lack of targeted strain modification strategies. Therefore, constructing engineered Bacillus strains capable of producing fengycin from corn steep liquor is of great significance for the industrial-scale production of fengycin.

[0003] Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens TF28 is a Bacillus strain capable of synthesizing nutrient esters at a high level. The inventors modified it in previous studies, significantly increasing the yield of nutrient esters produced through fermentation (see Chinese Invention Patent No. ZL202210288093.7, entitled "An Engineered Bacillus Amyloliquefaciens for Producing Nutrient Esters and Its Construction Method and Application"). However, the engineered Bacillus Amyloliquefaciens obtained in the aforementioned patent indirectly increases nutrient ester yield by enhancing the expression of global regulatory factors to promote the synthesis of all types of non-ribosomal synthetic peptides, failing to specifically increase nutrient ester yield. Furthermore, when using this engineered Bacillus Amyloliquefaciens for fermentation to produce nutrient esters, yeast extract, beef extract, and ammonium sulfate were initially used as a complex nitrogen source, leading to excessive waste of raw material resources. Currently, there are no reported technical improvement methods for strains capable of effectively utilizing corn steep liquor to synthesize nutrient esters. Summary of the Invention

[0004] To address the technical problems of high culture medium costs and inefficiency in synthesizing nutrient by corn steep liquor in existing strains used for fermentation production of nutrient biosynthesis, this invention involves randomly mutagenesis of Bacillus amyloliquefaciens TF28 to screen for a mutant strain with strong growth capacity in corn steep liquor. Based on this mutant strain, the original promoter is replaced with a strong promoter in tandem to directionally enhance the expression of the nutrient biosynthesis operon. The modified Bacillus amyloliquefaciens engineered strain can effectively utilize corn steep liquor for growth and synthesize high levels of nutrient biosynthesis.

[0005] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution: The first objective of this invention is to provide a strain of Bacillus amyloliquefaciens (BAM). Bacillus amyloliquefaciens TF29, this Bacillus amyloliquefaciens is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 37503, deposited on January 22, 2026, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0006] A second objective of this invention is to provide the application of the aforementioned Bacillus amyloliquefaciens TF29 in the production of nutrient by utilizing corn steep liquor.

[0007] In one embodiment of the present invention, the corn steep liquor is made by concentrating the wastewater generated from the corn soaking process, and its main components include: 15% nitrogenous compounds, 10% reducing sugars, 7% lactic acid, 4% lactose, and 5% ash.

[0008] In one embodiment of the present invention, the application is to use a fermentation medium containing corn steep liquor for fermentation. The composition of the fermentation medium containing corn steep liquor is as follows (by mass fraction): 4% glucose, 2% fructose, 8% corn steep liquor, 2.21‰ magnesium sulfate, 0.1‰ calcium chloride, 0.1‰ manganese sulfate, 1.5‰ potassium dihydrogen phosphate, 3‰ dipotassium hydrogen phosphate, with the balance being water, and the pH adjusted to 7.5.

[0009] In one embodiment of the present invention, the application involves inoculating a bacterial suspension of Bacillus amyloliquefaciens TF29 into a seed culture medium, culturing the seed culture to prepare a seed liquid, and then inoculating the seed liquid into a fermentation medium containing corn steep liquor for fermentation culture.

[0010] In one embodiment of the present invention, the seed culture medium comprises 2% tryptone, 0.5% yeast extract, 10 mM sodium chloride, 2.5 mM potassium chloride, 10 mM magnesium chloride, 10 mM magnesium sulfate, 20 mM glucose, and the balance being water.

[0011] In one embodiment of the present invention, the seed culture conditions are 37°C and 200 r / min for 16-24 h.

[0012] In one embodiment of the present invention, the seed culture conditions are 37°C and 200 r / min for 16 h.

[0013] In one embodiment of the present invention, the fermentation culture conditions are 37°C, 200 r / min, and culture for 48 h.

[0014] In one embodiment of the present invention, the inoculation amount of the seed liquid in the fermentation culture is 10%.

[0015] The beneficial effects of this invention are: This invention uses Bacillus amyloliquefaciens TF28, a high-yield nutrient-rich Bacillus strain, as the starting strain. First, a mutant strain with significantly enhanced growth ability in corn steep liquor was obtained through ARTP random mutagenesis, solving the problem of existing Bacillus strains' inefficient utilization of nutrients in corn steep liquor. Based on this, this invention further utilizes the strong promoter P... sigW With P narK Tandem substitution of the natural promoter P upstream of the nutrient synthesis operon fen This enabled targeted enhancement of the expression of the abundant element synthesis operon.

[0016] The results showed that the modified Bacillus amyloliquefaciens strain TF29 not only achieved efficient growth using corn steep liquor as the main nitrogen source and part of the carbon source, but also significantly improved the synthesis level of essential elements in the corn steep liquor fermentation system. Compared with the initial strain TF28, both its cell biomass and essential element yield were significantly increased. The engineered strain and its construction method provided by this invention effectively reduce the cost of fermentation culture medium, providing a new technical approach for the large-scale, low-cost industrial production of essential elements, and has good application prospects and industrialization value. Attached Figure Description

[0017] Figure 1 The figure shows the comparison of cell density between the initial strain TF28 and different mutant strains after 24 h of culture in liquid corn steep liquor; where 1 represents the initial strain TF28; and 2, 3, 4 and 5 represent different mutant strains. Figure 2 This is a statistical graph showing the changes in cell growth of control strain TF28 and engineered strain TF29 during corn steep liquor fermentation. Figure 3 This is a statistical graph showing the changes in nutrient production during corn steep liquor fermentation of control strain TF28 and engineered strain TF29. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of this invention to realize and apply the technology of this invention. In the art, any embodiments obtained by other skilled personnel without creative effort are protected by this invention.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The materials, reagents, culture media, and instruments used are all conventional materials, reagents, culture media, and instruments in the art, and can be obtained commercially by those skilled in the art. Unless otherwise specified, the molecular biology experimental operations involved in this invention, such as PCR amplification, enzyme digestion and ligation, and transformation, are all conventional experimental operations in the art or can be performed according to the product instructions of the corresponding reagents.

[0020] The Bacillus amyloliquefaciens TF28 (accession number CGMCC No. 4038) used as the starting strain for random mutation in this invention is disclosed in Chinese invention patent No. ZL202210288093.7, entitled "An engineered Bacillus amyloliquefaciens strain for producing nutrient and its construction method and application".

[0021] The engineered bacterium TF29 obtained in this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 37503, deposited on January 22, 2026. The address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0022] The corn steep liquor growth medium used in this invention comprises, by mass fraction: 4% glucose, 2% fructose, 8% corn steep liquor, 2.21‰ magnesium sulfate, 0.1‰ calcium chloride, 0.1‰ manganese sulfate, 1.5‰ potassium dihydrogen phosphate, 3‰ dipotassium hydrogen phosphate, with the remainder being water, adjusted to pH 7.5. The corn steep liquor is prepared by concentrating wastewater from the corn soaking process, and its main components include: 15% nitrogenous compounds, 10% reducing sugars, 7% lactic acid, 4% lactose, and 5% ash.

[0023] The SOC medium consists of: 2% tryptone, 0.5% yeast extract, 10 mM sodium chloride, 2.5 mM potassium chloride, 10 mM magnesium chloride, 10 mM magnesium sulfate, and 20 mM glucose.

[0024] Example 1: Screening of Bacillus amyloliquefaciens mutant strains with strong growth ability in corn steep liquor This invention uses ARTP mutagenesis to screen for Bacillus amyloliquefaciens mutants with strong growth ability in corn steep liquor. The specific screening method is as follows: (1) Take the bacterial culture of Bacillus amyloliquefaciens TF28 grown to the logarithmic growth phase, centrifuge to collect the bacterial precipitate, resuspend the bacterial cells in sterile water to obtain a concentration of 10 6 -10 8 A bacterial suspension containing CFU / mL.

[0025] (2) In the clean bench, use tweezers to place the slide in the outer flame of an alcohol lamp for 30 seconds, then place it in a sterilized petri dish. After the slide cools down, take 10 µL of bacterial suspension and spread it on the surface of the slide to complete the preparation of the slide. Sterilize the ARTP mutagenesis instrument.

[0026] (3) After the pre-sterilization is completed, the slide containing the sample to be treated is transferred to the ARTP mutagen for mutagenesis. The mutagenesis parameters are: irradiation distance 2 mm, gas flow rate 8 SLM, input power 100 W, and irradiation time 45 s.

[0027] (4) After processing, the slides were held with sterile tweezers and placed into EP tubes containing 1 mL of sterile water. The EP tubes were then placed on a shaker and shaken for 2 min to completely wash the bacteria attached to the slides into the sterile water, thus reforming the bacterial suspension. The new bacterial suspension was appropriately diluted, and 200 µL of the diluted bacterial solution was evenly spread onto solid corn steep liquor growth medium supplemented with 15 g / L agar. The culture was carried out at 37°C for 24 h to obtain the mutant strain.

[0028] (5) Select strains that grow well on solid corn steep liquor growth medium and inoculate them into liquid corn steep liquor growth medium. After culturing at 30℃ and 180 rpm for 16 h with shaking, re-inoculate with 10% of the strain into new liquid corn steep liquor growth medium and culture at 30℃ and 180 rpm for 24 h with shaking. Then dilute to a certain factor. At the same time, Bacillus amyloliquefaciens TF28 is inoculated into liquid corn steep liquor growth medium and cultured at 30℃ and 180 rpm for 16 h with shaking. After re-inoculating with 10% of the strain into new liquid corn steep liquor growth medium and culturing at 30℃ and 180 rpm for 24 h with shaking, dilute to the same factor. Using uninoculated medium as a control, the absorbance of the bacterial solution at a wavelength of 600 nm is measured. By comparing the absorbance of the mutant bacterial solution at 600 nm, Bacillus amyloliquefaciens mutant strains with strong growth ability in corn steep liquor are screened.

[0029] The results showed that after culturing in liquid corn steep liquor for 24 h, the cell density of all screened mutant strains was higher than that of the initial strain TF28, with strain 5 showing the highest OD. 600 The value was the highest, significantly better than other mutant strains and control strain TF28 ( Figure 1 This indicates that it has the strongest ability to utilize nutrients in corn steep liquor, meaning that a mutant strain that efficiently utilizes corn steep liquor for growth has been screened.

[0030] Example 2: Construction of an engineered Bacillus amyloliquefaciens strain for efficient production of nutrient-rich compounds from corn steep liquor Using Bacillus amyloliquefaciens TF28 genomic cDNA as a template, promoter P was synthesized. sigW and P narK A tandem clone of two promoters was constructed using overlap PCR, with the "TTTATATTTT" (SEQ ID NO.18) sequence serving as a spacer between the two promoters. These clones were then coupled to the P-coated operon upstream of the cytokine operon. fen The sequences on both sides of the promoter are tandemly connected at the 5' and 3' ends to construct the donor sequence; according to P fen Sequence design targeting sgRNA; using pJOE8999 as a backbone, inserting it into P using seamless cloning technology. fen -sgRNA and donor sequence, construct pJOE8999-P fen -sgRNA-P sigW -P narK The recombinant vector, namely pJOE8999-sgRNA-Donor, was used. This vector was transformed into the *Bacillus amyloliquefaciens* mutant strain obtained in Example 1. Successful knockout positive transformants were then screened, and these were the resulting engineered *Bacillus amyloliquefaciens* strain TF29. The specific method is as follows: 1. Cloning of donor sequences The genome of Bacillus amyloliquefaciens TF28 was extracted as a template, and primer P was used. sigW -F and P sigW -R amplification yields promoter P sigW (The nucleotide sequence is shown in SEQ ID NO.1), using primer P narK -F and P narK -R amplification yields promoter P narK (The nucleotide sequence is shown in SEQ ID NO.2). Using promoter P... sigW Using primer P as a template sigW -DOWN and P sigW +Space+P narK - 5' arm amplification to obtain P sigW +Interval sequence+P narK The first 5 bases are used by promoter P. narK Using primer P as a template narK -UP and P sigW +Space+P narK -3'arm amplification to obtain P sigW The last five bases + spacer sequence + P narK Fragment. Then use primer P. sigW -DOWN and P narK -UP amplified the two fragments obtained above into one recombinant fragment ①, namely P, using overlap PCR. sigW +Interval sequence+P narK Using the genome of Bacillus amyloliquefaciens TF28 as a template, primers P and P were used to... sigW +Space+P narK -SfiI-F, sgRNA-BsaI-R and sgRNA-BsaI-F,P sigW +Space+P narK -SfiI-R amplification yielded promoter P fen (Promoter P) fen The nucleotide sequence is shown in SEQ ID NO.19. Homologous arm fragments of 200 bp upstream and downstream of the knockout site are extracted (the nucleotide sequence of the upstream homologous arm 5'arm is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream homologous arm 3'arm is shown in SEQ ID NO.4). Then, primer P is used... sigW -DOWN and P sigW +Space+P narK -SfiI-R uses overlap PCR to ligate the two homologous arms to the recombinant fragment ①, obtaining a recombinant fragment ②, namely 5'arm-P. sigW +Interval sequence+PnarK -3'arm, the recombinant fragment ② is the donor sequence. The sequences of the primers used in the above process are shown in Table 1; the PCR reaction system is shown in Table 2; the PCR reaction conditions are: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55-60℃ annealing for 30 s, 72℃ extension (calculated at 1 kb / min) for a total of 30 cycles; 72℃ final extension for 10 min, and the annealing temperature is in principle (1 / 2Tm-5 of the upstream and downstream primers)℃.

[0031] SEQ ID NO.1: TGCCCCCCTCCACCATTATTGGGCTATAGCCAAGCGGTAAGGCAACGGACTTTGACTCCGTCATGCGTTGGTTCGAATCCAGCTAGCCCAGTCACAGACACCTTTGATCAAAAGGTGTCTTTTTTCTTTTCGGAAAAATCATTCCAACTT CTAACTGTTCAGTCTGTATAATAATTTTAAAAATATGTTAAGGTAGTTTATTCACGAATTACCATCTACACCCTGCCAAAAATTTGATAAACTTATTTTATAAAAAAATTGAAACCTTTTGAAACGAAGCTCGTATACATACAGACCGGT; SEQ ID NO.2: GAAAACGCCGAACCCGGTTCTTAAACAGAACCGGTTTTTTGATGACGCCGGGCGTCCCCATATCGTTTGAAAATCCTTCCTGCTGCTCTGTGTGAACGTTTTGTGAAAAAAGCAGAGTGTGTGACATAGTTCACAAGGAAACGCGCCGTCTCTGTTTATAGTGTACATAGCATCACCTGACTCGGAAGGAGTGAACGATC; SEQ ID NO.3: ATACTGAGGCGGAGAATATCTTATAAACGGTTCAACACTATCCTCATATGAAATTAAATAAACGAAGAAAAAATCTAGTGATGAAGAACTATTAAAAATCGATACTTTCATAACTTTACATTCGAAATCCTAATAAAATTAATCAAGAAA AATAAATAATTAATACTATATTCAAAAAAATGTTATAAAAATTTTATATTTTTTATTGTACTTTAAAAAAATTCGGTTAATATAATGCATATATGGATTATATAGTCATATAATTTCTTTTTTATTGTAATTATTTCAGTTTCTTATCCTC; SEQ ID NO.4: GAATTCGTTGAAAGAAAATACTTATGGTTTAACTCATGCCCAAAGGAGAGTTTGGTTTACTGAACTGTTGGAGCCTGGTACAAGCATCTGTAATCTGACCGCCTGTGTAAAATTCAGGGGTGATGTTGATCTTGATGCTCTTCAGTTGGC TCTGAACCTTTTCAATCTCCCGTAATGATGCAATCAGGTTCCAGCTGACAGAAGGAATTGAATCGGAGTCAGAGCCTCGTCTGTATCTTGCAGAATACAAAGGATTATCACTTGAAAATAATAGATTTTACAAATGCTGAAATGACTGAAAC.

[0032] Table 1 Primer Information

[0033] Table 2 PCR reaction system

[0034] 2. sgRNA design With P fen The promoter sequence (SEQ ID NO.19) was used as the target fragment to design sgRNA. The sgRNA sequence is shown in Table 1. The sgRNA fragment can be prepared by synthesizing the sense and antisense primers and then annealing at 65°C for 20 min.

[0035] SEQ ID NO.19: TTGACATTGATTTTGTTTACAATTTGACGAAATGATTTTTGAAAGTATTTATATATATATTTTAAATATTTTATTTAAAAGGAGAGTTATTTAAATGTTGATTTGTTATGTTTTGTTAACTTTTATTTATTTATTTTATATATATATTTTAAATTTATTTAAA.

[0036] 3. Construction of recombinant gene knockout vectors SfiI and BsaI enzyme digestion reaction system (20 μL): plasmid DNA 1-2 μg, 10× enzyme digestion buffer 2 μL, restriction endonuclease 1 μL, sterile deionized water to make up to 20 μL, digest at 37℃ for 1-2 h.

[0037] T4 DNA ligation reaction system (20 μL): Linearized vector and insert fragment are mixed at a molar ratio of 1:3, 10×T4 DNA ligation buffer 2 μL, T4 DNA ligase 1 μL, and sterile deionized water is added to a final volume of 20 μL. Ligation is carried out at 16℃ for 2-4 h or at 4℃ overnight.

[0038] The donor sequence obtained in step 1 and the sgRNA obtained in step 2 were ligated to the pJOE8999 vector backbone. The specific method is as follows: The pJOE8999 vector backbone was digested with the restriction endonuclease SfiI. The donor sequence obtained in step 1 was ligated to the digested vector backbone using T4 ligase to construct the pJOE8999-Donor plasmid. The pJOE8999-Donor plasmid was then digested with the restriction endonuclease BsaI. The sgRNA obtained in step 2 was ligated to the digested pJOE8999-Donor using T4 ligase to construct the pJOE8999-sgRNA-Donor recombinant vector.

[0039] 4. Transformation and screening of positive clones (1) Preparation of electrocompetent cells of Bacillus amyloliquefaciens mutant strain ① Prepare an electroporation cell buffer solution with the following components by mass fraction: 8.5% sorbitol, 8.5% mannitol, and 10% glycerol, dissolved in deionized water.

[0040] ② The mutant strain was inoculated into NYD liquid medium (by mass fraction: 0.8% beef extract, 5% yeast extract, 0.1% glucose, pH 7.2-7.5) and cultured at 30℃ for 14 h. At this time, the OD... 600 The concentration should be 0.8-1.0. Place the bacterial solution on ice for 30 minutes.

[0041] ③ Centrifuge the bacterial solution at 4000 rpm for 2 min, collect the bacterial cells, and repeat once.

[0042] ④ Wash the centrifuged bacterial cells with pre-cooled electroporation buffer, centrifuge at 4000 rpm for 2 min, and discard the supernatant.

[0043] ⑤ Repeat step ④ twice.

[0044] ⑥ Dissolve the bacterial cells in an appropriate amount of pre-cooled electroporation cell buffer; the final bacterial cell concentration should be 10. 9 ~2×10 10 CFU / mL.

[0045] ⑦ Dispense the bacterial culture into 1.5 mL Eppendorf tubes and store at -80℃. It is recommended to prepare and use immediately.

[0046] (2) Electroconversion of the recombinant carrier The recombinant vector pJOE8999-sgRNA-Donor was introduced into a Bacillus amyloliquefaciens mutant strain using electroporation. The electroporation conditions were: 2.5 kV and 5.5 ms. Immediately after electroporation, 1 mL of SOC medium was added for resuscitation, and the cells were cultured at 30°C with shaking at 100 rpm for 3 h. Then, the cells were centrifuged at 3000×g for 5 min, and 900 μL of supernatant was removed. The cells were resuspended in the remaining SOC medium, and the entire bacterial culture was plated on SOC agar plates containing 25 mg / L kanamycin. After overnight culture, single colonies were picked, and positive transformants were screened by sequencing to obtain strain TF29, which showed enhanced expression of the sucralose promoter.

[0047] Example 3: Application of Bacillus amyloliquefaciens engineered strain for efficient production of nutrient-rich compounds from corn steep liquor 200 μL of TF29 bacterial culture was inoculated into SOC medium and cultured in a shake flask at 37℃ and 200 r / min for 24 h. Then, a 10% inoculum was added to seed culture medium (SOC medium), and the culture was continued at 37℃ and 200 r / min for 16 h to prepare seed culture. The seed culture was then inoculated into corn steep liquor growth medium at a 10% inoculum and cultured at 37℃ and 200 r / min for 48 h. Samples were taken at 0, 24, and 48 h of fermentation, and the absorbance (OD) of the bacterial cells was analyzed. 600 The fermentation levels of TF28 and cytosine were determined. The initial TF28 strain was used as a control.

[0048] The method for detecting the concentration of Fengyuansu is as follows: ① Take the bacterial solution to be tested, centrifuge at 10000×g for 20 min at 4℃ to remove the bacterial cells and take the supernatant. Add 5mol / L HCl to the supernatant to pH 2.0 and let it stand at 4℃ for 12 h.

[0049] ② Centrifuge at 10000 rpm for 5 min, collect the precipitate, air dry, add 5 mL of methanol to the dried precipitate to dissolve it, filter the solvent through a sterile 0.22 μm nylon filter membrane, transfer it to a 1.5 mL Eppendorf tube, and store at 4℃.

[0050] ③ Liquid Chromatography Analysis: A C18 reversed-phase column was used to separate and purify the nutrient element. Water / TFA was used as mobile phase A, and methanol / TFA as mobile phase B. The concentration of mobile phase B was increased from 30% to 70% over 10 min, and then finally to 100% over 25 min. The detection wavelength was 210 nm. The fermentation level of nutrient element in the engineered Bacillus amyloliquefaciens was quantified using nutrient element standards (MCE, USA).

[0051] Depend on Figure 2 and Figure 3 As shown, in the corn steep liquor fermentation system, after 48 h of fermentation, strain TF29 showed a significantly higher cell density and a nutrient yield of 102.68 mg / L compared to its control strain TF28 under the same fermentation conditions. In contrast, the initial strain TF28 could only produce trace amounts of nutrient from corn steep liquor, which was significantly lower than the engineered strain obtained in this invention.

[0052] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. A strain of Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens TF29, characterized in that, Its accession number is CGMCC No.37503.

2. The application of Bacillus amyloliquefaciens TF29 as described in claim 1 in the production of nutrient by utilizing corn steep liquor.

3. The application according to claim 2, characterized in that, The corn steep liquor is made by concentrating the wastewater generated during the corn soaking process. Its main components include: 15% nitrogenous compounds, 10% reducing sugars, 7% lactic acid, 4% lactose, and 5% ash.

4. The application according to claim 3, characterized in that, The application involves fermentation using a fermentation medium containing corn steep liquor. The composition of the fermentation medium is as follows (by mass fraction): 4% glucose, 2% fructose, 8% corn steep liquor, 2.21‰ magnesium sulfate, 0.1‰ calcium chloride, 0.1‰ manganese sulfate, 1.5‰ potassium dihydrogen phosphate, 3‰ dipotassium hydrogen phosphate, with the remainder being water, and the pH adjusted to 7.

5.

5. The application according to claim 4, characterized in that, The application involves inoculating a bacterial suspension of Bacillus amyloliquefaciens TF29 into a seed culture medium, culturing the suspension to prepare a seed culture, and then inoculating the seed culture into a fermentation medium containing corn steep liquor for fermentation culture.

6. The application according to claim 5, characterized in that, The seed culture medium consists of 2% tryptone, 0.5% yeast extract, 10 mM sodium chloride, 2.5 mM potassium chloride, 10 mM magnesium chloride, 10 mM magnesium sulfate, 20 mM glucose, and the remainder is water.

7. The application according to claim 5, characterized in that, The seed culture conditions were 37℃ and 200 r / min for 16-24 h.

8. The application according to claim 5, characterized in that, The seed culture conditions were 37℃ and 200 r / min for 16 h.

9. The application according to claim 5, characterized in that, The fermentation conditions were 37℃, 200 r / min, and cultured for 48 h.

10. The application according to claim 5, characterized in that, The inoculation amount of the seed liquid in the fermentation culture is 10%.

Citation Information

Patent Citations

  • A kind of engineering bacillus amyloliquefaciens bacteria producing Fengyuansu and its construction method and application

    CN116837003B