Mint stem cells, isolated culture method and identification method

Abstract

The invention provides a mint stem cell, an isolated culture method and an identification method, and the isolated culture method of the mint stem cell comprises the following steps: taking a stem tip meristem of a mint stem tip as an explant, carrying out induction culture on the stem tip meristem to generate an embryonic callus; and carrying out suspension culture on the embryonic callus to obtain the mint stem cell suspension system. The technical problems that in the prior art, due to dependence on traditional agricultural planting, the yield and quality of active ingredients of mint are unstable, and a specific and high-activity stem cell culture system for mint is lacked are solved. According to the method, through a series of elaborately designed steps, the target of obtaining high-quality stem cells from the source is achieved.

Description

Technical Field

[0001] This invention relates to the field of plant tissue culture technology, and in particular to a peppermint stem cell and its isolation, culture, and identification methods. Background Technology

[0002] Peppermint is a perennial herb belonging to the genus *Mentha* in the family Lamiaceae. It contains a variety of active ingredients, among which menthol, menthone, and flavonoids are widely used in food additives, pharmaceuticals, oral care products, cosmetics, and fragrance industries. Currently, the production and extraction of peppermint's active ingredients mainly rely on traditional agricultural cultivation and chemical extraction, which suffers from problems such as strong dependence, long production cycles, susceptibility to environmental and seasonal influences, and large fluctuations in the content of effective components. Furthermore, there is a significant gap in its application at the cellular level, particularly in stem cell research.

[0003] Plant stem cells are undifferentiated cells with unlimited division capacity. They can stably retain plant genetic information, and their bioactive components can be efficiently extracted through in vitro culture, making them an important way to solve the problems of plant resource shortages and unstable raw material quality. Current plant stem cell culture techniques often use differentiated root, stem, and leaf tissues as explants, obtaining stem cells through callus dedifferentiation. However, this method suffers from problems such as weak cell division capacity, susceptibility to degeneration and mutation, and long culture cycles.

[0004] Currently, research on peppermint mainly focuses on cultivation, breeding, chemical composition analysis, and essential oil extraction processes, with few reports on research into peppermint stem cell culture. Existing plant stem cell culture technologies are mostly used in medicinal plants such as ginseng, yew, and snow lotus, and their culture systems are species-specific and cannot be directly applied to peppermint. Therefore, further improvement and development are needed. Summary of the Invention

[0005] To address the shortcomings of existing technologies and solve the aforementioned problems, a method for isolating and culturing peppermint stem cells, as well as an identification method, is proposed, and the following technical solution is provided: A method for isolating and culturing peppermint stem cells includes the following steps: using the apical meristem of peppermint as an explant, inducing and culturing the apical meristem to generate embryogenic callus, and culturing the embryogenic callus in suspension to obtain a peppermint stem cell suspension system.

[0006] Furthermore, the diameter of the apical meristem is 0.1-0.3 mm.

[0007] Furthermore, the apical meristem of the shoot tip is subjected to surface sterilization treatment before induction culture.

[0008] Furthermore, the surface sterilization treatment includes: first soaking in 75% ethanol for 5-10 minutes, and then soaking in sodium hypochlorite solution with an effective chlorine content of 2-5% for 8-15 minutes.

[0009] Furthermore, the shoot tip meristem was inoculated onto a solid induction medium and cultured in the dark. The solid induction medium was based on B5 or MS medium, supplemented with 2,4-dichlorophenoxyacetic acid (1.0-3.0 mg / L), 6-benzylaminopurine (0.1-0.5 mg / L), 20-30 g / L sucrose, and 6-8 g / L agar powder. The pH of the medium used for induction culture was 5.6-5.8.

[0010] Furthermore, the conditions for the dark culture are: temperature 23±2℃, culture time 20-30 days.

[0011] Furthermore, the suspension culture medium was a liquid subculture medium based on B5 medium, with the addition of 0.5-2.0 mg / L of 2,4-dichlorophenoxyacetic acid, 0.05-0.2 mg / L of 6-benzylaminopurine, and 30 g / L of sucrose, and the pH was adjusted to 5.6-5.8.

[0012] Furthermore, the suspension culture conditions are: temperature 23±2℃, rotation speed 100-120 rpm, under dark or low light conditions, subculture every 10-14 days, for a total of 3-5 subcultures.

[0013] In addition, this application also provides a peppermint stem cell suspension obtained by the above method.

[0014] This application also provides a method for identifying peppermint stem cells, which involves detecting and comparing the expression levels of stem cell marker genes WUS and CLV3 in peppermint stem cell suspensions and mature peppermint leaf cells. If the expression levels of WUS and CLV3 genes in the suspension cells of the peppermint stem cell suspension are higher than those in mature leaf tissue, then the suspension cells are stem cells. The method for identifying peppermint stem cells is characterized by detecting and comparing the expression levels of stem cell marker genes WUS and CLV3 in peppermint stem cell suspensions and mature peppermint leaf cells. If the expression levels of WUS and CLV3 genes in the suspension cells of the peppermint stem cell suspension are higher than those in mature leaf tissue, then the suspension cells are stem cells.

[0015] Due to the adoption of the above technical solutions, the beneficial technical effects of the present invention are as follows: 1. Clear source, high activity and good stability: By directly selecting the apical meristem of mint stem as explant, the original stemness of cells is guaranteed from the source, avoiding the problems of weak cell vitality and unstable genetic traits caused by the dedifferentiation of differentiated tissues in traditional methods. The mint stem cells obtained have strong division ability and good genetic stability. 2. The method of this invention is highly efficient and reproducible: By using a specific hormone combination (2,4-dichlorophenoxyacetic acid and 6-benzylaminopurine) and concentration range optimized for peppermint, the induction efficiency and quality of embryogenic callus tissue are significantly improved, a stable and reproducible culture system is established, and the problem that existing technologies cannot be directly applied to peppermint is solved.

[0016] 3. It has the potential for industrial application, can be stably passaged and adapted to large-scale culture in bioreactors, laying the foundation for the industrial production of high-value-added secondary metabolites such as menthol using the cell factory model, and has the feasibility for industrial application. Detailed Implementation

[0017] To enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Based on the embodiments in this application, other similar embodiments obtained by those skilled in the art without creative effort should all fall within the scope of protection of this application.

[0018] A method for isolating and culturing peppermint stem cells includes the following steps: using the apical meristem of peppermint shoots as explants, inducing and culturing the apical meristem to generate embryogenic callus, and then culturing the embryogenic callus in suspension to obtain a peppermint stem cell suspension system. This method addresses the technical problems of unstable yield and quality of peppermint active ingredients due to reliance on traditional agricultural cultivation, and the lack of a specific, highly active stem cell culture system for peppermint. Through a series of carefully designed steps, this method achieves the goal of obtaining high-quality stem cells from the source.

[0019] The method begins with explant preparation and isolation. This step selects the terminal bud or young stem segment with axillary buds from mint plants as explants and isolates the apical meristem. The apical meristem is chosen as the starting material because the cells in this region are in an undifferentiated or weakly differentiated state, possessing strong proliferative potential and genetic stability. By directly utilizing these primitive stem cells, this method fundamentally avoids a series of problems associated with dedifferentiation of differentiated tissues (such as leaves and stem segments) in traditional techniques, such as decreased cell viability, long culture periods, and susceptibility to somatic clonal mutations. This lays the foundation for obtaining suitable stem cell lines in the subsequent process.

[0020] The shoot apical meristems isolated in the previous step were inoculated onto a solid induction medium supplemented with specific plant growth regulators and cultured in the dark to induce embryogenic callus formation. The aim of this step is to utilize exogenous hormones to induce a rapid, disordered proliferation state, while precisely controlling the type and ratio of hormones to guide cells to form embryogenic callus with embryogenetic potential, rather than simply forming undifferentiated callus. This protocol uses a combination of the potent auxin 2,4-dichlorophenoxyacetic acid and the cytokinin 6-benzylaminopurine to synergistically promote cell division and maintain its undifferentiated state, thereby efficiently obtaining high-quality cell material for establishing suspension systems.

[0021] Successfully induced embryogenic callus tissue was transferred to liquid subculture medium for suspension culture. The purpose of this step is to transfer cells from a solid surface to a liquid environment, allowing them to grow in a three-dimensional liquid environment, thereby achieving rapid and large-scale expansion of cell numbers. Continuous shaking or stirring in a shaker or bioreactor ensures that cells have sufficient contact with nutrients and gas exchange. Simultaneously, through regular subculture, rapidly growing, well-dispersed, and non-aggregating cell populations are continuously screened, ultimately establishing a stable and homogeneous peppermint stem cell suspension system.

[0022] The diameter of the shoot apical meristem was limited to 0.1–0.3 mm. This size range is a key parameter derived from extensive experimental optimization. Meristems smaller than 0.1 mm have low cell counts and low survival rates under in vitro culture conditions, making it difficult to initiate effective cell division and proliferation. Explants larger than 0.3 mm carry excessive differentiated or in-differentiation leaf primordia and lower tissues, which not only make it difficult to induce embryogenic callus but may also produce inhibitory substances affecting the growth of the core meristem, while increasing the risk of incomplete surface sterilization and endophytic contamination. Therefore, by precisely controlling the size within 0.1–0.3 mm, the survival rate of explants, induction success rate, and purity of obtained cells can be maximized, thereby significantly improving the efficiency and reproducibility of the entire method.

[0023] In the solid induction medium, the concentration of 2,4-dichlorophenoxyacetic acid (2,4-dichlorophenoxyacetic acid) is 1.0-3.0 mg / L, and the concentration of 6-benzylaminopurine (6-benzylaminopurine) is 0.1-0.5 mg / L. This hormone ratio is the core formulation optimized for the specific species of mint in this invention. 2,4-Dichlorophenoxyacetic acid, as a potent synthetic auxin, can effectively break the dormant state of cells, initiate the cell cycle, and induce rapid cell division. Meanwhile, 6-benzylaminopurine, as a cytokinin, works synergistically with auxin to promote cytoplasmic division and help maintain the undifferentiated state of cells. By controlling both within the aforementioned specific concentration range, an effective synergistic effect of auxin and cytokinin is achieved, thereby efficiently guiding the mint shoot tip meristem towards the formation of dense, granular embryogenic callus, rather than the formation of soft, water-soaked non-embryonic callus or direct differentiation into roots, shoots, or other organs.

[0024] The liquid subculture medium contains 0.5-2.0 mg / L of 2,4-dichlorophenoxyacetic acid and 0.05-0.2 mg / L of 6-benzylaminopurine. This formulation is specifically designed for the suspension culture stage. Compared to the solid induction stage, the hormone concentration in the liquid medium usually needs to be appropriately reduced. The principle is that cells grow dispersed in a liquid environment, and their absorption efficiency of hormones is higher. Excessively high hormone concentrations may have toxic effects on cells or cause abnormal differentiation. This concentration range aims to maintain vigorous cell proliferation while ensuring that cells retain their stem cell characteristics during rapid division, preventing unintended differentiation or senescence due to changes in the culture environment. By using this formulation, long-term, stable passage of peppermint stem cell suspension lines can be ensured.

[0025] This application also provides a peppermint stem cell line prepared by the above method, which possesses objectively measurable biological characteristics. The core of this stem cell line lies in the fact that the expression levels of the stem cell marker genes WUS and CLV3 in its cells are at least three times higher than those in mature leaf cells taken from the same peppermint plant. When detecting gene expression levels, the relative expression levels of WUS 405 and CLV3 406 in the stem cells were significantly higher than in mature leaves. This intrinsic molecular biological characteristic is one or more technical features that distinguish this cell line from natural peppermint tissue cells and cultured cells that can be obtained by other methods, indicating that it possesses stem cell characteristics.

[0026] The expression levels of the WUS and CLV3 genes in the stem cell line were at least 5 times higher than those in mature mint leaf cells. This higher expression threshold represents a cell population with greater "steminess" or activity obtained through the preferred embodiment of this invention. Generally, higher marker gene expression levels are associated with stronger cell proliferation capacity, better genetic stability, and higher potential for secondary metabolite synthesis. Therefore, this characteristic defines the superior product of this invention, which is likely to exhibit better performance in subsequent industrial applications.

[0027] Furthermore, this application also provides a molecular identification method for peppermint stem cells. By detecting and comparing the expression levels of stem cell marker genes WUS and CLV3 in cells from the established suspension system with those in mature peppermint leaf cells (used as a control), the "stemness" of the obtained cells is objectively confirmed. Mature leaf cells are highly differentiated somatic cells, and the expression levels of their stem cell marker genes are extremely low or undetectable. If the expression levels of WUS and CLV3 genes in cells cultured using this method are significantly higher than those in mature leaf cells, it proves from a molecular biological perspective that these cells do indeed possess stem cell characteristics. This identification method based on the expression levels of core functional genes is more scientific, precise, and reliable than relying solely on morphological observation, providing a reliable basis for quality control and subsequent applications of the established cell lines.

[0028] Molecular identification was performed using real-time quantitative PCR (qPCR), employing primer pairs SEQ ID NO: 3 and SEQ ID NO: 4 for amplifying the WUS gene and primer pairs SEQ ID NO: 5 and SEQ ID NO: 6 for amplifying the CLV3 gene. This specification provides an objective, precise, and reproducible technical means for the identification process. qPCR itself ensures the quantification and high sensitivity of the detection results. The use of these specific primer sequences defined by SEQ ID NO: 3-6 ensures that the PCR reaction can accurately and efficiently amplify the WUS and CLV3 gene fragments in mint, without mistakenly amplifying other highly homologous but functionally unrelated genes. This primer set was designed and validated specifically for the mint genome sequence, and its use binds the identification results to a well-defined molecular tool, enhancing the scientific rigor and legal stability of the identification conclusions.

[0029] Peppermint stem cell lines can be used to produce peppermint secondary metabolites. Using the peppermint stem cell lines obtained by this invention, large-scale cultivation in a controlled bioreactor environment overcomes the limitations of traditional agricultural planting, enabling stable, efficient, and continuous production of key active ingredients in peppermint, unaffected by seasonality. This provides a novel and sustainable source of raw materials for the pharmaceutical, food, and daily chemical industries. Peppermint secondary metabolites may specifically include menthol and / or menthone. Menthol and menthone are the most important and commercially valuable active ingredients in peppermint essential oil, giving peppermint its unique cooling sensation and aroma, and are core functional components in many products. This specification clearly defines the main production objectives of this stem cell factory, making its application value more focused and prominent.

[0030] Example 1 This embodiment relates to a method for isolating, culturing, and identifying peppermint stem cells. The specific steps are as follows: (1) Material preparation: Take healthy peppermint tissue culture seedlings that have grown for 4 weeks from the artificial climate chamber and cut the tender shoots at the top with 2-3 pairs of unopened leaves.

[0031] (2) Sterilization of explants: Rinse tender shoots with tap water for 10 min. In a clean bench, soak in 75% ethanol for 10 min, then rinse once with sterile water; transfer to a sodium hypochlorite solution with an effective chlorine content of 5% and soak for 12 minutes, gently shaking during the process; finally, rinse thoroughly with sterile water 5 times and blot dry with filter paper.

[0032] (3) Stem tip separation: In a clean bench, using forceps and a scalpel under a stereomicroscope, peel off the outer leaves to expose and cut off the stem tip dome with a diameter of about 0.2 mm. The operation time should be controlled within 2 minutes.

[0033] (4) Solid induction: Peppermint shoot tip domes were inoculated into petri dishes containing 25 mL of solid induction medium (MS + 2.0 mg / L 2,4-D + 0.2 mg / L 6-BA + 25 g / L sucrose + 7 g / L agar, pH 5.7). Five shoot tips were inoculated into each dish. After sealing, the dishes were placed in a completely dark incubator at 24℃ for static incubation.

[0034] (5) Observation and subculture: After 10 days of culture, some stem tips began to swell. After 25 days of culture, about 70% of the stem tips produced typical pale yellow, granular embryogenic callus. Select well-grown embryogenic callus blocks (about 3 mm in diameter) for the next step.

[0035] (6) Establishment of the suspension system: The callus tissue blocks were transferred into Erlenmeyer flasks containing 50 mL of liquid amplification medium (B5 + 1.0 mg / L 2,4-D + 0.1 mg / L 6-BA + 30 g / L sucrose, pH 5.7). The flasks were placed in a shaker at 24℃ and 110 rpm under low light conditions (15 μmol·m⁻²·s⁻¹, 12h light / 12h dark). The initial culture was relatively dense, and subcultured every 2 weeks. By the 4th generation, a stable suspension system consisting of numerous small (50-150 μm), pale yellow cell clusters was obtained.

[0036] (7) Molecular identification: Suspension cells from the 5th generation and 8 days after subculture were collected by vacuum filtration. Mature leaves from the mother plant were also collected. RNA extraction and cDNA synthesis were performed using a plant RNA extraction kit. The RNA concentration and A260 / A280 ratio were found to be acceptable. 1 μg of RNA was used for reverse transcription, followed by SYBR Green Premix Ex Taq II reagent on a QuantStudio 5 system. The reaction volume was 20 μL, and the program was: 95℃ for 30 s; 40 cycles of (95℃ for 5 s, 60℃ for 30 s). The expression of WUS and CLV3 genes in different cell types was detected using quantitative real-time PCR, with EF-1α as an internal control.

[0037] The EF1a primers are: EF1a-F: TCAGGAGGCTCTTCCTGGTGA; EF1a-R: AGCTCCCTTGGCAGGGTCAT; The WUS primers are WUS-F: ACATCAACGGTGGTAGTGGT; WUS-R: AGAGCTTTAATCCCGAGCGA; CLV3 primers are CLV3-F: TGGAGAAGCAGAGAAGGCAA; CLV3-R: TGGTGGGTTCACATGATGGT; The expression levels of the WUS gene and CLV3 gene in the suspension cells were calculated using the 2−ΔΔCt method. The expression levels of WUS and CLV3 genes in the suspension cells were 5.23 times that of the leaf control, and 3.85 times that of the leaf control. Student's t-test showed that both differences were highly significant (p<0.001). This indicates the successful induction and establishment of a peppermint embryogenic stem cell line with high stemness characteristics.

[0038] Example 2 This embodiment relates to a method for isolating, culturing, and identifying peppermint stem cells. The specific steps are as follows: (1) Material preparation: Take healthy peppermint tissue culture seedlings that have grown for 4 weeks from the artificial climate chamber and cut the tender shoots at the top with 2-3 pairs of unopened leaves.

[0039] (2) Sterilization of explants: Rinse tender shoots with tap water for 10 min. In a clean bench, soak in 75% ethanol for 10 min, then rinse once with sterile water; transfer to a sodium hypochlorite solution with an effective chlorine content of 5% and soak for 12 minutes, gently shaking during the process; finally, rinse thoroughly with sterile water 5 times and blot dry with filter paper.

[0040] (3) Stem tip separation: In a clean bench, using forceps and a scalpel under a stereomicroscope, peel off the outer leaves to expose and cut off the stem tip dome with a diameter of about 0.2 mm. The operation time should be controlled within 2 minutes.

[0041] (4) Solid induction: Peppermint shoot tip domes were inoculated into petri dishes containing 25 mL of solid induction medium (MS + 1.5 mg / L 2,4-D + 0.3 mg / L 6-BA + 25 g / L sucrose + 7 g / L agar, pH 5.7). Five shoot tips were inoculated into each dish. After sealing, the dishes were placed in a completely dark incubator at 24℃ for static incubation.

[0042] (5) Observation and subculture: After 10 days of culture, some stem tips began to swell. After 25 days of culture, about 70% of the stem tips developed typical pale yellow, granular embryogenic callus. After 28 days of culture, the induction rate of embryogenic callus was about 65%, and the callus morphology was similar to that of Example 1, but the color was slightly lighter. Well-grown embryogenic callus blocks (about 3 mm in diameter) were selected for the next step.

[0043] (6) Establishment of the suspension system: The callus tissue blocks were transferred into Erlenmeyer flasks containing 50 mL of liquid amplification medium (B5 + 1.0 mg / L 2,4-D + 0.1 mg / L 6-BA + 30 g / L sucrose, pH 5.7). The flasks were placed in a shaker at 24℃ and 110 rpm under low light conditions (15 μmol·m⁻²·s⁻¹, 12h light / 12h dark). The initial culture was relatively dense, and subcultured every 2 weeks. By the 4th generation, a stable suspension system consisting of numerous small (50-150 μm), pale yellow cell clusters was obtained.

[0044] (7) Molecular identification: Suspension cells from the 5th generation and 8 days after subculture were collected by vacuum filtration. Mature leaves from the mother plant were also collected. RNA extraction and cDNA synthesis were performed using a plant RNA extraction kit. The RNA concentration and A260 / A280 ratio were found to be acceptable. 1 μg of RNA was used for reverse transcription, followed by SYBR Green Premix Ex Taq II reagent on a QuantStudio 5 system. The reaction volume was 20 μL, and the program was: 95℃ for 30 s; 40 cycles of (95℃ for 5 s, 60℃ for 30 s). The expression of WUS and CLV3 genes in different cell types was detected using quantitative real-time PCR, with EF-1α as an internal control.

[0045] The EF1a primers are: EF1a-F: TCAGGAGGCTCTTCCTGGTGA; EF1a-R: AGCTCCCTTGGCAGGGTCAT; The WUS primers are WUS-F: ACATCAACGGTGGTAGTGGT; WUS-R: AGAGCTTTAATCCCGAGCGA; CLV3 primers are CLV3-F: TGGAGAAGCAGAGAAGGCAA; CLV3-R: TGGTGGGTTCACATGATGGT; The expression levels of WUS and CLV3 in the suspended cells were calculated using the 2−ΔΔCt method. These levels were 4.78 and 3.52 times higher than those in the leaf tissue, respectively (p<0.001), demonstrating that this hormone ratio can effectively induce and maintain embryonic stem cell characteristics, indicating that the hormone concentration range provided by this invention has a certain degree of tolerance.

[0046] Example 3: This example demonstrates the process of scaling up a laboratory-scale suspension system to a bioreactor.

[0047] (1) Material preparation: Take healthy peppermint tissue culture seedlings that have grown for 4 weeks from the artificial climate chamber and cut the tender shoots at the top with 2-3 pairs of unopened leaves.

[0048] (2) Sterilization of explants: Rinse tender shoots with tap water for 10 min. In a clean bench, soak in 75% ethanol for 10 min, then rinse once with sterile water; transfer to a sodium hypochlorite solution with an effective chlorine content of 5% and soak for 12 minutes, gently shaking during the process; finally, rinse thoroughly with sterile water 5 times and blot dry with filter paper.

[0049] (3) Stem tip separation: In a clean bench, using forceps and a scalpel under a stereomicroscope, peel off the outer leaves to expose and cut off the stem tip dome with a diameter of about 0.2 mm. The operation time should be controlled within 2 minutes.

[0050] (4) Solid induction: Peppermint shoot tip domes were inoculated into petri dishes containing 25 mL of solid induction medium (MS + 2.2 mg / L 2,4-D + 0.25 mg / L 6-BA + 30 g / L sucrose + 7 g / L agar, pH 5.7). Five shoot tips were inoculated into each dish. After sealing, the dishes were placed in a completely dark incubator at 24℃ for static culture. Among 30 shoot tips, 23 successfully induced embryogenic callus, with an induction rate of 76.7%.

[0051] (5) Shake-flask amplification: The induced callus tissue was placed in a 250 mL shake flask (containing 50 mL B5 + 1.2 mg / L 2,4-D + 0.15 mg / L 6-BA medium) to establish a suspension system, and was continuously subcultured to the 5th generation, and the cells grew stably.

[0052] (6) Bioreactor culture: A 2L stirred glass bioreactor was used, equipped with a pH electrode, dissolved oxygen (DO) electrode, temperature probe, and a four-bladed flat-blade turbine agitator. The reactor and culture medium were sterilized in place (121℃, 20 minutes). Cells in the logarithmic growth phase in the shake flasks were inoculated at a rate of 7% (v / v) into the bioreactor containing 1.5 L of the same liquid amplification medium (B5 + 1.2 mg / L 2,4-D + 0.15 mg / L 6-BA + 30 g / L sucrose, pH 5.8). The temperature was set at 23±1℃. The stirring speed was initially set at 80 rpm and gradually adjusted to 120 rpm according to cell growth and aggregation to maintain uniform cell suspension and moderate shear stress. The dissolved oxygen (DO) level was maintained above 30% saturation by adjusting the aeration rate (air, 0.2-0.8 vvm). The pH was maintained at 5.8 ± 0.1 by automatic addition of 0.5 M NaOH or 0.5 M HCl. Cells were cultured in complete darkness. Cell dry weight (DCW) was measured every 24 hours. By day 12, the cell dry weight had reached approximately five times its initial weight, indicating the early stationary phase.

[0053] (7) Identification: Cells cultured in the reactor for 8 days were identified by qRT-PCR. The results showed that the expression levels of WUS and CLV3 were 6.12 times and 4.31 times higher than those in leaf tissue, respectively (p<0.001), and the cell morphology was well maintained in the reactor, confirming that large-scale culture did not significantly change the embryonic stem cell characteristics of the cells.

[0054] Comparative Example 1: (1) Material preparation: Take healthy peppermint tissue culture seedlings that have grown for 4 weeks from the artificial climate chamber, cut tender, fully unfolded leaves from the peppermint tissue culture seedlings, and cut them into small pieces of about 5 mm × 5 mm using a hole punch.

[0055] (2) Sterilization of explants: Rinse tender shoots with tap water for 10 min. In a clean bench, soak in 75% ethanol for 10 min, then rinse once with sterile water; transfer to a sodium hypochlorite solution with an effective chlorine content of 5% and soak for 12 minutes, gently shaking during the process; finally, rinse thoroughly with sterile water 5 times and blot dry with filter paper.

[0056] (3) Stem tip separation: In a clean bench, using forceps and a scalpel under a stereomicroscope, peel off the outer leaves to expose and cut off the stem tip dome with a diameter of about 0.2 mm. The operation time should be controlled within 2 minutes.

[0057] (4) Solid induction: Peppermint shoot tip domes were inoculated into petri dishes containing 25 mL of solid induction medium (MS + 2.0 mg / L 2,4-D + 0.2 mg / L 6-BA + 25 g / L sucrose + 7 g / L agar, pH 5.7). Five shoot tips were inoculated into each dish. After sealing, the dishes were placed in a completely dark incubator at 24℃ for static incubation.

[0058] (5) Observation and subculture: After 15 days of culture, the edges of the leaf masses began to swell, forming loose, water-soaked, or slightly greenish callus tissue, which was significantly different from the granular and dense structure of Example 1. This non-embryonic callus tissue was transferred to liquid amplification medium in an attempt to establish a suspension system. It was found that the cell clusters were large (>500 μm), easily sank to the bottom, grew slowly, and were difficult to subculture. qRT-PCR analysis of the culture showed no significant increase in the expression levels of WUS and CLV3 genes compared to the leaf control (p>0.05). This strongly demonstrates that shoot apical meristem is an irreplaceable and optimal explant source for inducing embryonic stem cells with high stemness characteristics.

[0059] Comparative Example 2: This embodiment relates to a method for isolating, culturing, and identifying peppermint stem cells. The specific steps are as follows: (1) Material preparation: Take healthy peppermint tissue culture seedlings that have grown for 4 weeks from the artificial climate chamber and cut the tender shoots at the top with 2-3 pairs of unopened leaves.

[0060] (2) Sterilization of explants: Rinse tender shoots with tap water for 10 min. In a clean bench, soak in 75% ethanol for 10 min, then rinse once with sterile water; transfer to a sodium hypochlorite solution with an effective chlorine content of 5% and soak for 12 minutes, gently shaking during the process; finally, rinse thoroughly with sterile water 5 times and blot dry with filter paper.

[0061] (3) Stem tip separation: In a clean bench, using forceps and a scalpel under a stereomicroscope, peel off the outer leaves to expose and cut off the stem tip dome with a diameter of about 0.2 mm. The operation time should be controlled within 2 minutes.

[0062] (4) Solid induction: Peppermint shoot tip domes were inoculated into petri dishes containing 25 mL of solid induction medium (MS + 0 mg / L 2,4-D + 0.2 mg / L 6-BA + 25 g / L sucrose + 7 g / L agar, pH 5.7). Five shoot tips were inoculated into each dish. After sealing, the dishes were placed in a completely dark incubator at 24℃ for static incubation.

[0063] (5) Observation and subculture: After 30 days of culture, the vast majority of shoot tip meristems (>90%) showed no significant changes, with only a few slightly enlarged but without proliferation, failing to form effective callus. Therefore, subsequent suspension culture and molecular identification could not be performed. This indicates that in the absence of suitable auxin (especially 2,4-D), cytokinin (6-BA) alone cannot initiate the dedifferentiation of peppermint shoot tip meristems and the formation of embryogenic callus.

[0064] Comparative Example 3: This embodiment relates to a method for isolating, culturing, and identifying peppermint stem cells. The specific steps are as follows: (1) Material preparation: Take healthy peppermint tissue culture seedlings that have grown for 4 weeks from the artificial climate chamber and cut the tender shoots at the top with 2-3 pairs of unopened leaves.

[0065] (2) Sterilization of explants: Rinse tender shoots with tap water for 10 min. In a clean bench, soak in 75% ethanol for 10 min, then rinse once with sterile water; transfer to a sodium hypochlorite solution with an effective chlorine content of 5% and soak for 12 minutes, gently shaking during the process; finally, rinse thoroughly with sterile water 5 times and blot dry with filter paper.

[0066] (3) Stem tip separation: In a clean bench, using forceps and a scalpel under a stereomicroscope, peel off the outer leaves to expose and cut off the stem tip dome with a diameter of about 0.2 mm. The operation time should be controlled within 2 minutes.

[0067] (4) Solid induction: Peppermint shoot tip domes were inoculated into petri dishes containing 25 mL of solid induction medium (MS + 2.0 mg / L NAA + 0.2 mg / L 6-BA + 25 g / L sucrose + 7 g / L agar, pH 5.7). Five shoot tips were inoculated into each dish. After sealing, the dishes were placed in a completely dark incubator at 24℃ for static incubation.

[0068] (5) Observation and subculture: After 25-30 days of culture, callus tissue can be formed around the shoot tip, but its morphology is mostly soft, translucent or non-embryonic structure that is easily oxidized and browned. After being transferred to liquid culture medium, the cells have poor dispersibility and it is difficult to form a uniform suspension system, resulting in poor growth.

[0069] (6) Molecular identification: qRT-PCR analysis of the obtained cultures showed that while the expression level of the WUS gene was slightly upregulated (1.86-fold, p<0.05), the expression level of the CLV3 gene did not change significantly (1.45-fold, p>0.05), and the upregulation of both genes was much lower than that in Example 1. This indicates that although NAA can induce cell proliferation, the cells induced by it are significantly weaker in stem cell characteristics than those induced by 2,4-D. 2,4-D has a unique advantage in obtaining high-quality embryonic stem cells.

[0070] As can be seen from the above examples and comparative examples, only by using shoot apical meristem as explants can embryogenic callus with typical traits and high expression of stem cell marker genes be efficiently induced. During the induction phase, the presence of 2,4-D is essential and highly effective, exhibiting superior induction effects compared to other common auxins such as NAA. qRT-PCR detection of the expression levels of WUS and CLV3 genes can effectively and quantitatively identify the embryogenic stem cell attributes of the cells, providing objective and reliable results. The embryogenic stem cell suspension line established by this method exhibits good growth characteristics and genetic stability, and can be adapted for large-scale culture from shake flasks to bioreactors. This invention provides a complete, efficient, reliable, and scalable method for inducing and culturing peppermint embryogenic stem cells, filling a technological gap in this field and possessing significant scientific value and industrial application potential.

[0071] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A method for isolating and culturing peppermint stem cells, characterized in that, Includes the following steps: Using the apical meristem of mint as explants, the apical meristem was induced and cultured to produce embryogenic callus, and the embryogenic callus was then cultured in suspension to obtain a mint stem cell suspension line.

2. The method for isolating and culturing peppermint stem cells according to claim 1, characterized in that, The diameter of the apical meristem is 0.1-0.3 mm.

3. The method for isolating and culturing peppermint stem cells according to claim 1, characterized in that, The apical meristem of the shoot tip is surface sterilized before induction culture.

4. The method for isolating and culturing peppermint stem cells according to claim 3, characterized in that, The surface sterilization treatment includes: first soaking in 75% ethanol for 5-10 minutes, and then soaking in sodium hypochlorite solution with an effective chlorine content of 2-5% for 8-15 minutes.

5. The method for isolating and culturing peppermint stem cells according to claim 1, characterized in that, The shoot tip meristem was inoculated onto a solid induction medium and cultured in the dark. The solid induction medium was based on B5 or MS medium, supplemented with 2,4-dichlorophenoxyacetic acid (1.0-3.0 mg / L), 6-benzylaminopurine (0.1-0.5 mg / L), 20-30 g / L sucrose, and 6-8 g / L agar powder. The pH of the medium used for induction culture was 5.6-5.

8.

6. The method for isolating and culturing peppermint stem cells according to claim 5, characterized in that, The conditions for dark culture are: temperature 23±2℃, culture time 20-30 days.

7. The method for isolating and culturing peppermint stem cells according to claim 1, characterized in that, The suspension culture medium was a liquid subculture medium based on B5 medium, with the addition of 0.5-2.0 mg / L 2,4-dichlorophenoxyacetic acid, 0.05-0.2 mg / L 6-benzylaminopurine, and 30 g / L sucrose, and the pH was adjusted to 5.6-5.

8.

8. The method for isolating and culturing peppermint stem cells according to claim 1, characterized in that, The conditions for suspension culture are: temperature 23±2℃, rotation speed 100-120 rpm, in darkness or low light conditions, subculture every 10-14 days, for a total of 3-5 subcultures.

9. A method for isolating and culturing peppermint stem cells according to any one of claims 1-8.

10. A method for identifying peppermint stem cells as described in claim 9, characterized in that, The expression levels of stem cell marker genes WUS and CLV3 were detected and compared between peppermint stem cell suspension and mature peppermint leaf cells. The expression levels of WUS and CLV3 genes in the suspension cells of peppermint stem cell suspension were higher than those in mature leaf tissue, indicating that the suspension cells were stem cells.