Mutant of OsABA8ox1 gene promoter and application of mutant in improvement of plant alkali stress resistance
By using CRISPR/Cas9 technology to perform site-specific editing of the OsABA8ox1 gene promoter, its expression level was reduced, and the endogenous ABA content in rice was increased. This solved the problem of growth restriction in rice under saline-alkali stress and significantly improved the rice's resistance to alkali stress.
Patent Information
- Application Number
- CN202610447730.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-07
- Publication Date
- 2026-05-08
AI Technical Summary
The lack of effective OsABA8ox1 promoter resources in existing technologies makes it difficult to improve the salt tolerance of rice through targeted methods, resulting in limited growth of rice under salt stress.
The OsABA8ox1 gene promoter was edited at specific sites using CRISPR/Cas9 technology to reduce its expression level, increase the endogenous ABA content in rice, and enhance resistance to alkali stress.
It significantly improves the resistance of rice to alkali stress, with a survival rate as high as 66.67% after 12 days of recovery, providing important application value for the breeding of salt-tolerant rice varieties.
Smart Images

Figure CN121991958A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding technology, and in particular to a mutant of the OsABA8ox1 gene promoter and its application in improving plant resistance to alkali stress. Background Technology
[0002] In recent years, global soil salinization has continued to worsen, with the area of salinized land showing a year-on-year upward trend. Developing and utilizing severely saline-alkali land for rice production, and further increasing rice yields in moderately and mildly saline-alkali land, has become an important task for comprehensive management of saline-alkali land and improvement of grain production capacity. Using technologies such as molecular marker-assisted breeding to introduce key salt-alkali tolerance genes or functional sites into main varieties to directionally improve their alkali stress resistance is an efficient technical approach to solving these problems. However, currently, practical gene resources available for the targeted improvement of alkali tolerance in regional rice varieties remain extremely scarce, making it difficult to meet the production demand for the breeding of new salt-alkali tolerant rice varieties.
[0003] Abscisic acid (ABA) is an important plant hormone that helps plants cope with abiotic stresses such as salinity and drought, and plays a key regulatory role in rice's tolerance to sodium hydroxide stress. Under salinity stress, especially sodium hydroxide stress, ABA can induce stomatal closure, reduce water loss, activate the antioxidant system to scavenge reactive oxygen species, and simultaneously regulate the expression of ion transport proteins and maintain intracellular Na+. + / K + Improving ion balance enhances the plant's tolerance to high-salt, high-pH stress, significantly increasing the survival rate and growth vigor of rice under saline-alkali conditions. The OsABA8ox1 gene encodes rice ABA8'-hydroxylase, a key negative regulator of endogenous ABA levels. This gene primarily reduces the ABA content in the plant by catalyzing the oxidative degradation of active ABA, thereby participating in the regulation of ABA-dependent stress signaling pathways. Under saline-alkali stress, the expression of OsABA8ox1 is significantly induced and upregulated, with higher expression levels indicating higher stress intensity. High expression of this gene accelerates ABA decomposition, leading to insufficient endogenous ABA accumulation in the plant, which weakens the ABA-mediated stress resistance signaling pathway, resulting in increased plasma membrane damage, excessive accumulation of reactive oxygen species, and sodium deficiency in rice. + / K + Problems such as imbalance significantly reduce alkali tolerance. Therefore, the expression level of OsABA8ox1 directly affects the endogenous ABA homeostasis in rice and is a crucial regulatory node determining the rice's tolerance to sodium alkali.
[0004] Multiple studies have shown that site-directed mutations in key gene coding regions often lead to various negative phenotypes. However, by editing promoters without altering the coding region, precise regulation of gene expression can effectively avoid problems such as protein structural abnormalities, functional inactivation, or unexpected translational disorders caused by coding region mutations. This approach achieves precise and mild upregulation or downregulation of gene expression levels while preserving the gene's natural coding function and normal protein expression, significantly reducing off-target negative effects and genetic background interference from gene editing. Furthermore, this regulatory method leverages the cis-acting element characteristics of promoters to achieve spatiotemporally specific gene expression regulation, allowing changes in gene expression levels to precisely match the needs of crop growth, development, and stress responses. This provides a safer, more efficient, and precise molecular breeding technology pathway for the targeted improvement of agronomic traits such as crop stress resistance and quality, and is currently the preferred strategy for achieving precise gene function regulation in plant molecular breeding.
[0005] Existing studies have confirmed that inhibiting OsABA8ox1 expression through RNAi can increase endogenous ABA content, thereby enhancing rice's salt and alkali tolerance. However, related studies have focused on the functional inhibition of the coding region of this gene, and have not yet found the effect of functional mutations in its promoter region on expression regulation and rice's alkali tolerance. Currently, the resources of OsABA8ox1 promoter functional sites that can be used to directionally improve rice's soda alkali tolerance are still extremely scarce, making it difficult to meet the actual needs of molecular breeding of rice in saline-alkali land. Summary of the Invention
[0006] To address the aforementioned problems, this invention provides a mutant of the OsABA8ox1 gene promoter and its application in improving plant resistance to alkali stress. This invention screened the OsABA8ox1 gene promoter region, which is closely related to the endogenous ABA content in rice. Using CRISPR / Cas9 technology, this promoter region was site-specifically edited to obtain a mutant that reduces the expression level of the OsABA8ox1 gene. Based on this mutation, the endogenous ABA content in rice can be increased, significantly improving the rice's resistance to alkali stress (compared to the wild type). pOSABA8OX1-PE6 The survival rate of the material after 12 days of recovery was as high as 66.67%, which can be used to improve rice germplasm resources and has important application value in the breeding of stress-resistant rice varieties.
[0007] To address the problems existing in the prior art, in a first aspect, the present invention provides a mutant of the OsABA8ox1 gene promoter, characterized in that, compared with the wild-type rice OsABA8ox1 gene promoter, the mutant has a 9bp deletion from 144bp to 135bp upstream of the start codon, a T-to-G mutation at 145bp, and a T deletion at 157bp; this mutant can specifically reduce the expression level of the OsABA8ox1 gene, increase the endogenous ABA content in rice, and significantly improve the rice's resistance to alkali stress. The nucleotide sequence of the above mutant is shown in SEQ ID NO.27.
[0008] Furthermore, the promoter of the wild-type rice OsABA8ox1 gene includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.1; ii) Nucleotide sequences with the same promoter function obtained by inserting, deleting, or replacing one or more nucleotides as shown in i).
[0009] Secondly, the present invention provides an sgRNA comprising any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.11 (GGTGGCAGCTATTTATAGAT); ii) Nucleotide sequences with the same targeting function obtained by inserting, deleting, or replacing one or more nucleotides as shown in i).
[0010] Thirdly, the present invention provides a biological material, including the aforementioned mutant or the aforementioned sgRNA; the biological material is an expression cassette, vector, transgenic cell or recombinant viral particle.
[0011] The expression cassette of this invention includes: a promoter (corresponding to the aforementioned mutant), a coding sequence, and a termination signal for terminating the transcription process (e.g., including a terminator and a polyadenylation signal). It can also guide the cell to add a poly(A) tail to the end of the mRNA to increase mRNA stability and translation efficiency. Common examples include SV40 polyA and BGH polyA. Furthermore, various elements can be added to the expression cassette, such as enhancers, introns, Kozak sequences, Shine-Dalgarno sequences, or selection marker genes. The vectors of this invention include: plasmid vectors (extrachromosomal circular DNA molecules derived from bacteria or yeast), viral vectors (modified viruses that have lost their pathogenicity and self-replication ability but retain their ability to efficiently infect cells and deliver genetic material into cells), phage vectors, or artificial chromosome vectors (e.g., bacterial artificial chromosome BAC or yeast artificial chromosome YAC). The transgenic cells of this invention are cells whose genetic material has undergone artificially stable alterations, such as the introduction of the aforementioned mutants provided in this application. The transgenic cells described in this invention include animal cells, plant cells, or microbial cells, wherein the animal and plant cells do not possess the potential to develop into a complete individual (and do not belong to any animal or plant species). The recombinant viral particles described in this invention are virus-like particles, with genetic material encapsulated by a protein coat (viral capsid). For example, recombinant viral particles are prepared by transfecting the aforementioned viral vector and other helper plasmids into a packaging cell line (e.g., HEK293T cells), which will then complete the expression and assembly of viral proteins and recombinant genes to obtain complete recombinant viral particles. Those skilled in the art, possessing the mutants disclosed in this application, are fully aware of the preparation methods of the aforementioned expression cassettes, vectors, transgenic cells, and recombinant viral particles based on existing technology. There are no technical obstacles involved; therefore, expression cassettes, vectors, transgenic cells, and recombinant viral particles containing the aforementioned gene mutants are also within the scope of this invention.
[0012] Fourthly, the present invention provides the use of the aforementioned mutant, or the OsABA8ox1 gene promoter editing reagent, in reducing the expression level of the OsABA8ox1 gene, or in preparing a kit for reducing the expression level of the OsABA8ox1 gene. The editing reagent is used to edit the OsABA8ox1 gene promoter, causing it to mutate into the aforementioned mutant.
[0013] Fifthly, the present invention provides the use of the aforementioned mutant, or the OSABA8OX1 gene promoter editing reagent, in any of the following: i) Increase the endogenous abscisic acid (ABA) content in plants, or prepare a kit for increasing the endogenous ABA content in plants; ii) Improve the alkali stress resistance of plants, or prepare a kit for improving the alkali stress resistance of plants; iii) Cultivate transgenic plants with high endogenous ABA content and high resistance to alkali stress; iv) Targeted improvement of plant varieties related to alkali stress resistance; v) Innovation and improvement of alkali-tolerant plant germplasm resources.
[0014] The plants mentioned above are preferably plants of the genus Oryza, and more preferably rice.
[0015] Further, the editing reagent includes one or more of the following: a CRISPR-Cas9 system, a TALENs system, or a ZFNs system; preferably, the editing reagent is a CRISPR-Cas9 system. Further, the CRISPR-Cas9 system includes sgRNA as described above.
[0016] In a sixth aspect, the present invention provides a method for reducing the expression level of the OsABA8ox1 gene, comprising: mutating the promoter of the OsABA8ox1 gene to obtain the aforementioned mutant.
[0017] In a seventh aspect, the present invention provides a method for preparing transgenic rice plants, or increasing the endogenous ABA content of rice plants, or improving the alkali stress resistance of rice plants, comprising: mutating the promoter of the OsABA8ox1 gene in the rice plant to obtain the aforementioned mutant.
[0018] The present invention has the following beneficial effects: 1. This invention screened the promoter region of the OsABA8OX1 gene, which is closely related to the endogenous ABA content in rice. By using CRISPR / Cas9 technology to perform site-specific editing on this promoter region, a mutant that can reduce the expression level of the OsABA8ox1 gene was obtained. Based on this mutation method, the endogenous ABA content in rice can be increased.
[0019] 2. The OsABA8ox1 gene promoter regulation strategy provided by this invention can be widely applied to the breeding of salt-tolerant rice varieties, and can significantly improve the resistance of rice to alkali stress (compared to wild type). pOSABA8OX1-PE6 The survival rate of the material after 12 days of recovery was as high as 66.67%, which can be used to improve rice germplasm resources and has important application value in the breeding of stress-resistant rice varieties. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0021] Figure 1 This refers to the OsABA8ox1 promoter structure, CRISPR / Cas9 target information, and OsABA8ox1 promoter editing information provided in Embodiment 1 of the present invention; the orange area in the figure represents the promoter position where the target is located; the red box area in the figure is the area deleted for each mutant, and the right side shows the mutation mode; Figure 2 It is the OsABA8ox1 promoter editing material of Embodiment 4 of the present invention ( pOsABA8ox1-PE1, pOsABA8ox1-PE2 , pOsABA8ox1-PE3 , pOsABA8ox1-PE4 , pOsABA8ox1-PE5 , pOsABA8ox1-PE6 Phenotypic and bar charts of different strains under alkaline stress (0d, 6d and 12d). The bar charts show the survival rate of each strain, and the error bars represent the standard deviation (SD). "**" in the figure indicates significant difference, P≤0.01, the same below. Figure 3 It is the OsABA8ox1 promoter editing material of Embodiment 5 of the present invention ( pOsABA8ox1-PE1, pOsABA8ox1-PE2 , pOsABA8ox1-PE3 , pOsABA8ox1-PE4 , pOsABA8ox1-PE5 , pOsABA8ox1-PE6 The expression levels of the OsABA8ox1 gene in different strains before (0 h) and after (48 h) alkali stress treatment; Figure 4 It is the OsABA8ox1 promoter editing material of Embodiment 6 of the present invention ( pOsABA8ox1-PE1, pOsABA8ox1-PE2 , pOsABA8ox1-PE3 , pOsABA8ox1-PE4 , pOsABA8ox1-PE5 , pOsABA8ox1-PE6 The endogenous ABA content of different mutant strains was measured before (0 h) and after (48 h) alkali stress treatment. Detailed Implementation
[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art; for example, refer to experimental manuals in the art or follow the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the experimental materials and reagents involved in the following embodiments are commercially available.
[0023] Example 1: Construction of OsABA8ox1 gene editing vector 1. sgRNA target design and primer synthesis: CRISPR / Cas9 editing targets were designed in the upstream promoter region (-2500 bp to the ATG start codon, see SEQ ID NO.1) of the rice OsABA8ox1 gene. Based on the predicted cis-acting elements on the promoter, four deletion regions and two editing targets were designed on the promoter. Two sgRNAs were designed at the 5' and 3' ends of the four deletion regions (Table 1), and one sgRNA was set at the editing target (Table 1). The following primers were synthesized (Table 2): Table 1: sgRNAs with 4 deletion regions (target regions 1-4) and 2 editing targets (target sites 5-6)
[0024] Table 2: Primers for 4 deletion regions (target regions 1-4) and 2 editing targets (targets 5-6)
[0025] 2. Constructing plasmids Following the methods described in the paper (Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(7):12.DOI:CNKI:SUN:JCXK.0.2018-07-008.), vectors targeting regions 1-4, 5, and 6 were constructed. The basic vectors were pYLgRNA-OsU6a, pYLgRNA-OsU3, and pYLCRISPR / Cas9Pubi-H; the constructed vectors were named Cas9Pubi-H-PE1, Cas9Pubi-H-PE2, Cas9Pubi-H-PE3, Cas9Pubi-H-PE4, Cas9Pubi-H-PE5, and Cas9Pubi-H-PE6.
[0026] Example 2: Agrobacterium-mediated transformation of OsABA8ox1 editing vector 1. Thawing of competent cells Remove EHA105 Agrobacterium competent cells from the -80°C freezer and immediately place them on ice to thaw slowly.
[0027] 2. Plasmid transformation Add 0.5-1 µg of the target plasmid (the plasmid prepared in Example 1) to 100 µL of thawed competent cells, mix gently, and incubate on ice for 30 minutes.
[0028] 3. Freeze-heat shock treatment The mixture was quickly transferred to liquid nitrogen and frozen for 5 minutes, and then immediately transferred to a 37°C water bath for heat shock for 5 minutes.
[0029] 4. Bacterial resuscitation After heat shock, the centrifuge tubes were quickly transferred to ice to cool for 2 minutes, then 800 µL of antibiotic-free YEB liquid medium was added. The tubes were then placed in a full-temperature shaker (MKN) and shaken at 28°C and 120 rpm for 4–5 hours.
[0030] 5. Resistance plate screening After the culture was completed, the bacterial cells were collected by centrifugation, most of the supernatant was discarded, and the remaining bacterial culture was mixed by pipetting and spread evenly on LB solid plates containing 50 µg / mL kanamycin (Amresco) and 50 µg / mL rifampin (Amresco). The plates were then incubated upside down at 28°C for about 3 days.
[0031] 6. Identification and Preservation of Positive Clones After single colonies have grown on the plates, positive clones are screened using colony PCR. Verified positive clones are picked and inoculated into LB liquid medium containing the corresponding antibiotics (50 µg / mL kanamycin (Amresco) and 50 µg / mL rifampin (Amresco)), and cultured at 28°C and 180 rpm for 16 hours with shaking. The cultured bacterial solution is then thoroughly mixed with 30% glycerol at a 1:1 volume ratio and stored at -80°C for later use as the Agrobacterium strain containing the target plasmid. This stored bacterial solution can be directly activated and used in subsequent infection experiments for rice genetic transformation.
[0032] Example 3: Obtaining and Identifying OsABA8ox1 Gene Promoter Editing Materials I. Agrobacterium-mediated infection of rice callus: 1) Take the Agrobacterium strain containing the target plasmid from the -80℃ freezer and inoculate it into LB liquid medium containing kanamycin (50 μg / mL) and rifampin (25 μg / mL) at a ratio of 1:100. Incubate overnight at 28℃ and 180 rpm with shaking. 2) Wait until the bacterial culture reaches an orange juice-like turbidity (OD). 600 When ≈1.0), it is used for subsequent infection experiments; 3) Take 500 μL of bacterial culture and place it in a 1.5 mL centrifuge tube. Centrifuge at 5000 rpm and 28℃ for 3 minutes. Discard the supernatant and collect the white bacterial precipitate. Then, use 300 μL of co-culture medium containing 30 μg / mL acetylsyringone (Aldrich) (each liter contains 4.4 g of total MS medium powder, 30 g of sucrose, 2 mg of 2,4-D, and 3 g of plant gel, adjusted to pH 5.2; the medium is autoclaved at 121℃ for 20 minutes; after the sterilized medium cools to about 55℃, add 30 mg of acetylsyringone) to gently resuspend the bacterial cells for later use. 4) Select healthy callus tissue from Nipponbare (NB) rice and place it in a 50 mL centrifuge tube, filling the callus tissue to approximately the 5 mL mark. 5) Add 20 mL of co-culture medium containing 20 μg / mL acetylsuccinone to the NB callus, then add 300 μL of the bacterial suspension prepared in step 3), and gently mix for 2-3 minutes to complete the infection operation; 6) Discard the co-culture medium, transfer the callus tissue to a culture dish lined with filter paper, and aspirate excess liquid for about 1 minute; then transfer the callus tissue to filter paper soaked in co-culture medium (the filter paper is placed on the surface of the solid co-culture medium), and co-culture at 28°C in the dark for 2-3 days.
[0033] II. Resumption of Culture 1) After co-culture, transfer the callus tissue to a 50 mL centrifuge tube and wash it 4-5 times with sterile water containing 400 μg / mL carbenicillin (Amresco), each time for 1 minute, to thoroughly remove residual Agrobacterium.
[0034] 2) Rinse the callus tissue 2-3 times with sterile water, dry the surface moisture, and then transfer it to a recovery medium containing 400 μg / mL carbenicillin (each liter contains 4.4 g MS dry powder, 30 g sucrose, 2 mg 2,4-D, 400 mg carbenicillin, 3 g plant gel, and adjust the pH to 5.8; the medium is autoclaved at 121℃ for 20 min, and the antibiotics are sterilized by filtration. After the sterilized medium has cooled to about 55℃, it is aseptically added). Incubate the medium in a 28℃ artificial climate chamber (continuous light) for 4-5 days.
[0035] III. Screening and Cultivation After the recovery culture was completed, the callus tissue was transferred to a selection medium containing 400 μg / mL carbenicillin and 50 μg / mL hygromycin (Roche). The medium contained 4.4 g MS medium powder, 30 g sucrose, and 2 mg 2,4-D per liter, with the addition of screening resistance agents: 50 mg hygromycin B, 400 mg carbenicillin, and 3 g plant gel. The pH was adjusted to 5.8. The medium was autoclaved at 121°C for 20 min, during which hygromycin and antibiotics were filtered and sterilized. The medium was added after cooling to 55°C. The medium was then cultured under continuous light at 28°C for about 30 days.
[0036] IV. Differentiation and Culture The resistant callus tissues that survived the screening culture were transferred to differentiation medium (containing 4.4 g MS medium powder, 30 g sucrose, 2 mg 6-BA, 0.2 mg NAA, 50 mg hygromycin B, 400 mg carbenicillin, and 3 g plant gel per liter, with pH adjusted to 5.8; the medium was autoclaved at 121℃ for 20 minutes, and 6-BA, NAA, hygromycin B, and carbenicillin were filtered to remove bacteria, and then aseptically added after the medium cooled to 55℃). One cluster of callus tissue was inoculated into each bottle and cultured under continuous light at 28℃ for about 30 days to induce the differentiation of transgenic seedlings.
[0037] V. Molecular Identification of Transgenic Plants 1) Take about 20 mg of rice leaf samples from induced transgenic seedlings, place them in a 2 mL centrifuge tube, add sterile steel beads, freeze quickly with liquid nitrogen, and then vigorously shake and grind into powder; 2) Remove the steel ball, add 700 μL of DNA lysis buffer, and incubate at 65°C for 30 minutes to fully lyse the sample; 3) Add an equal volume of chloroform, mix vigorously by inverting, and let stand at room temperature for 10 minutes; 4) Centrifuge at 12000 rpm and 4℃ for 10 minutes; 5) Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at room temperature for 10 minutes. 6) Centrifuge at 12000 rpm and 4℃ for 10 minutes, then discard the supernatant; 7) Wash the white precipitate (containing DNA and protein) with 70% ethanol, centrifuge again and discard the supernatant, then let the precipitate air dry at room temperature; 8) Add 50~100 μL of deionized water to dissolve the DNA to obtain a crude DNA solution for subsequent PCR identification; 9) Using crude DNA as a template, and referring to the Takara LA Taq DNA Polymerase instructions, the editing types of each transgenic line were detected according to the primers in Table 3. Specifically, pOsABA8ox1-1F (SEQ ID NO.12) and pOsABA8ox1-1R (SEQ ID NO.13) detected the editing types of target regions 1, 2, and 3; pOsABA8ox1-2F (SEQ ID NO.14) and pOsABA8ox1-2R (SEQ ID NO.15) detected the editing type of target region 4; and pOsABA8ox1-3F (SEQ ID NO.16) and pOsABA8ox1-3R (SEQ ID NO.17) detected the editing types of target sites 5 and 6.
[0038] Table 3 Primers used for detection
[0039] After screening and verification, this invention obtained a total of 6 homozygous mutants of OsABA8ox1 promoter editing with different editing types (e.g. Figure 1 (As shown). pOsABA8ox1-PE1 The mutation type is a deletion of 108bp from 1860bp to 1753bp before the start codon; pOsABA8ox1-PE2 The mutation type is a deletion of 130bp from 1467bp to 1338bp before the start codon; pOsABA8ox1-PE3 The mutation type is a deletion of 53bp from 1356bp to 1304bp before the start codon; pOSABA8OX1-PE4 The mutation type is a deletion of 144bp from the first 1279bp to the first 1136bp of the start codon; pOsABA8ox1-PE5 The mutation type involves a 6bp deletion between 419bp and 414bp before the start codon; pOsABA8ox1-PE6 The mutation type is a deletion of 9bp from 144bp to 135bp before the start codon, a T mutation to G at 145bp, and a T deletion at 157bp.
[0040] Example 4: Survival rate of OsABA8ox1 gene promoter editing materials under alkaline stress To verify the effect of OsABA8ox1 promoter editing on improving rice resistance to alkali stress, six promoters with different editing types obtained in Example 3 were selected. pOsABA8ox1-PE1 (SEQ ID NO.22) pOsABA8ox1-PE2 (SEQ ID NO.23) pOsABA8ox1-PE3 (SEQ ID NO.24) pOsABA8ox1-PE4 (SEQ ID NO.25) pOsABA8ox1-PE5 (SEQ ID NO.26) pOsABA8ox1-PE6The OsABA8ox1 promoter editing material family (SEQ ID NO. 27), with wild-type NB as a control, was grown in Kimura B nutrient solution to the 3-leaf-1-heart stage, then transferred to 15mM Na2CO3 (pH=10.8~11.0) prepared with distilled water for 6 days, and then transferred back to Kimura B nutrient solution for 12 days of recovery. Each family was treated in 3 replicates, with 32 plants per replicate. Survival rate was assessed after recovery, with surviving plants defined by the unfolded green leaves.
[0041] The results show that ( Figure 2 All materials showed significant growth inhibition under alkaline stress compared to the wild type. pOSABA8OX1-PE6 The survival rate of the material was as high as 66.67% after 12 days of recovery, significantly higher than that of wild-type and other promoter-edited lines. This result indicates that mutations in specific regions of the promoter can significantly improve the alkali stress resistance of rice.
[0042] Example 5: OsABA8ox1 Gene promoter editing materials under alkaline stress OsABA8ox1 Expression level detection To verify whether OsABA8ox1 promoter editing is reduced under alkaline stress. OsABA8ox1 Expression level. Six different editing types obtained in Example 3 were selected. pOsABA8ox1-PE1 , pOsABA8ox1-PE2 , pOsABA8ox1-PE3 , pOsABA8ox1-PE4 , pOsABA8ox1-PE5 , pOsABA8ox1-PE6 The OsABA8ox1 promoter editing material family, with wild-type NB as a control, was grown in Kimura B nutrient solution to the 3-leaf-1-heart stage, and then transferred to 15mM Na2CO3 (pH=10.8~11.0) prepared with distilled water. Gene expression levels were detected before treatment (0 h) and after treatment (48 h). The specific method was as follows: total RNA was extracted using TRIzol reagent, treated with DNase, and then reverse transcribed to synthesize cDNA as a template. Real-time quantitative PCR (qRT) was used. The relative expression levels of OsABA8ox1 in each material were detected by PCR, with UBQ as the internal reference gene. The qRT values of UBQ and OsABA8ox1 were compared. The PCR primer sequences are shown in Table 4.
[0043] Table 4 qRT PCR primers
[0044] The results show that ( Figure 3 ), pOsABA8ox1-PE2 Before treatment, the expression level was significantly higher than that of the wild type. pOsABA8ox1- PE6The expression levels of the strains before and after treatment were significantly lower than those of the wild type. The expression levels of the other strains were not different from those of the wild type before and after treatment, but their expression levels were upregulated by alkali stress.
[0045] Example 6: Detection of endogenous ABA content in OsABA8ox1 gene promoter editing materials under alkaline stress To further verify whether OsABA8ox1 gene promoter editing in rice plants increases endogenous ABA content, six plants with different editing types obtained in Example 3 were selected. pOsABA8ox1-PE1 , pOsABA8ox1-PE2 , pOsABA8ox1- PE3 , pOsABA8ox1-PE4 , pOsABA8ox1-PE5 , pOsABA8ox1-PE6 The OsABA8ox1 promoter editing material family, with wild-type NB as a control, was grown in Kimura B nutrient solution to the 3-leaf-1-heart stage, and then transferred to 15mM Na2CO3 (pH=10.8~11.0) prepared with distilled water. Endogenous ABA content was measured before treatment (0 h) and after treatment (48 h). The endogenous ABA content was determined by Wuhan Maiwei Metabolic Biotechnology Co., Ltd.
[0046] The results showed that the endogenous ABA content of the six gene-edited lines was not significantly different from that of the wild type before treatment. After alkali stress treatment, the endogenous ABA content of all lines, including the wild type, was increased compared with that before treatment. pOsABA8ox1-PE1 , pOsABA8ox1-PE2 , pOsABA8ox1-PE3 , pOsABA8ox1-PE4 , pOsABA8ox1-PE5 The endogenous ABA content of the five strains was not significantly different from that of the wild type after treatment. pOsABA8ox1-PE6 After treatment, the endogenous ABA content reached 27.24 ng / g, significantly higher than that of the wild type (11.36 ng / g). This example further verifies that the improved OsABA8ox1 promoter editing strategy of this invention increases the endogenous ABA content in rice.
[0047] In summary, the above examples fully demonstrate that the specific OsABA8ox1 promoter-edited strains in this invention can significantly improve the rice's resistance to alkali stress by reducing its own expression level and increasing the endogenous ABA content.
Claims
1. A mutant of the OsABA8ox1 gene promoter, characterized in that, Compared with the promoter of the wild-type rice OsABA8ox1 gene, the mutant has a 9bp deletion from 144bp to 135bp upstream of the start codon, a T-to-G mutation at 145bp, and a T deletion at 157bp; this mutant can specifically reduce the expression level of the OsABA8ox1 gene.
2. The mutant as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
27.
3. The mutant as described in claim 1, characterized in that, The promoter of the wild-type rice OsABA8ox1 gene includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.1; ii) Nucleotide sequences with the same promoter function obtained by inserting, deleting, or replacing one or more nucleotides from the nucleotide sequence shown in i).
4. An sgRNA, characterized in that it includes... Any of the following nucleotide sequences: i) Nucleotide sequence, specifically: GGTGGCAGCTATTTATAGAT; ii) Nucleotide sequences with the same targeting function obtained by inserting, deleting, or replacing one or more nucleotides as shown in i).
5. A biomaterial, characterized in that, Includes the mutant of any one of claims 1-3 or the sgRNA of claim 4; the biological material is an expression cassette, vector, transgenic cell or recombinant viral particle.
6. The use of the mutant of any one of claims 1-3, or the OsABA8ox1 gene promoter editing reagent, in reducing the expression level of the OsABA8ox1 gene, or in preparing a kit for reducing the expression level of the OsABA8ox1 gene; wherein the editing reagent is used to edit the OsABA8ox1 gene promoter to mutate it into the mutant of any one of claims 1-3.
7. The use of the mutant of any one of claims 1-3, or the editing reagent for the OSABA8OX1 gene promoter, in any of the following: i) Increase the endogenous abscisic acid content in plants, or prepare a kit for increasing the endogenous ABA content in plants; ii) Improve the alkali stress resistance of plants, or prepare a kit for improving the alkali stress resistance of plants; iii) Cultivate transgenic plants with high endogenous ABA content and high resistance to alkali stress; iv) Targeted improvement of plant varieties related to alkali stress resistance; v) Innovation and improvement of alkali-tolerant plant germplasm resources; The editing reagent is used to edit the promoter of the OsABA8ox1 gene to mutate it into the mutant described in any one of claims 1-3.
8. The application as described in claim 7, characterized in that, The plant in question is a member of the genus Oryza.
9. A method for reducing the expression level of the OsABA8ox1 gene, comprising: The promoter of the OsABA8ox1 gene is mutated to obtain the mutant according to any one of claims 1-3.
10. A method for preparing transgenic rice plants, or increasing the endogenous ABA content in rice plants, or improving the alkali stress resistance of rice plants, comprising: The promoter of the OsABA8ox1 gene in the rice plant was mutated to obtain the mutant according to any one of claims 1-3.