Miniature reversed repeat transposon MITE230 and application of dsRNA thereof in prevention and control of Frankliniella occidentalis
By using the miniature inverse repeat transposon MITE230 and its dsRNA, a recombinant vector was constructed and transformed into tobacco plants. This solved the problems of dsRNA stability and delivery efficiency in the control of western flower thrips using RNAi technology, achieving highly efficient and sensitive insecticidal effects against spinosad. This method is suitable for pest control in plants such as tobacco and tomato.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2025-12-24
- Publication Date
- 2026-05-08
AI Technical Summary
Existing RNAi technology faces challenges in controlling western flower thrips, including poor dsRNA stability, low delivery efficiency, and insufficient precision in target gene screening, and is particularly ineffective in controlling highly resistant western flower thrips populations.
Using the miniature inverse repeat transposon MITE230 and its dsRNA, a recombinant vector was constructed and transformed into Agrobacterium to infect tobacco plants, generating transgenic tobacco to enhance the sensitivity of western flower thrips to spinosad and specifically kill the pest.
It significantly improved the sensitivity of western flower thrips to spinosad, reduced the use of chemical pesticides, and achieved efficient and specific pest control.
Smart Images

Figure CN121992012A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically, to the application of a miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips. Background Technology
[0002] Western flower thrips (Frankliniella occidentalis) is a major agricultural pest with a global distribution and a wide host range, damaging more than 500 plant species, including vegetables, flowers, and various cash crops. This tiny insect is elusive, has a short generation cycle, and reproduces rapidly. Both nymphs and adults cause direct damage by rasping and sucking sap from the epidermal cells of plant tissues, leading to symptoms such as white spots, streaks, leaf curling, wilting of new shoots, and even necrosis. More seriously, western flower thrips are highly efficient vectors of many plant viruses, especially tomato spotted wilt virus and impatiens necrotic spot virus, posing a serious threat to crop yield and quality.
[0003] Currently, the control of western flower thrips mainly relies on chemical insecticides. However, due to the insect's short life cycle and rapid reproduction, coupled with the long-term high-intensity selective pressure from chemical agents, western flower thrips have developed high levels of resistance to many commonly used agents, including spinosad and pyrethroids. Studies have shown that specific resistant populations, such as near-isogenic populations resistant to spinosad, exhibit extremely strong tolerance to conventional doses of insecticides, leading to a significant decrease or even complete ineffectiveness of chemical control. The overuse of chemical pesticides not only faces the dilemma of escalating resistance but also brings a series of serious problems such as environmental pollution, excessive pesticide residues, and biodiversity destruction (e.g., damage to pollinating insects and natural enemies).
[0004] In recent years, RNA interference (RNAi) technology has been regarded as a core direction of next-generation green pest control technology due to its high specificity, environmental friendliness, and low likelihood of inducing traditional resistance. RNAi technology delivers sequence-specific double-stranded RNA into pests, efficiently and precisely silencing key genes related to growth, development, or pesticide resistance, thereby achieving control. Despite its great potential, RNAi technology still faces several technical bottlenecks in the practical application of western flower thrips control, limiting its large-scale application from the laboratory to the field: First, exposed dsRNA is easily degraded by nucleases in natural environments (such as leaf surfaces) and within the insect's internal environment, resulting in a shortened duration of effectiveness and high control costs. Second, how dsRNA efficiently penetrates the insect's body wall or enters the midgut through feeding and is effectively absorbed by cells is a key factor limiting the efficiency of RNAi. As a rasping-sucking pest, the western flower thrips' unique feeding method further increases the difficulty of effective dsRNA delivery. Third, not all genes can be effectively silenced by RNAi to induce a lethal phenotype. Currently, there is a lack of efficient and universally applicable target gene screening systems, and specific effective targets for different physiological stages of western flower thrips (such as nymphs and adults) or different geographical populations (such as susceptible and resistant populations) are particularly scarce. Finally, the large-scale, low-cost production of dsRNA and its field-stabilized formulation technology are still immature, which is a significant factor restricting its commercial application.
[0005] Therefore, developing an RNAi technology system that can overcome the above-mentioned bottlenecks, especially for highly resistant western flower thrips populations, has become an urgent need in the field of green pest control in agriculture. Summary of the Invention
[0006] In view of this, the present invention proposes the application of the miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips, aiming to solve the problems of poor dsRNA stability, low delivery efficiency and insufficient accuracy of target gene screening faced by RNAi technology in the actual control of western flower thrips.
[0007] This invention proposes the application of the miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips, comprising the following steps: 1) Collect adult thrips from spinosad-susceptible and spinosad-resistant populations of western flower thrips and extract genomic DNA from them. 2) PCR amplification was performed by mixing the MITE230 primer with the extracted western flower thrips genomic DNA, and MITE230 was cloned. The MITE230 plasmid was obtained by extracting the bacterial culture with correct sequencing. 3) PCR amplification was performed by mixing dsRNA primers with the extracted western flower thrips genomic DNA, and then the PCR products were subjected to gel electrophoresis and the products were recovered. 4) The PCR-recovered products were used to synthesize dsRNA using the T7 RiboMAX Express RNAi kit; 5) Newly emerged female western flower thrips were fed with synthetic dsRNA; 6) Perform spinosad bioassay on female western flower thrips fed with dsRNA; 7) The plasmid of MITE230 was ligated into the PTCK303 vector to form a recombinant vector; 8) The recombinant vector obtained in step 7) was used to transform Agrobacterium to obtain monoclonal Agrobacterium; 9) Inoculate monoclonal Agrobacterium into a culture medium containing antibiotics and culture to obtain engineered bacterial solution; 10) After preparing explants from sterile tobacco seedlings, they were mixed with engineered bacterial solutions for infection. The infected explants were cultured in the dark, and then screened to obtain independent and complete transgenic tobacco lines. 11) Harden off the transgenic tobacco lines obtained through cultivation to obtain transgenic tobacco seedlings that can enhance the sensitivity of western flower thrips to spinosad; The dsRNA primers include nucleotide sequences such as ds230-F of SEQ ID NO.1, ds230-R of SEQ ID NO.2, dsEGFP-F of SEQ ID NO.3, and dsEGFP-R of SEQ ID NO.4; The nucleotide sequence of the micro inverted repeat transposon MITE230 is shown in SEQ ID NO.5; The MITE230 primers include an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO. 6, and the sequence of the downstream primer is shown in SEQ ID NO. 7.
[0008] Preferably, the PCR amplification reaction system in step 3) includes the following reagents: 2×ES Taq mix: 12.5μL 10 μmol / L upstream primer: 0.5 μL 10 μmol / L downstream primer: 0.5 μL DNA template: 1μL Sterile water: 10.5 μL.
[0009] The reaction procedure for the PCR amplification is as follows: Pre-denaturation at 95℃ for 5 minutes Denaturation at 95°C for 30 seconds Annealing at 58℃ for 45 seconds Extended temperature 72℃ 1min / kb Repeat the denaturation-annealing-extension cycle for 35 times. Final extension at 72℃ for 10 minutes.
[0010] Preferably, the reaction system for dsRNA synthesis in step 4) includes the following reagents: Template DNA: 1μg Transcription reaction buffer: 2 μL Ribonuclease inhibitor: 2.5 μL T7 RNA polymerase: 2 μL 1.8 μL of ATP (adenosine triphosphate) at a concentration of 100 mmol / L. 1.8 μL of 100 mmol / L CTP (cytidine triphosphate) 1.8 μL of 100 mmol / L GTP-guanosine triphosphate 1.8 μL of uridine triphosphate (UTP) at a concentration of 100 mmol / L. 100 mmol / L DTP deoxyribonucleoside triphosphate: 2 μL Nuclease-free water: until the total volume of the system is 20 μL.
[0011] Preferably, the method for constructing the recombinant vector in step 7) is as follows: a. Mix buffer, dNTPs, MITE230 DNA template, DMSO, upstream primer, downstream primer, and DNA polymerase for PCR amplification; b. Perform agarose gel electrophoresis on the PCR amplification products, and cut and recover the target DNA band to obtain the DNA product; c. Mix the DNA product, enzyme digestion buffer, restriction endonuclease, and water to digest the DNA fragments. d. Perform agarose gel electrophoresis on the DNA fragments, and cut and recover the target DNA bands to obtain the DNA fragments; e. The DNA fragment obtained in step d and the empty PTCK-303 vector were digested with SacI / SpeI enzymes and then recombined. The empty PTCK-303 vector was then digested with BamHI / KpnI enzymes and finally added to the EasyGenoDNA recombination system for ligation to obtain the recombinant vector PTCK303-MITE230.
[0012] Preferably, the transformation method of the monoclonal Agrobacterium in step 8) is as follows: Competent Agrobacterium cells were mixed with a recombinant vector and sequentially subjected to an ice bath, liquid nitrogen, a 37°C water bath, an ice bath followed by liquid culture medium, and then cultured with shaking to obtain monoclonal Agrobacterium. The Agrobacterium species in question is GV3101.
[0013] Preferably, the method for culturing the engineered bacterial solution in step 9) is as follows: Monoclonal Agrobacterium colonies were inoculated into YEB liquid medium containing antibiotics and cultured at 28°C in the dark with shaking at 180 rpm. When the bacterial concentration at OD600nm was 0.6-0.8, the colonies were transferred to centrifuge tubes and centrifuged at 4000 rpm at 4°C for 10 min to collect the bacterial cells. The cells were then resuspended in YB resuspension to obtain an engineered bacterial suspension with an OD600nm concentration of 0.5.
[0014] Preferably, the infection temperature in step 10) is room temperature, and the time is 10-15 minutes; The cultivation time in the dark is 2 days; The culture medium used during the cultivation process is co-culture medium YC.
[0015] Preferably, the screening culture in step 10) is carried out at a temperature of 25°C, a light intensity of 3000~5000 lux, and a photoperiod of 16h / day; During the selection and culture process, the explants were transferred to a new culture medium every two weeks, and necrotic explants were discarded during the transfer process.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention enhances the sensitivity of western flower thrips to spinosad by targeting and interfering with MITE230, thereby specifically killing the pest and reducing the use of chemical pesticides.
[0017] This application is not limited to tobacco plants; it can also be used to genetically modify other plants, such as tomatoes, to control western flower thrips. Attached Figure Description
[0018] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings: Figure 1 The results show the mortality rate of western flower thrips silenced with dsRNA in the feeding solution for 48 hours in Example 1 under spinosad conditions. Figure 2 The results show the mortality rate of western flower thrips in the spinosad environment after silencing transgenic tobacco leaves for 48 hours in the experimental case. Detailed Implementation
[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the present invention.
[0020] Furthermore, regarding the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included within this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0024] This invention proposes the application of the miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips, comprising the following steps: 1) Collect adult thrips from spinosad-susceptible and spinosad-resistant populations of western flower thrips and extract genomic DNA from them. 2) PCR amplification was performed by mixing the MITE230 primer with the extracted western flower thrips genomic DNA, and MITE230 was cloned. The MITE230 plasmid was obtained by extracting the bacterial culture with correct sequencing. 3) PCR amplification was performed by mixing dsRNA primers with the extracted western flower thrips genomic DNA, and then the PCR products were subjected to gel electrophoresis and the products were recovered. 4) The PCR-recovered products were used to synthesize dsRNA using the T7 RiboMAX Express RNAi kit; 5) Newly emerged female western flower thrips were fed with synthetic dsRNA; 6) Perform spinosad bioassay on female western flower thrips fed with dsRNA; 7) The plasmid of MITE230 was ligated into the PTCK303 vector to form a recombinant vector; 8) The recombinant vector obtained in step 7) was used to transform Agrobacterium to obtain monoclonal Agrobacterium; 9) Inoculate monoclonal Agrobacterium into a culture medium containing antibiotics and culture to obtain engineered bacterial solution; 10) After preparing explants from sterile tobacco seedlings, they were mixed with engineered bacterial solutions for infection. The infected explants were cultured in the dark, and then screened to obtain independent and complete transgenic tobacco lines. 11) Harden off the transgenic tobacco lines obtained through cultivation to obtain transgenic tobacco seedlings that can enhance the sensitivity of western flower thrips to spinosad; The dsRNA primers include nucleotide sequences such as ds230-F of SEQ ID NO.1, ds230-R of SEQ ID NO.2, dsEGFP-F of SEQ ID NO.3, and dsEGFP-R of SEQ ID NO.4; The nucleotide sequence of the micro inverted repeat transposon MITE230 is shown in SEQ ID NO.5; The MITE230 primers include an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO. 6, and the sequence of the downstream primer is shown in SEQ ID NO. 7.
[0025] In this invention, the PCR amplification reaction system in step 3) includes the following reagents: 2×ES Taq mix: 12.5μL 10 μmol / L upstream primer: 0.5 μL 10 μmol / L downstream primer: 0.5 μL DNA template: 1μL Sterile water: 10.5 μL.
[0026] The reaction procedure for the PCR amplification is as follows: Pre-denaturation at 95℃ for 5 minutes Denaturation at 95°C for 30 seconds Annealing at 58℃ for 45 seconds Extended temperature 72℃ 1min / kb Repeat the denaturation-annealing-extension cycle for 35 times. Final extension at 72℃ for 10 minutes.
[0027] In this invention, the reaction system for dsRNA synthesis in step 4) includes the following reagents: Template DNA: 1μg Transcription reaction buffer: 2 μL Ribonuclease inhibitor: 2.5 μL T7 RNA polymerase: 2 μL 1.8 μL of ATP (adenosine triphosphate) at a concentration of 100 mmol / L. 1.8 μL of 100 mmol / L CTP (cytidine triphosphate) 1.8 μL of 100 mmol / L GTP-guanosine triphosphate 1.8 μL of uridine triphosphate (UTP) at a concentration of 100 mmol / L. 100 mmol / L DTP deoxyribonucleoside triphosphate: 2 μL Nuclease-free water: until the total volume of the system is 20 μL.
[0028] In this invention, the method for constructing the recombinant vector in step 7) is as follows: a. Construct plasmids using a high-fidelity enzyme PCR reaction system. The high-fidelity enzyme PCR reaction system has a volume of 20 μL and includes: 2 μL 10× buffer, 2 μL 2 mM deoxyribonucleoside triphosphate, 2 μL MITE230 plasmid, 1 μL dimethyl sulfoxide, 0.8 μL 10 pmol / L upstream and downstream primers, 0.5 U kod DNA polymerase (KOD-401, TOYOBO), and water; The high-fidelity enzyme PCR reaction system was subjected to PCR amplification according to the following procedure: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 50~64℃ annealing for 30 s, 68℃ extension for 1 min / kb; 40 cycles; 68℃ incubation for 8 min. b. Add 10× loading buffer to the PCR reaction system in step a, perform electrophoresis on an agarose gel containing 1%~3% (10μL EB, 1~3 g agarose / 100 mL 0.5×TBE buffer), perform electrophoresis in 0.5×TBE buffer at 5~10 V / cm, end the electrophoresis, and take a picture in the gel imaging system; Excise the target band and place it in a 1.5 mL EP tube. Add 400 μL of banding B (sol) to the tube and place it in a 70°C water bath until the gel is completely dissolved. Add 100 μL of isopropanol to the tube, incubate at room temperature for 1 minute, and centrifuge at 5000 rpm for 1 minute to pass through the column. Repeat the isopropanol washing and column passing. Add 500 μL of wash buffer and wash twice at 12000 rpm, then centrifuge at 10000 rpm for 1 minute. Add 40 μL of double-distilled water to the column, incubate at 37°C for 2 minutes, and centrifuge at 12000 rpm for 1 minute to collect the DNA product. c. After the PCR fragments were recovered from the agarose gel, the first fragment and the PTCK-303 empty vector were digested with SacI / SpeI, followed by recombination. After correct sequencing, the plasmid containing the first fragment was digested with BamHI / KpnI, recovered, and then a second recombination was performed. The plasmid and the selected empty vector were digested together in a 40 μL system for 1 h. After electrophoresis, the DNA fragment to be ligated was recovered from the gel and added to the EasyGenoDNA recombination system for ligation (#VI201-02, Tiangen Biotech). The recombinant system comprises: 5 μL 2×EasyGeno Assembly Mix, 2.5 μL enzyme-digested vector DNA, and 2.5 μL fragment DNA; The recombination conditions were: bathing in a 16°C water bath for 30 minutes; Enzyme digestion method: Mix the DNA to be digested, 4 μL of 10× digestion buffer, 4 μL of 10× BSA, and 6 U of restriction endonuclease, then add water to a volume of 40 μL and digest for 1 h; In this invention, the transformation method of the monoclonal Agrobacterium in step 8) is as follows: Take Agrobacterium competent cells stored at -80℃ and let them partially thaw at room temperature or in your palm for a moment. When they are in an ice-water mixture, insert them into ice. Add 0.01~1 μg plasmid DNA to every 100 μl of Agrobacterium competent cells, mix by hand by tapping the bottom of the tube, and incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes in sequence. Add 700 μL of antibiotic-free LB or YEB liquid medium and incubate at 28°C with shaking for 2-3 hours; Centrifuge at 6000 rpm for one minute to collect bacteria, and collect about 100 μL of supernatant. Gently pipette and resuspend the bacterial block, then spread it on LB or YEB plates containing the corresponding antibiotic. Invert the plates and incubate at 28℃ for 2-3 days to obtain monoclonal Agrobacterium. The Agrobacterium species in question is GV3101.
[0029] In this invention, the method for culturing the engineered bacterial solution in step 9) is as follows: Monoclonal Agrobacterium colonies were inoculated into YEB liquid medium containing antibiotics and cultured at 28°C and in the dark with shaking at 180 rpm. When the bacterial concentration at OD600nm was 0.6-0.8, the bacterial cells were transferred to centrifuge tubes, centrifuged at 4000 rpm and 4°C for 10 min to collect the cells, and then resuspended in YB resuspension to obtain an engineered bacterial suspension with a concentration of OD600nm of 0.5. The antibiotic in question is kanamycin.
[0030] In this invention, the infection temperature in step 10) is room temperature, and the time is 10-15 minutes; The cultivation time in the dark is 2 days; The culture medium used during the cultivation process is co-culture medium YC.
[0031] In this invention, the screening culture in step 10) is carried out at a temperature of 25°C, a light intensity of 3000~5000 lux, and a photoperiod of 16h / day. During the selection and culture process, the explants were transferred to a new culture medium every two weeks, and necrotic explants were discarded during the transfer process.
[0032] SEQ ID NO.1: TAATACGACTCACTATAGGGAGGCCGTCTTTTGGCAA; SEQ ID NO.2: TAATACGACTCACTATAGGGCTGCCAAATTTCGGCCT; SEQ ID NO.3: TAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTAC; SEQ ID NO.4: TAATACGACTCACTATAGGGGTTCACCTTGATGCCGTTC; SEQ ID NO.5: CACTGTTATTCAACGATTGTGACGTCACATCGTTTCAATGTAAATCGTGTCACATTCGTTTGAATGTTGTGTCATATTCGTTGTAAACGTGAATCGGCCAAGCCTGGCGCCATTAGAGCATCAATTCACCTCAAGTCACGTTTAAATGAATGTGACACAATATTCGAACGAATGTGACACATTTCACATTGAAATGAATGTGACGTCACATATCTTGAATAACAGTGCAA; SEQ ID NO.6: AGGCCGTCTTTTGGCAA; SEQ ID NO.7: CTGCCAAATTTCGGCCT.
[0033] Example 1 1.1 Extraction of DNA from Western Flower Thrips Approximately 80-100 adult western flower thrips from populations Ivf03 and NIL-R were collected in 1.5 mL centrifuge tubes. Genomic DNA was extracted from western flower thrips using a tissue genome extraction kit (Tiangen Technology Co., Ltd., China) and stored at -20°C for later use.
[0034] 1.2 Synthesis of dsRNA Based on the sequence of MITE230, specific dsRNA primers containing the T7 promoter sequence were designed, as shown in Table 1: Table 1 RNAi primers
[0035] Conventional PCR was performed using dsRNA primers with DNA. The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3. Table 2 PCR amplification reaction system
[0036] Table 3 PCR amplification reaction procedure
[0037] After PCR amplification, the product was subjected to agarose gel electrophoresis. The presence of the target band (only one target band) was observed under a BIO-RAD ChemiDoc XRS gel imaging system. The gel was then cut and recovered using a Promega gel recovery kit to obtain the recovered product, which was stored at -20°C.
[0038] Based on the products obtained above, dsRNA synthesis was performed using the T7 RiboMAX Express RNAi kit. The specific experimental steps are as follows: According to the reaction system in Table 4, the relevant components were added sequentially to a 1.5 mL RNAfree centrifuge tube and incubated at 37°C for 1 h; 1 µL of RNaes-Free DNase was added and incubated at 37°C for 30 min; an equal volume of 5 mmol / L ammonium acetate solution was added, and the tube was placed on ice for 15 min, then centrifuged at 13000 rpm for 15 min at 4°C; the supernatant was removed, and the precipitate was washed with 1 mL of 70% ethanol and centrifuged at 8000 rpm for 10 min at 4°C; the ethanol solution was discarded, and the tube was air-dried; 200 µL of nuclease-free water was added, and the tube was stored at -80°C for later use.
[0039] Table 4 dsRNA synthesis system
[0040] 1.3 RNAi of the silent western flower thrips NIL-R population MITE230 A dsRNA feeding solution of 500 ng / µL was prepared using 10% sucrose solution and dsRNA, and newly emerged female western flower thrips were fed to them. The experimental setup was as follows: First, the bottom 1 cm of a 10 mL centrifuge tube was cut off, and the cut edge was slightly heated over an alcohol lamp until it was slightly melted. Then, it was quickly attached to a 200-mesh gauze (ensuring good air permeability of the device). Thirty newly emerged female western flower thrips were placed in the RNAi device, and then a pre-thinned Parafilm sealing film was quickly attached to the tube opening. 200 µL of dsRNA feeding solution was added, and the sample well was sealed with the sealing film. After the bottom was shielded from light, the device was placed in an incubator (25±1℃, 16L:8D) and fed for 48 h.
[0041] 1.4 Bioassays of Western Flower Thrips after MITE230 RNAi Spontamine bioassay was performed on western flower thrips that had been silenced for 48 h using the leaf tube film method.
[0042] 1.4.1 Preparation of spinosad: Dilute 92% spinosad with distilled water containing 0.1% Triton to 250 mg / L.
[0043] 1.4.2. Centrifuge tube soaking: Mark each centrifuge tube and fill it with the corresponding reagent using a pipette. Place the tubes horizontally for 4 hours to allow the tube walls to fully contact the reagent. Then, discard the spinosad reagent and allow the tubes to dry at room temperature for 2 hours. Cut a 3-5 mm hole at the bottom of each tube to allow the thrips to be drawn in.
[0044] 1.4.3. Cabbage leaf disc immersion solution: Use a punch to make leaf discs about 1 cm in diameter from cabbage leaves in the greenhouse that have not been exposed to any pesticides. Immerse the leaf discs in spinosad pesticide for about 10 seconds, then remove them and place them on filter paper. Let them dry at room temperature for 30 minutes before use.
[0045] 1.4.4. Assembly of the bioassay apparatus: Place the dried leaf disc with the back facing up into the centrifuge tube. Before placing it in, place a filter paper of the same size under the leaf disc to absorb moisture.
[0046] 1.4.5. Fluke Implantation: Use a fluke to suck adult western flower thrips into the small hole, 15-20 thrips per tube. After suction, seal the hole with sealing film and finally tighten the centrifuge tube cap. Place all centrifuge tubes in an indoor environment at 27±1℃, L:D=16:8 photoperiod, and 65% humidity for 48 hours. Check the mortality rate of western flower thrips under 250 mg / L spinosad (thrips that cannot move when gently touched are considered dead). Results are as follows: Figure 1 As shown, silencing western flower thrips with MITE230 for 48 h significantly increased their sensitivity to spinosad, with the mortality rate increasing significantly from 40.5% to 72.67% compared to the control group (fed dsEGFP).
[0047] 1.5 Tobacco Genetic Transformation 1.5.1 Constructing a Recombination Carrier The plasmid of MITE230 was ligated into the PTCK303 vector to form a recombinant vector.
[0048] 1.5.2 Obtaining Plant Materials Select plump tobacco seeds of uniform size and disinfect them as follows: 1) Clean with 75% alcohol for 1 minute.
[0049] 2) Rinse the tobacco seeds for 10 minutes with a mixture of 10% sodium hypochlorite solution (i.e., sodium hypochlorite stock solution and sterile water in a volume ratio of 1:9) and 1‰ Tween solution. The sodium hypochlorite stock solution (CAS: 7681-52-9) was purchased from Sinopharm. Then, disinfect the tobacco seeds with 5% sodium hypochlorite solution for 8 minutes.
[0050] 3) Wash 5 times with sterile water, and retain the water after the last wash.
[0051] 4) Use sterile forceps to cut off the tip of the 1mL sterile pipette tip, blow away the watery seeds, and transfer them to sterile filter paper to remove surface moisture.
[0052] 5) After sterilization, inoculate the seeds onto the sowing medium (YA), place them in a culture room at 25±1℃, light for 16h / d, and culture at 3000 lux. Once they grow to a height of 6~8cm, they can be used for genetic transformation.
[0053] 1.5.3 Preparation of engineered bacterial culture The competent Agrobacterium strain was GV3101 (catalog number AC1001S, purchased from Shanghai Weidi Biotechnology Co., Ltd.). The Agrobacterium transformation method was as follows: Agrobacterium competent cells stored at -80℃ were partially thawed at room temperature or in the palm of the hand, and then inserted into ice while in an ice-water mixture. 0.01–1 μg of plasmid DNA was added to every 100 μl of competent Agrobacterium cells, and the mixture was stirred by hand at the bottom of the tube. The tube was then incubated sequentially on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37℃ water bath for 5 minutes, and in an ice bath for 5 minutes. 700 μL of antibiotic-free LB or YEB liquid medium was added, and the tube was incubated at 28℃ with shaking for 2–3 hours. The cells were collected by centrifugation at 6000 rpm for one minute. Approximately 100 μL of the supernatant was collected, and the resuspended bacterial block was gently resuspended by pipetting and spread onto LB or YEB plates containing the appropriate antibiotic. The plates were then incubated upside down in a 28℃ incubator for 2–3 days to obtain monoclonal Agrobacterium.
[0054] Select a single-clone Agrobacterium colony and inoculate it into 50 mL of YEB liquid medium containing the corresponding antibiotic. Incubate at 28°C in the dark with shaking at 180 rpm. When the bacterial concentration (OD600nm) reaches 0.6, transfer it to a centrifuge tube and centrifuge at 4000 rpm at 4°C for 10 min to collect the bacterial cells. Then resuspend the cells in YB resuspension and adjust the concentration (OD600nm) to 0.5.
[0055] 1.5.4 Explant Preparation Cut the tender leaves of sterile tobacco seedlings into pieces approximately 1cm x 1cm for later use.
[0056] 1.5.5 Infection and Co-culture Mix the explants with the engineered bacterial solution and incubate at room temperature for 15 minutes, shaking occasionally. After incubation, blot the infecting explants dry on sterile absorbent paper and then transfer them to co-culture medium YC for 2 days in the dark.
[0057] 1.5.6 Screening and Culture The co-cultured explants were transferred to selection medium YD containing the corresponding antibiotic (kanamycin), with about 10 explants placed in each culture dish to ensure good contact between the explants and the medium. The culture was then transferred to 25°C, 3000 lux, and a photoperiod of 16 h / day. The explants were transferred to a new medium every 2 weeks, and necrotic explants were discarded during the transfer process.
[0058] 1.5.6 Rooting Culture When the adventitious buds grow to about 1 cm during the screening and culture process, select single buds from non-adjacent positions, completely remove the callus tissue and culture medium at the base, and transfer them to the rooting medium YF for culture to form an independent and complete lineage.
[0059] 1.5.7 Hardening off and transplanting After the sterile seedlings have developed lateral roots, remove the bottle cap, cover them with a plastic bag, and place them in a cool, ventilated place to harden off. After removing the cap, to ensure humidity and sterilization, pour in a 1500-fold diluted 50% carbendazim solution (the amount should just cover the culture medium). Two days later, rinse off the agar adhering to the roots (do not damage the root system during rinsing), and transplant the seedlings into the nutrient substrate. Keep the substrate moist during cultivation. For the first 7 days, cover the seedlings with a transparent plastic film and cultivate them under low light for a period of time to allow the transplanted seedlings to adapt to the transition from culture medium to nutrient soil.
[0060] Experimental Example The control characteristics of tobacco seedlings successfully cultivated in Example 1 against western flower thrips were tested.
[0061] Select successfully transformed tobacco seedlings, pick leaves, cut filter paper of appropriate size, put the leaves and filter paper together into a 5 mL centrifuge tube, use a pipette to aspirate newly emerged female adult thrips of the NIL-R population (spinosad resistant population) and put them into the centrifuge tube, and feed for 48 h.
[0062] Bioassays of western flower thrips after consuming genetically modified tobacco: 1. Preparation of spinosad: Dilute 92% spinosad with distilled water containing 0.1% Triton to a concentration of 250 mg / L to obtain the spinosad agent.
[0063] 2. Centrifuge tube soaking: Label each centrifuge tube and fill it with spinosad solution using a pipette. Place the tubes horizontally for 4 hours to allow the tube walls to fully contact the solution. Then discard the solution and allow the tubes to dry at room temperature for 2 hours. Cut a 3-5 mm hole at the bottom of each tube to allow the thrips to be drawn in.
[0064] 3. Cabbage leaf disc infusion: Use a punch to make leaf discs about 1 cm in diameter from cabbage leaves in the greenhouse that have not been exposed to any pesticides. Dip the leaf discs in spinosad pesticide for about 10 seconds, then take them out and place them on filter paper. Let them dry at room temperature for 30 minutes before use.
[0065] 4. Assembling the bioassay apparatus: Place the dried leaf disc with the back facing up into the centrifuge tube. Before placing it in, place a filter paper of the same size under the leaf disc to absorb moisture.
[0066] 5. Fluke: Experimental group: Adult western flower thrips that had been fed with transgenic tobacco leaves (feeding time was 48 hours before the experiment) were sucked into the small hole using a siphon tube, with 15-20 thrips per tube. After sucking, the small hole was sealed with sealing film, and finally the centrifuge tube cap was tightened.
[0067] Control group: Adult western flower thrips that had been fed with dsEGFP (feeding time was 48 hours before the experiment) were sucked into the small hole using a siphon tube, 15-20 thrips per tube. After sucking, the small hole was sealed with sealing film, and finally the centrifuge tube cap was tightened.
[0068] All centrifuge tubes were placed in an indoor environment with a temperature of 27±1℃, an L:D ratio of 16:8, a photoperiod of 65%, and a humidity of 65%. After 48 hours, the mortality rate of western flower thrips under 250 mg / L spinosad was examined. The results were as follows: Figure 2 As shown, feeding transgenic tobacco with western flower thrips for 48 hours significantly increased its sensitivity to spinosad, with the mortality rate increasing significantly from 68.45% to 100% compared to the control group. Feeding plants with dsRNA after its transfer to the plant resulted in better gene silencing than feeding them directly with dsRNA.
[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.
Claims
1. The application of a miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips, characterized in that, Includes the following steps: 1) Collect adult thrips from spinosad-susceptible and spinosad-resistant populations of western flower thrips and extract genomic DNA from them. 2) PCR amplification was performed by mixing the MITE230 primer with the extracted western flower thrips genomic DNA, and MITE230 was cloned. The MITE230 plasmid was obtained by extracting the bacterial culture with correct sequencing. 3) PCR amplification was performed by mixing dsRNA primers with the extracted western flower thrips genomic DNA, and then the PCR products were subjected to gel electrophoresis and the products were recovered. 4) The PCR-recovered products were used to synthesize dsRNA using the T7 RiboMAX Express RNAi kit; 5) Newly emerged female western flower thrips were fed with synthetic dsRNA; 6) Perform spinosad bioassay on female western flower thrips fed with dsRNA; 7) The plasmid of MITE230 was ligated into the PTCK303 vector to form a recombinant vector; 8) The recombinant vector obtained in step 7) was used to transform Agrobacterium to obtain monoclonal Agrobacterium; 9) Inoculate monoclonal Agrobacterium into a culture medium containing antibiotics and culture to obtain engineered bacterial solution; 10) After preparing explants from sterile tobacco seedlings, they were mixed with engineered bacterial solutions for infection. The infected explants were cultured in the dark, and then screened to obtain independent and complete transgenic tobacco lines. 11) Harden off the transgenic tobacco lines obtained through cultivation to obtain transgenic tobacco seedlings that can enhance the sensitivity of western flower thrips to spinosad; The dsRNA primers include nucleotide sequences such as ds230-F of SEQ ID NO.1, ds230-R of SEQ ID NO.2, dsEGFP-F of SEQ ID NO.3, and dsEGFP-R of SEQ ID NO.4; The nucleotide sequence of the micro inverted repeat transposon MITE230 is shown in SEQ ID NO.5; The MITE230 primers include an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO.6, and the sequence of the downstream primer is shown in SEQ ID NO.
7.
2. The application of the miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips according to claim 1, characterized in that, The PCR amplification reaction system described in step 3) includes the following reagents: 2×ES Taq mix: 12.5μL 10 μmol / L upstream primer: 0.5 μL 10 μmol / L downstream primer: 0.5 μL DNA template: 1μL Sterile water: 10.5 μL; The reaction procedure for the PCR amplification is as follows: Pre-denaturation at 95℃ for 5 minutes Denaturation at 95°C for 30 seconds Annealing at 58℃ for 45 seconds Extended temperature 72℃ 1min / kb Repeat the denaturation-annealing-extension cycle for 35 times. Final extension at 72℃ for 10 minutes.
3. The application of the miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips according to claim 2, characterized in that, The reaction system for dsRNA synthesis described in step 4) includes the following reagents: Template DNA: 1μg Transcription reaction buffer: 2 μL Ribonuclease inhibitor: 2.5 μL T7 RNA polymerase: 2 μL 1.8 μL of ATP (adenosine triphosphate) at a concentration of 100 mmol / L. 1.8 μL of 100 mmol / L CTP (cytidine triphosphate) 1.8 μL of 100 mmol / L GTP-guanosine triphosphate 1.8 μL of uridine triphosphate (UTP) at a concentration of 100 mmol / L. 100 mmol / L concentration of DTP deoxyribonucleoside triphosphate: 2 μL Nuclease-free water: until the total volume of the system is 20 μL.
4. The application of the miniature inverse repeat transposon MITE230 and its dsRNA in the control of western flower thrips according to claim 3, characterized in that, The method for constructing the recombinant vector described in step 7) is as follows: a. Mix buffer, dNTPs, MITE230 DNA template, DMSO, upstream primer, downstream primer, and DNA polymerase for PCR amplification; b. Perform agarose gel electrophoresis on the PCR amplification products, and cut and recover the target DNA band to obtain the DNA product; c. Mix the DNA product, enzyme digestion buffer, restriction endonuclease, and water to digest the DNA fragments. d. Perform agarose gel electrophoresis on the DNA fragments, and cut and recover the target DNA bands to obtain the DNA fragments; e. The DNA fragment obtained in step d and the empty PTCK-303 vector were digested with SacI / SpeI enzymes and then recombined. The empty PTCK-303 vector was then digested with BamHI / KpnI enzymes and finally added to the EasyGenoDNA recombination system for ligation to obtain the recombinant vector PTCK303-MITE230.
5. The application of the miniature inverse repeat transposon MITE230 and its dsRNA according to claim 4 in the control of western flower thrips, characterized in that, The transformation method of the monoclonal Agrobacterium in step 8) is as follows: Competent Agrobacterium cells were mixed with a recombinant vector and sequentially subjected to an ice bath, liquid nitrogen, a 37°C water bath, an ice bath followed by liquid culture medium, and then cultured with shaking to obtain monoclonal Agrobacterium. The Agrobacterium species in question is GV3101.
6. The application of the miniature inverse repeat transposon MITE230 and its dsRNA according to claim 5 in the control of western flower thrips, characterized in that, The method for culturing the engineered bacterial solution described in step 9) is as follows: Monoclonal Agrobacterium colonies were inoculated into YEB liquid medium containing antibiotics and cultured at 28°C in the dark with shaking at 180 rpm. When the bacterial concentration at OD600nm was 0.6-0.8, the colonies were transferred to centrifuge tubes and centrifuged at 4000 rpm at 4°C for 10 min to collect the bacterial cells. The cells were then resuspended in YB resuspension to obtain an engineered bacterial suspension with an OD600nm concentration of 0.
5.
7. The application of the miniature inverse repeat transposon MITE230 and its dsRNA according to claim 6 in the control of western flower thrips, characterized in that, The infection temperature described in step 10) is room temperature, and the time is 10-15 minutes; The cultivation time in the dark is 2 days; The culture medium used during the cultivation process is co-culture medium YC.
8. The application of the miniature inverse repeat transposon MITE230 and its dsRNA according to claim 7 in the control of western flower thrips, characterized in that, The screening culture described in step 10) is conducted at a temperature of 25°C, a light intensity of 3000~5000 lux, and a photoperiod of 16h / day. During the selection and culture process, the explants were transferred to a new culture medium every two weeks, and necrotic explants were discarded during the transfer process.