Non-tissue-culture-dependent hevea brasiliensis high-altitude layering genetic transformation method

By using a non-tissue culture-dependent air layering genetic transformation method for rubber trees, and infecting the trunks of rubber trees with Agrobacterium rhizogenes K599 bacterial solution, the problems of high cost, long cycle and strong genotype dependence in existing rubber tree transformation technologies have been solved. This method achieves efficient and simple genetic transformation, is applicable to a variety of varieties, and produces robust transformed plants.

CN121992017APending Publication Date: 2026-05-08XISHUANGBANNA TROPICAL BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XISHUANGBANNA TROPICAL BOTANICAL GARDEN CHINESE ACAD OF SCI
Filing Date
2026-01-22
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing transgenic rubber tree technology is highly dependent on tissue culture systems, which are costly, time-consuming, complex to operate, and highly dependent on genotype. It is difficult to achieve efficient genetic transformation of key varieties such as GT1 and Tianren 31-45. Furthermore, traditional methods are not universally applicable under different conditions, material acquisition is limited by the season, and the transformed plants are weak.

Method used

A non-tissue culture-dependent air layering genetic transformation method for rubber trees was adopted. The target gene was carried by Agrobacterium rhizogenes K599 bacterial solution. The infection was carried out by girdling the stem and covering it with a moist culture medium, bypassing the tissue culture process. The process included girdling treatment, pretreatment to remove latex, use of sucrose and CaCl2 solution, and infection by wrapping or injection. It is applicable to a variety of rubber tree varieties.

Benefits of technology

It achieves simple, rapid, and low-cost genetic transformation with a positive rate of over 57%, high instantaneous transformation rate, and produces robust transformed plants. It is not limited by season, is applicable to a variety of rubber tree varieties, and simplifies the operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121992017A_ABST
    Figure CN121992017A_ABST
Patent Text Reader

Abstract

The invention relates to a non-tissue-culture-dependent hevea brasiliensis high-altitude layering genetic transformation method, and relates to the technical field of plant genetic engineering. The method comprises the following steps: S1, providing an agrobacterium rhizogenes K599 bacterial solution containing a target gene, and loading the target gene in a pCAMBIA2301 vector; s2, preparing an infection material (infection liquid or lawn) by using the agrobacterium rhizogenes K599; s3, carrying out girdling treatment on stems of the rubber tree seedlings, and carrying out pretreatment on girdling wounds; s4, the pretreated girdling wound is infected with the infection material; s5, covering and mounting the girdling wound with a wet culture medium so as to keep the wound wet and incubate the strain; wherein the target gene is a GUS gene, an RUBY gene or a JcFT gene. The method can avoid a series of complicated operations such as tissue culture, and is simple, convenient, rapid, low in cost, not limited by seasons, easy to operate and independent of genotypes; particularly, by means of the method, the high positive rate can be obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of plant genetic engineering technology, and in particular to a non-tissue culture-dependent method for genetic transformation of rubber trees by air layering. Background Technology

[0002] rubber tree ( Hevea brasiliensis Natural rubber produced by rubber trees is a crucial industrial raw material and strategic resource. However, its traditional hybridization breeding cycle is as long as 30-50 years, making it difficult to efficiently aggregate superior traits such as high yield and stress resistance, which seriously restricts variety renewal. Modern molecular breeding methods, represented by transgenic technology, have made it possible to achieve precise control of the rubber tree genome and significantly shorten the breeding cycle, and are also a key approach to gene function identification.

[0003] Currently, the application of transgenic technology in rubber trees heavily relies on tissue culture systems. These systems are generally characterized by high costs, long cycles, and complex operations. Furthermore, the induction of callus tissue and somatic embryogenesis in rubber trees are strictly genotype-dependent. This situation means that stable genetic transformation systems can only be established in a few easily regenerated varieties. Key parental materials of important Chinese cultivars such as GT1 and Tianren 31-45, due to the difficulty in somatic embryogenesis, have yet to achieve efficient genetic transformation through tissue culture, becoming a significant bottleneck for the comprehensive application of molecular breeding technology.

[0004] To overcome this bottleneck, non-tissue culture-dependent genetic transformation methods have become an important research direction. For example, the patent CN119752983A, "A Non-Tissue Culture-Dependent Genetic Transformation Method for Rubber Tree Roots," successfully bypasses the complex tissue culture regeneration process by directly infecting rootless rubber seedlings with Agrobacterium rhizogenes, providing a new approach for genetic manipulation of difficult-to-transform varieties. However, this method still has significant limitations in practical applications: First, its high-efficiency transformation (positive rate up to 63.7%) is only under specific conditions for the GT1 variety; under other conditions, such as poor temperature and seedling age, the transformation rate drops sharply, lacking universality. Second, it uses rootless seedlings as explants, making material acquisition seasonally limited, and the transformed plants are weak and difficult to maintain, requiring improvement in technical stability and operability.

[0005] Therefore, developing an efficient non-tissue culture genetic transformation method that is not limited by season, is applicable to a wider range of rubber tree varieties, and can produce robust transformed plants is of urgent practical significance for accelerating the molecular breeding process of rubber trees, and is also a goal that has been continuously pursued in this field. Summary of the Invention

[0006] To address or partially address the problems existing in related technologies, this application provides a method for genetic transformation of rubber trees by air layering that is not dependent on tissue culture. This method enables genetic transformation of rubber trees without relying on tissue culture.

[0007] This application provides a tissue culture-independent method for genetic transformation of rubber trees by air layering, comprising the following steps: S1. Provide a culture of Agrobacterium rhizogenes K599 containing the target gene, wherein the target gene is loaded into the pCAMBIA2301 vector; S2. Prepare infection material using the Agrobacterium rhizogenes K599 bacterial suspension; S3. Perform girdling on the stems of rubber seedlings and pre-treat the girdling wounds to remove fresh latex secreted from the wounds; S4. Infect the pretreated girdled wound with the aforementioned infecting material; S5. Cover and wrap the girdled wound with a moist culture medium to keep the wound moist and incubate the inoculum; The target gene is either the GUS gene, the RUBY gene, or the JcFT gene.

[0008] Further, in step S2, the infection material is Agrobacterium rhizogenes K599 infection solution or Agrobacterium rhizogenes K599 bacterial moss.

[0009] Furthermore, the OD600 of the Agrobacterium rhizogenes K599 bacterial suspension is 0.4-0.8; the infection method is either the wrapping method or the injection method.

[0010] Furthermore, the OD600 of the Agrobacterium rhizogenes K599 bacterial suspension is 0.6-0.8; the infection method is injection.

[0011] Further, in step S3, the girdling treatment is as follows: a ring of phloem is removed from the stem at a height of 50 cm from the ground.

[0012] Furthermore, in step S3, the pretreatment includes wiping away the latex secreted from the girdling wound and then washing it.

[0013] Furthermore, the cleaning is performed using a mixed solution containing 5% sucrose and 30 mM CaCl2.

[0014] Furthermore, in step S5, the culture medium is manufactured soil.

[0015] Furthermore, in step S5, the culture medium is filled into an aerial pressure strip propagation box to cover and wrap the girdling wound.

[0016] Furthermore, the rubber tree seedling variety is GT1, PR107, or RRIM600.

[0017] The beneficial effects of this application are: 1. The method for constructing positive transgenic roots mediated by Agrobacterium rhizogenes under non-tissue culture conditions provided in this application, compared with conventional plant transgenic systems, bypasses a series of complex operations such as tissue culture, and is simple, rapid, low-cost, not limited by season, easy to operate, and independent of genotype. In particular, the method in this application can obtain a high positive rate. When the OD600 of Agrobacterium rhizogenes K599 bacterial solution is 0.4-0.8 and the inoculation method is used, the positive rate is above 57%; and when the OD600 of Agrobacterium rhizogenes K599 bacterial solution is 0.6-0.8 and the inoculation method is injection, the positive rate is also above 48%.

[0018] 2. This application utilizes Agrobacterium rhizogenes-mediated plant transgenic technology under non-tissue culture conditions, achieving a high instantaneous transformation rate and enabling stable genetic transformation of rubber tree roots. Transgenic rubber tree roots can be obtained within 1-2 months, facilitating research on genetic transformation of rubber trees. Attached Figure Description

[0019] The above and other objects, features and advantages of this application will become more apparent from the more detailed description of exemplary embodiments thereof in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments thereof.

[0020] Figure 1 This application illustrates a flowchart of the genetic transformation process of rubber trees under high-altitude air pressure. Figure 2 The PCR identification shown in this application GUS Schematic diagram of transgenic roots; the electrophoresis images from top to bottom are: DNA electrophoresis of regenerated hairy roots of rubber seedlings; PCR identification of the internal reference gene (HbActin), kanamycin resistance gene (Npt II), and... GUS Electrophoresis diagram of genes; Figure 3 This is the transformation shown in this application. JcFT Rubber tree roots with genetically modified genes and root plants with positive transgenic roots. Detailed Implementation

[0021] Embodiments of this application will now be described in more detail with reference to the accompanying drawings. While embodiments of this application are shown in the drawings, it should be understood that this application may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to make this application more thorough and complete, and to fully convey the scope of this application to those skilled in the art.

[0022] Experimental materials Plant materials: The rubber trees were obtained from rubber tree seedlings GT1, RRIM600 and PR107 in the greenhouse of Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences (21°41' N / 101°25' E, altitude 570 m).

[0023] Vector strain: The strain used in the experiment contained the target vector (pCAMBIA2301) and the target gene (35S: GUS 35S: RUBY , SUC2 : JcFT Agrobacterium rhizogenes K599, C58C1, and Ar.1193, along with their strains and plasmids, were preserved in the laboratory.

[0024] YEB medium: Beef extract 5 g·L -1 5 g / L of peptone -1 Yeast extract 1 g·L -1 MgSO4·7H2O 0.5 g·L -1 5 g·L sucrose -1 Dissolve in distilled water, adjust pH to 7.0, and add 15 g·L⁻¹ agar powder to the solid culture medium. -1 .

[0025] Example 1 Explant preparation: GT1, RRIM600 and PR107 rubber tree seeds were collected from Mengla Farm. Plump and undamaged seeds were selected and planted in sand pits. After covering with sand, the seeds were sprayed with a fungicide and watered twice a week. Once the rubber tree seedlings reached a height of 1 m and a stem diameter of 1 cm, they were then subjected to Agrobacterium infection.

[0026] Because rubber trees are rich in latex, wounds caused by physical damage secrete large amounts of natural rubber. Therefore, before Agrobacterium infection, the girdling wound must be pretreated to remove fresh latex. Specifically, the fresh latex in the girdling wound can be cleaned by wiping. After wiping, the wound should be washed for 10 minutes under osmotic pressure conditions with a solution containing 5% sucrose and 30 mM CaCl2. It should be noted that all subsequent embodiments in this application involve pretreatment of the girdling wound before infection, which will not be repeated hereafter.

[0027] Preparation of Agrobacterium rhizogenes K599, C58C1 or Ar.1193 bacterial culture: Preparation of Agrobacterium rhizogenes K599, C58C1, or Ar.1193 bacterial cultures: Agrobacterium K599, C58C1, or Ar.1193 cultures were removed from a -80℃ freezer and activated at 28℃ for 2 days. Single colonies were then picked and inoculated into YEB medium containing 100 mg / L kanamycin and spectinomycin, and incubated at 28℃ and 200 r·min. -1 After shaking culture for 12 h, 200 µL of bacterial culture was added to 50 mL of liquid culture medium containing antibiotics (100 mg / L kanamycin and spectinomycin), and incubated at 28 °C and 200 r·min. -1 After shaking culture for 8-12 h, Agrobacterium rhizogenes K599, C58C1, or Ar.1193 bacterial suspensions were prepared. The absorbance (OD) of the Agrobacterium rhizogenes K599 bacterial suspension was measured by aspirating 0.5 mL. 600 value; Preparation of Agrobacterium rhizogenes infection solution and Agrobacterium rhizogenes mycelial motility: Preparation of Agrobacterium rhizogenes K599, C58C1, or Ar.1193 infection solutions: Centrifuge Agrobacterium rhizogenes K599, C58C1, or Ar.1193 bacterial solutions at 8000×g, resuspend in 50 mL MS liquid medium, and add 100 μmol·L⁻¹ -1 Acetyleugenol, 100 mmol·L -1 Calcium chloride, 5 mg·L -1 6-BA, 50 mg·L -1 MES was used to prepare Agrobacterium rhizogenes K599, C58C1, or Ar.1193 infection solutions for injection infection.

[0028] Preparation of Agrobacterium rhizogenes K599 bacterial culture: Spread 2 ml of K599, C58C1 or Ar.1193 bacterial culture prepared by the above method evenly onto a resistance plate and incubate at 28℃ for 2 days to prepare Agrobacterium rhizogenes K599, C58C1 or Ar.1193 bacterial culture.

[0029] Experimental process 1) Detection of instantaneous conversion rate of different bacterial strains: On the trunk of a rubber tree, about 1 cm of phloem was removed by girdling at a depth of 50 cm from the ground. Then, samples containing the target gene 35S were applied. GUS The target vector pCAMBIA2301 Agrobacterium rhizogenes (OD) 600 =0.6) K599, C58C1, Ar.1193 infection solutions were injected to infect the upper wounds of girdled rubber tree seedlings. After infection, the seedlings were kept moist in a plant air-propagation box filled with moist machine-made soil and cultured for 3 days. Fifteen girdled rubber seedlings were randomly selected and then... GUSThe instantaneous conversion rate of the cut was measured, and the remaining rubber seedlings were cultured for 30 days. Rooting status and the proportion of plants with positive roots were then analyzed. The rubber seedlings with positive roots were then transplanted into potting soil for further phenotypic analysis. GUS The staining test determines whether the rooted seedlings turn blue.

[0030] use GUS Staining assays report transient gene transformation rate. Regenerated hairy roots were washed with sterile water and then placed... GUS Staining was performed at 37℃ for 6 hours in the staining solution, followed by destaining with 95% alcohol. Staining results were statistically analyzed, and staining intensity was rated. The instantaneous conversion rate was calculated, and optimal infection conditions were selected based on the GUS instantaneous conversion rate. The instantaneous conversion rate (%) was calculated as: (Number of explants with blue dots / Total number of stained explants) × 100. 2) Compare the instantaneous and stable conversion rates of different bacterial concentrations and infection methods. Using OD 600 The target vectors containing the 35S promoter were 0.4, 0.6, and 0.8 mg / L. , GUS Agrobacterium rhizogenes K599 mycelial moss, prepared from Agrobacterium rhizogenes K599 bacterial suspension (pCAMBIA2301 vector), was used for mycelial infection of girdled rubber tree seedlings (mycelial infection involves applying solid mycelial moss to the wound of the girdled rubber tree); OD was used 600 The target vectors containing the 35S promoter were 0.4, 0.6, and 0.8 mg / L. , GUS After preparing Agrobacterium rhizogenes K599 infection solution using the pCAMBIA2301 vector, infection was carried out via injection (the bacterial solution was drawn into a syringe, the needle was inserted into the tissue near the cambium layer of the plant, and then the bacterial solution was injected). After 3 days of co-culture, 15 plants were randomly selected, and the infected parts were excised and... GUS Staining compares infection efficiency, through GUS The instantaneous conversion rate of the cut was measured. The remaining plants were further cultured in a high-pressure propagation box under humidity, with each experiment containing 40 seedlings, repeated three times. Rooting rate was recorded after 30 days; after 45 days, 15 long-rooted rubber seedlings were randomly selected for observation, and root tips were taken for further analysis. GUS Staining was performed to determine the positive rate of transgenic roots.

[0031] Rubber seedlings with positive roots identified by PCR were transplanted into potting soil for further phenotypic analysis. GUS staining was used to determine whether the rooted seedlings showed a blue color.

[0032] The stable transformation rate of the reporter gene was detected using GUS staining, as shown in the following steps.

[0033] Identification of positive roots: Use a target vector (containing a 35S promoter), GUS After explants were infected with Agrobacterium rhizogenes K599 using the pCAMBIA2301 vector of the gene and cultured for 30 days, all materials produced a large number of hairy roots. Genomic DNA was extracted from the hairy roots for PCR identification. The method steps were as follows: regenerated hairy roots were collected, and genomic DNA was extracted using the CTAB method; wild-type rubber hairy roots were used as a negative control, and previously obtained transformations were used... GUS The rubber material containing the gene served as a positive control for PCR amplification. The PCR amplification system consisted of 10 µL Taq PCR Master Mix, 0.5 µL DNA template, 0.5 µL each of primers XD626 and XD627, and ddH2O to a final volume of 20 µL. The amplification conditions were as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; followed by a final extension at 72℃ for 8 min. PCR results were detected by 1% agarose gel electrophoresis.

[0034] Experimental results: 1) The conversion rates of different strains were compared, and the experimental results are shown in Table 1.

[0035] Table 1. Comparison of conversion rates of different bacterial strains Note: Each group was repeated three times, with 40 seedlings per repeat. 15 seedlings were used to analyze the instantaneous conversion rate, and 15 seedlings were used to analyze the stable conversion rate. The fungal infection method was used, and all rubber trees used were of the GT1 variety.

[0036] Using the target vector (containing the 35S promoter) respectively , GUS Three Agrobacterium rhizogenes infection solutions (K599, C58C1, and Ar.1193) containing the pCAMBIA2301 vector were used to infect wounds of rubber tree seedlings. After 60 days of culture, the rooting status of hairy roots and the number of positive roots were counted. Figure 1 The results showed that under all infection conditions, the transient expression efficiency of strain K599 was higher than that of C58C1 and Ar.1193 (Table 1), and the transient transformation rate of strain K599 was the highest, reaching 92.45%, with the highest positive rate of regenerated roots, reaching 62.2%. Therefore, strain K599 is suitable for the genetic transformation of rubber seedlings.

[0037] 2) The instantaneous and stable conversion rates of different bacterial concentrations and infection methods are shown in the following experimental results.

[0038] The instantaneous conversion rates for different bacterial concentrations and infection methods are shown in Table 2.

[0039] Table 2 compares the instantaneous conversion efficiency of bacterial cultures with different concentrations. Note: All bacterial cultures used were K599, all rubber trees were GT1 variety, and each sample consisted of 40 trees. Lowercase letters after the data indicate significant differences. P (≤0.05), the value after ± is the standard deviation of 3 repeated trials.

[0040] As shown in Table 2, the instantaneous conversion rate of the inoculated bacterial culture was independent of the concentration of the bacterial culture, ranging from 83.33% to 91.67% (Table 2); the OD500 of the bacterial culture concentration was... 600 When the concentration of the bacterial solution was 0.8, the instantaneous conversion rate of injection infection was the highest, reaching 88.67% (Table 2), which was slightly lower than that of wrapped bacterial infection. The instantaneous conversion rate of injection infection increased with the increase of bacterial concentration.

[0041] The stable conversion rates of different bacterial concentrations and infection methods are shown in Table 3.

[0042] Table 3 Stable conversion rates of different infection pathways Note: K599 was used as the infection host, and all rubber trees used were of the GT1 variety. Each group was replicated three times, with 30 rubber seedlings per replicate. As shown in Table 3, the average number of roots of the plate mycelium prepared by different concentrations of bacterial solution did not differ significantly after mycelium wrapping infection. The positive rate after mycelium wrapping infection was high and stable, indicating that the mycelium wrapping method is the best option for infecting girdled rubber (Table 3).

[0043] 3) The conversion rates of different rubber tree varieties were compared, and the experimental results are shown in the table below.

[0044] Table 4. Comparison of conversion rates of different rubber tree varieties Note: K599 was used as the infection host, the bacterial concentration OD600=0.6, each group was repeated three times, with 40 seedlings in each replicate. 15 seedlings were used to analyze the transient conversion rate, and 15 seedlings were used to analyze the stable conversion rate. The inoculation method was used for all experiments.

[0045] Table 4 shows that there are no significant differences in transient expression efficiency and stable transformation efficiency among different rubber tree varieties after inoculation with the layering fungus, indicating that the layering transformation method is independent of the rubber tree variety.

[0046] In addition, the applicant also found that the positive rate was slightly lower than that of other groups in the applicant's previous exploratory experiments when exploring the conversion rate of different rubber tree varieties. The possible reason is that the experiment in this group was conducted in winter, while the experiments in other groups were conducted in spring or summer. The above results indicate that the positive rate may be related to the season.

[0047] Example 2: Obtaining the transformation reporter geneRUBY and functional genes JcFT Transgenic hairy roots Carry 35S:RUBY and SUC2: JcFT Agrobacterium rhizogenes K599 bacterial moss was used to infect girdled rubber tree seedlings, and positive roots were identified after 30 days of high-pressure propagation and moist cultivation.

[0048] After 30 days of cultivation, it was found 35S:RUBY The infected plants grew red hairy roots. Figure 2 This indicates that the expression was obtained. RUBY Transgenic root of reporter gene.

[0049] After 30 days of culture, carriers were extracted. SUC2:JcFT Genomic DNA from regenerated roots infected with strain K599 was identified by PCR. JcFT Genes. The specific steps are as follows: Take regenerated roots and extract genomic DNA using the CTAB method; use wild-type rubber roots as a negative control, containing... GUS and JcFT The gene plasmid was used as a positive control for PCR amplification. Identification. JcFT Forward primer XD626: TCGTGTGATTGGGGATGTTTTA; Reverse primer XD627: TGGTGGATACACGGT CTGCCTT; Rubber tree internal reference gene. HbActin Forward primer XG209: CATTTATGCGGATGGAAGCA, reverse primer XG210: CAGGGGAGTTTGGATTTGGA; GUS Forward primer XD67: GCTTTTGACACCTTAACTAGAGCG, reverse primer XD68: ATTATGCGGGGTTGCAGACC. PCR amplification system: 10 µL Taq PCR Master Mix, 1.0 µL DNA template, 0.5 µL each of primers XD626 and XD627, and ddH2O to a final volume of 20 µL. Amplification conditions were as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 8 min. PCR results were detected by 1% agarose gel electrophoresis. Experimental results: According to the 1% agarose gel electrophoresis image, plants numbered 1, 3, 4, 6, 8, 10, 11, 12, and 14 were found to have positive transgenic roots. Figure 3 Other plants did not contain positive transgenic roots, and their positive conversion rate was 9 / 14=64.3%.

[0050] The following conclusions were drawn based on the research findings; (1) All three types of Agrobacterium rhizogenes, K599, C58C1 and Ar.1193, can successfully infect the trunk of girdled rubber trees. Among them, K599 has the highest transient conversion rate and stable conversion rate.

[0051] (2) Among the two infection methods, wrap-in infection and injection infection, the transient and stable transformation efficiencies of wrap-in infection are higher than those of injection infection.

[0052] (3) The transformation reporter gene was obtained by Agrobacterium rhizogenes-mediated inoculum infection method. RUBY and functional genes JcFT Genetically modified rubber tree roots.

[0053] In summary, this study successfully established a *Agrobacterium rhizogenes*-mediated genetic transformation method for rubber tree hairy roots that is independent of tissue culture and variety. The effects of different strains, infection methods, and varieties on the genetic transformation efficiency of rubber trees were systematically explored, and rubber tree roots containing reporter genes and functional genes were obtained. Using this transformation method, transgenic rubber tree roots can be obtained within 1-2 months. Future integration with gene editing, RNAi, and other technologies will enable rapid research on rubber tree gene function, and combining this with morphogenetic gene-assisted strategies holds promise for achieving whole-tree genetic transformation of rubber trees.

[0054] The various embodiments of this application have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or improvement of the technology in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A non-tissue culture-dependent method for genetic transformation of rubber trees by air layering, characterized in that, Includes the following steps: S1. Provide a culture of Agrobacterium rhizogenes K599 containing the target gene, wherein the target gene is loaded into the pCAMBIA2301 vector; S2. Prepare infection material using the Agrobacterium rhizogenes K599 bacterial suspension; S3. Perform girdling on the stems of rubber seedlings and pre-treat the girdling wounds to remove fresh latex secreted from the wounds; S4. Infect the pretreated girdled wound with the aforementioned infecting material; S5. Cover and wrap the girdled wound with a moist culture medium to keep the wound moist and incubate the inoculum; The target gene is either the GUS gene, the RUBY gene, or the JcFT gene.

2. The method according to claim 1, characterized in that, In step S2, the infection material is Agrobacterium rhizogenes K599 infection solution or Agrobacterium rhizogenes K599 bacterial moss.

3. The method according to claim 1, characterized in that, The OD600 of the Agrobacterium rhizogenes K599 bacterial suspension was 0.4-0.8; the infection methods were the wrapping method or the injection method.

4. The method according to claim 1, characterized in that, The OD600 of the Agrobacterium rhizogenes K599 bacterial suspension is 0.6-0.8; the infection method is injection.

5. The method according to claim 1, characterized in that, In step S3, the girdling process is as follows: a ring of phloem is removed from the stem at a height of 50cm from the ground.

6. The method according to claim 1, characterized in that, In step S3, the pretreatment includes wiping away the latex secreted from the girdling wound and then washing it.

7. The method according to claim 6, characterized in that, The cleaning was performed using a mixed solution containing 5% sucrose and 30 mM CaCl2.

8. The method according to claim 1, characterized in that, In step S5, the culture medium is manufactured soil.

9. The method according to claim 1, characterized in that, In step S5, the culture medium is filled into an air pressure strip propagation box to cover and wrap the girdling wound.

10. The method according to any one of claims 1 to 9, characterized in that, The rubber tree seedlings are of the GT1, PR107 or RRIM600 varieties.

Citation Information

Patent Citations

  • Tissue culture-dependent hevea brasiliensis root genetic transformation method

    CN119752983A