Method for improving soybean genetic transformation efficiency based on glyphosate screening system

Abstract

The invention discloses a method for improving soybean genetic transformation efficiency based on a glyphosate screening system, which is characterized in that aromatic amino acid with proper concentration is added in an elongation stage for the first time to remarkably improve the soybean genetic transformation efficiency with glyphosate as a screening marker, and the transformation efficiency is improved by more than 8%. Meanwhile, compared with a common transformation technology system taking glufosinate-ammonium as a selection marker, the non-chimera proportion and the positive rate proportion are improved by 50% or above.

Description

(I) Technical Field

[0001] This invention belongs to the field of plant genetic transformation and relates to a method for improving the efficiency of soybean genetic transformation based on a glyphosate screening system. (II) Background Technology

[0002] Soybean is a globally important dual-purpose crop for both oil and protein. Improving soybean's stress resistance, quality, and yield through genetic transformation technology is one of the core directions of modern agricultural biotechnology research. Currently, the mainstream technology for soybean genetic transformation is the Agrobacterium-mediated cotyledon / hypocotyl transformation system. However, this technology still suffers from key problems such as low transformation efficiency, long regeneration cycle, and insufficient resistant shoot elongation rate, which seriously restrict the industrial application of soybean gene editing and transgenic breeding.

[0003] Glyphosate, the most commonly used screening agent in soybean genetic transformation (relying on the glyphosate-resistant EPSPS gene as a selection marker), works by inhibiting the activity of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in the shikimic acid pathway, thereby blocking the endogenous synthesis of three aromatic amino acids: tryptophan, phenylalanine, and tyrosine. In actual transformation operations, while glyphosate effectively eliminates untransformed cells during the selection phase, it can also cause "sublethal damage" to resistant transformed cells: even if transformed cells carry the glyphosate-resistant gene, their shikimic acid pathway is still slightly inhibited by glyphosate, leading to a decrease in the efficiency of aromatic amino acid synthesis.

[0004] Aromatic amino acids are essential nutrients for soybean cell division and shoot elongation, and are also precursors for the synthesis of key metabolites such as auxin (IAA, with tryptophan as a direct precursor), lignin, and phenolic antioxidants. During the shoot elongation stage after the screening phase, transformed shoots often exhibit slow elongation rates, high browning rates, and low survival rates due to a deficiency of endogenous aromatic amino acids. This has become a core bottleneck restricting the transition of soybean genetic transformation from "resistance screening" to "obtaining regenerated seedlings." Current technologies have not specifically addressed this issue, resulting in soybean transformation efficiency generally below 10%, far lower than crops such as corn and rice.

[0005] Currently, the optimization of the elongation stage in existing soybean genetic transformation technology schemes mainly focuses on hormone ratios (such as adjusting the ratio of auxin / cytokinin), optimizing the salt concentration of the culture medium, and regulating the culture environment (light / temperature). No research has yet focused on the specific problem of "deficiency of aromatic amino acids after glyphosate screening": (1) Conventional elongation culture medium only contains basic nitrogen sources (such as nitrate nitrogen and ammonium nitrogen), which cannot directly supplement the aromatic amino acids that plants cannot synthesize quickly, and it is difficult to alleviate the inhibitory effect of glyphosate on the shikimic acid pathway; (2) Some studies have tried to completely remove glyphosate during the elongation stage to reduce damage, but this can easily lead to the "escape" of untransformed cells and reduce the purity of resistant shoots; (3) A few studies have blindly added amino acid mixtures without optimizing the types and concentrations of aromatic amino acids for the transformation characteristics of soybeans. Either the concentration is too low and there is no effect, or the concentration is too high and produces amino acid toxicity, which inhibits shoot elongation.

[0006] Therefore, there is an urgent need to develop a soybean genetic transformation optimization technology adapted to the glyphosate screening system. By precisely adding a specific concentration of aromatic amino acids during the elongation stage to compensate for insufficient endogenous synthesis, while taking into account the continuous screening effect of glyphosate, the elongation efficiency and survival rate of resistant shoots can be improved, and an efficient and stable soybean genetic transformation technology system can be constructed. (III) Summary of the Invention

[0007] The purpose of this invention is to provide a method for improving the efficiency of soybean genetic transformation based on a glyphosate screening system. This invention, based on a glyphosate screening system, utilizes a soybean genetic transformation technology that precisely adds a specific concentration of aromatic amino acids during the elongation stage to compensate for the inhibitory effect of glyphosate on the shikimic acid pathway, significantly improving soybean genetic transformation efficiency, reducing the proportion of chimeras, and increasing the positive plant rate. This addresses the technical challenges of existing soybean genetic transformation technologies using glyphosate as a screening agent, such as low transformation efficiency, high chimera proportion, and low positive plant rate due to insufficient endogenous synthesis of aromatic amino acids during the elongation stage.

[0008] The technical solution adopted in this invention is:

[0009] This invention provides a method for improving the efficiency of soybean genetic transformation based on a glyphosate screening system. The method involves adding aromatic amino acids to the shoot elongation culture medium during the shoot elongation culture stage of soybean genetic transformation mediated by Agrobacterium using glyphosate as a screening agent, thereby improving the efficiency of soybean genetic transformation. The aromatic amino acids include tryptophan, phenylalanine, and tyrosine, with a final addition concentration of 300-600 μmol / L for each.

[0010] Furthermore, the aromatic amino acid is composed of 400-600 μmol / L tryptophan, 300-500 μmol / L phenylalanine, and 300-500 μmol / L tyrosine, and the concentration is the final concentration added to the shoot elongation medium.

[0011] Furthermore, the aromatic amino acid is composed of 500 μmol / L tryptophan, 400 μmol / L phenylalanine, and 400 μmol / L tyrosine.

[0012] Furthermore, the soybeans include grain soybeans and fresh soybeans.

[0013] Furthermore, the varieties of grain soybeans mentioned include, but are not limited to, Tianlong No. 1, William 82, and Zhongdou 43; the varieties of fresh soybeans include, but are not limited to, Zhexian No. 8, Huning 95-1, and Nannong 30.

[0014] Furthermore, the final concentration composition of the shoot elongation medium is as follows: MS basal salt mixture (PhytoTech, catalog number M524) 4.33 g / L, 2-morpholine ethanesulfonic acid (MES) 1.0 g / L, sucrose 30 g / L, iron salt solution 3.5 mL / L (2.6 g EDTA-FeNa dissolved in deionized water, adjusted to 200 mL), L-glutamine (L-Gln) 75 mg / L, L-aspartic acid (L-Asp) 75 mg / L, vitamin B5 (PhytoTech, catalog number G219) 1 mL / L, zeatin riboside (ZR) 1 mg / L, termetin 400 mg / L, gibberellin (GA3) 0.2 mg / L, indoleacetic acid (IAA) 0.1 mg / L, and glyphosate screening agent 10 g / L. mg / L, 7.5 g / L agar, solvent is deionized water, pH is 5.6; ZR, Timentin, GA3, IAA and glyphosate are added after sterilization.

[0015] Furthermore, the soybean genetic transformation method uses a glyphosate-tolerant gene as a selection marker gene and glyphosate as a selection agent.

[0016] Furthermore, the glyphosate-resistant gene is selected from one of the following: OsmEPSPS gene (amino acid sequence as shown in SEQ ID NO.2), GAT gene (amino acid sequence as shown in SEQ ID NO.3), GOX gene (amino acid sequence as shown in SEQ ID NO.4), G10 gene (amino acid sequence as shown in SEQ ID NO.5), and CP4 gene (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.6, 1536-2927 bp); preferably, cp4 is used as the screening marker gene.

[0017] Furthermore, the soybean genetic transformation is carried out according to the following steps:

[0018] (1) Sterilization: Select healthy, plump, and mature soybeans and place them in a desiccator filled with chlorine gas (generated by the reaction of 50ml 30% NaClO and 2ml concentrated HCl) for 16 hours for sterilization;

[0019] (2) Germination: After sterilization, soybeans were sown into germination medium in a clean bench and cultured at 25°C for 1 day; the bean sprouts with the hypocotyl removed were cut in half lengthwise so that both explants had cotyledons and epicotyls; the explants were cut at the nodes of the cotyledons and epicotyls in about 3-5 places; the final concentration of the germination medium was: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, sucrose 30 g / L, plant gel (Gelzan) 3.2 g / L, solvent was deionized water, pH 5.8;

[0020] (3) Infection: The prepared explants were immersed in Agrobacterium bacterial suspension (OD600 of 0.6) containing the target gene (such as the selection marker gene CP4) and co-cultured at 28°C for 10-30 minutes; then, the excess bacterial suspension on the explants was absorbed with absorbent paper and then transferred to CCM medium and incubated in the dark at 22°C for 3-5 days; the final concentration of CCM medium was: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, 2-morpholine ethanesulfonic acid (MES) 2.5 g / L, sucrose 20 g / L, glucose 10 g / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, acetylsuccinone (AS) 80 mg / L, dithiothreitol (DTT) 300 mg / L, solvent was deionized water, pH 5.4; AS and DTT were added in the form of 40 mg / mL and 150 mg / mL aqueous solutions, respectively;

[0021] (4) Recovery: The explants cultured in step (3) were transferred to the recovery medium and cultured at 26℃ for 7 days, with 16 h of light and 8 h of darkness per day; the final concentration of the recovery medium was as follows: B5 basal medium (PhytoTech, G398) 3.21 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution (2.6 g EDTA-FeNa dissolved in deionized water and brought to 200 mL) 4 mL / L, L-glutamine (L-Gln) 125 mg / L, L-aspartic acid (L-Asp) 125 mg / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, agar 6.8 g / L, zeatin riboside (ZR) 2 mg / L, termethin 400 mg / L, with deionized water as the solvent and pH 5.6; ZR and termethin were added before pouring the plates;

[0022] (5) Screening: After co-culturing in step (4), the explants were transferred to a screening medium containing 20 mg / L glyphosate (Sigma) and cultured at 26°C for 21 weeks under light (16 h light / 8 h dark) per day, with the medium being changed every two weeks. The final concentration of the screening medium consisted of: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution (2.6 g EDTA-FeNa dissolved in deionized water and brought to a final volume of 200 mL) 4 mL / L, L-Gln 125 mg / L, L-Asp 125 mg / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, agar 6.8 g / L, 6-benzyladenine (6-BA) 1 mg / L, termethin 400 mg / L, and glyphosate 20 mg / L. mg / L, solvent is deionized water, pH is 5.6;

[0023] (6) Elongation: The embryonic tissues selected in step (5) are then transferred to a sprout elongation medium supplemented with aromatic amino acids and cultured at 26°C until they grow into seedlings;

[0024] (7) Transplanting: Subsequently, the plants were directly transplanted into sterile nutrient soil and moisturized. After being cultivated for one month at a temperature of 26℃, a humidity of 80%, and a light-to-dark ratio of 16 h / 8 h per day, the small plants were cleaned to remove the agar and then planted in a greenhouse.

[0025] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0026] This invention, for the first time, significantly improves the genetic transformation efficiency of soybeans using glyphosate as a selection marker by adding an appropriate concentration of aromatic amino acids during the elongation stage, increasing the transformation efficiency by more than 8%. Simultaneously, compared with commonly used transformation technologies using glufosinate as a selection marker, the proportion of non-chimeras and the positive rate are increased by more than 50%. (iv) Description of the attached drawings

[0027] Figure 1 A schematic diagram of the soybean genetic transformation process.

[0028] Figure 2 Schematic diagram of the transformation vector structure. EGFP, enhanced green fluorescent protein GFP expression cassette; cp4 / bar, either the glyphosate resistance gene cp4 expression cassette or the glufosinate resistance gene bar expression cassette. (V) Detailed Implementation Methods

[0029] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0030] The molecular biology and biochemical methods used in the following embodiments of the present invention are all known techniques. They are described in detail in references such as Current Protocols in Molecular Biology, written by Ausubel and published by John Wiley and Sons, and Molecular Cloning: A Labortory Manual, 3rd ed., written by J. Sambrook et al., published by Cold Spring Harbor Laboratory Press (2001).

[0031] Description of the sequence of embodiments of the present invention:

[0032] SEQ ID NO.1 represents the sequence of the protein encoded by the CP4 gene; SEQ ID NO.2 represents the sequence of the protein encoded by the glyphosate resistance gene OsmEGFP; SEQ ID NO.3 represents the amino acid sequence of the glyphosate resistance gene GAT; SEQ ID NO.4 represents the amino acid sequence of the glyphosate resistance gene GOX; SEQ ID NO.5 represents the amino acid sequence of the glyphosate resistance gene G10; SEQ ID NO.6 represents the nucleotide sequence of the CP4 expression frame, where 1-1637 bp represents the Arabidopsis thaliana UBI10 promoter and 1638-2927 bp represents the CP4 gene; SEQ ID NO.7 represents the nucleotide sequence of the EGFP expression frame, where 1-880 bp represents the P35S promoter, 881-1621 bp represents the EGFP gene, and 1622-1893 bp represents the Tnos terminator; SEQ ID NO.8 represents the bar sequence of the glufosinate resistance gene.

[0033] Example 1: Construction of the transformation vector

[0034] 1. Construction of the transition carrier 1300-AC

[0035] The glyphosate-resistant gene can be any one of the following: OsmEPSPS gene (SEQ ID NO.2), GAT gene (SEQ ID NO.3), GOX gene (SEQ ID NO.4), G10 gene (SEQ ID NO.5), or CP4 gene (1536-2927 bp in SEQ ID NO.6). Taking the CP4 gene as an example, the transition vector is constructed according to the following steps.

[0036] (1) To construct the test vector, a glyphosate-resistant gene CP4 expression cassette (SEQ ID NO.6) containing the Arabidopsis thaliana UBI10 promoter and the CP4 gene (amino acid sequence as shown in SEQ ID NO.1) was artificially synthesized (Kangwei Century Company). The CP4 expression cassette was inserted between positions 273 and 274 of the vector pCambia1300 (NCBI sequence number GI:7638066) to artificially synthesize a plasmid containing the CP4 expression cassette.

[0037] (2) In order to construct a binary vector, pCambia1300 was double-digested with restriction endonucleases HindIII and XhoI, and the digested vector was recovered.

[0038] (3) Using the DNA of the plasmid containing the CP4 expression frame in step (1) as a template, primers ACF (5' GTAAAACGACGGCCAGTGCCAAAGCTTAAGGGACTAAAGCCTCCAC) and ACR (5' CACACATTATTATGGAGAAACTCGAGTTATCAAGCAGCCTTAGTATCAG) were used to amplify the fragment by PCR and obtain a fragment of about 3.0 kb in size, which was then recovered by electrophoresis.

[0039] (4) The two fragments from steps (2) and (3) above are connected by homologous recombination (Uniclone OneStep SeamlessCloning Kit, SC612, Jinsha Biotechnology) to obtain the transition vector 1300-AC.

[0040] 2. Construction of the final vector 1300-AC-GFP

[0041] (1) In order to construct a binary vector for co-expression of CP4 gene and green fluorescent protein GFP to facilitate the identification of positive rate, 1300-AC was digested with restriction endonuclease HindIII and the digested vector was recovered.

[0042] (2) An artificially synthesized (Kangwei Century Company) color-coded EGFP expression frame (SEQ ID NO.7) containing the P35S promoter, the EGFP gene (amino acid sequence as shown in SEQ ID NO.2), and the Tnos terminator. The EGFP expression frame was inserted between positions 273 and 274 of the vector pCambia1300 (NCBI sequence number GI:7638066) to artificially synthesize a plasmid containing the EGFP expression frame.

[0043] (3) Using plasmid DNA containing artificially synthesized EGFP expression frame as a template, primers PGF (5' GTAAAACGACGGCCAGTGCCATGCCTGCAGGTCCCCAG) and PGR (5' GTGGAGGCTTTAGTCCCTTAAGCTTGATCTAGTAACATAGATGACACC) were used to amplify the fragment by PCR and obtain a fragment of about 2.0 kb in size, which was then recovered by electrophoresis.

[0044] (4) The two fragments from steps (1) and (3) above are ligated using homologous recombination (Uniclone One Step Seamless Cloning Kit, SC612, Jinsha Biotechnology) to obtain the transition vector 1300-AC-GFP.

[0045] 3. Construction of the final vector 1300-PB-GFP

[0046] (1) As a control, a binary vector using the glufosinate resistance gene bar as a selection marker was constructed. The glufosinate resistance gene bar (nucleotide sequence as shown in SEQ ID NO.8) was artificially synthesized (Kangwei Century Company). XhoI restriction sites were designed at the 5' and 3' ends, respectively. The vector was inserted into the pCambia1300 restriction endonuclease digested with XhoI and ligated with T4 ligase (Thermo, EL0051) to obtain the transition vector 1300-PB. 1300-PB was digested with restriction endonucleases HindIII and EcoRI, and the digested vector was recovered.

[0047] (2) Using the plasmid DNA containing the artificially synthesized EGFP expression frame as a template, primers PG2F (5' GTAAAACGACGGCCAGTGCCATGCCTGCAGGTCCCCAGATTAG) and PG2R (5' AACAGCTATGACATGATTACGAATTCGATCTAGTAACATAGATGACACC) were used to amplify the fragment by PCR and then digested with enzymes to recover it.

[0048] (3) The two fragments from steps (1) and (2) above are ligated using homologous recombination (Uniclone One Step Seamless Cloning Kit, SC612, Jinsha Biotechnology) to obtain the transition vector 1300-PB-GFP.

[0049] Example 2: Agrobacterium-mediated transformation

[0050] The vectors 1300-AC-GFP and 1300-PB-GFP constructed in Example 1 were transformed into Agrobacterium EHA105 using the heat shock method. The transformed organisms were then inoculated into YEP solid medium (10 g / L peptone, 10 g / L yeast extract, 5 g / L NaCl, 15 g / L agar, deionized water as solvent, pH adjusted to 7.0, sterilized at 121℃ for 20 min, and kanamycin at a concentration of 50 μg / mL was added after sterilization). The medium was cultured at 28℃, and positive transformants were screened. Single colonies were then picked and inoculated into YEP liquid medium (10 g / L peptone, 10 g / L yeast extract, 5 g / L NaCl, deionized water as solvent, pH adjusted to 7.0, sterilized at 121℃ for 20 min, and kanamycin at a concentration of 50 μg / mL was added after sterilization). The medium was cultured at 28℃ until the OD600 reached 0.6, yielding Agrobacterium culture, which was used for subsequent soybean genetic transformation.

[0051] Example 3: Soybean genetic transformation

[0052] The genetically modified soybeans used here are derived from optimized versions of existing technologies. The specific process is as follows: Figure 1 As shown (Deng et al., 1998, Plant Physiology Communications 34: 381-387; Ma et al., 2008, Scientia AgriculturaSinica 41: 661-668; Zhou et al., 2001, Journal of Northeast Agricultural University 32: 313-319).

[0053] (1) Sterilization: Select healthy, plump and mature "William 82" and "Tianlong No. 1" soybeans and place them in a desiccator filled with chlorine gas (generated by the reaction of 50mL 30% NaClO and 2mL concentrated HCl) for 16 hours for sterilization.

[0054] (2) Germination: After sterilization, soybeans were sown into germination medium in a clean bench and cultured at 25°C for 1 day. The bean sprouts with the hypocotyl removed were cut in half lengthwise, so that both explants had cotyledons and epicotyls. The explants were cut at the nodes of the cotyledons and epicotyls in about 3-5 places, which could then be used as the target tissue for infection. The final concentration of the germination medium was: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, sucrose 30 g / L, plant gel (Gelzan) 3.2 g / L, solvent: deionized water, pH 5.8.

[0055] (3) Infection: The prepared explants were immersed in Agrobacterium bacterial suspension (OD600 of 0.6) containing the target gene (such as the selection marker gene CP4) and co-cultured at 28°C for 10-30 minutes; then, the excess bacterial suspension on the explants was absorbed with absorbent paper and then transferred to CCM medium and incubated in the dark at 22°C for 3-5 days; the final concentration of CCM medium was: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, 2-morpholine ethanesulfonic acid (MES) 2.5 g / L, sucrose 20 g / L, glucose 10 g / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, acetylsuccinone (AS) 80 mg / L, dithiothreitol (DTT) 300 mg / L, the solvent was deionized water, and the pH was 5.4; AS and DTT were added in the form of 40 mg / mL and 150 mg / mL aqueous solutions, respectively.

[0056] (4) Recovery: The explants cultured in step (3) were transferred to the recovery medium and cultured at 26℃ for 7 days, with 16h of light and 8h of darkness per day; the final concentration of the recovery medium was as follows: B5 basal medium (PhytoTech, G398) 3.21 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution (2.6 g EDTA-FeNa dissolved in deionized water and brought to 200 mL) 4 mL / L, L-glutamine (L-Gln) 125 mg / L, L-aspartic acid (L-Asp) 125 mg / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, agar 6.8 g / L, zeatin riboside (ZR) 2 mg / L, termethin 400 mg / L, with deionized water as the solvent and pH 5.6; ZR and termethin were added before pouring the plates.

[0057] (5) Screening: After co-culturing in step (4), the explants were transferred to a screening medium containing 20 mg / L glyphosate (Sigma) and cultured at 26°C for 21 weeks under light (16 h light / 8 h dark) per day, with the medium being changed every two weeks. The final concentration of the screening medium consisted of: B5 basal medium (PhytoTech, catalog number G398) 3.21 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution (2.6 g EDTA-FeNa dissolved in deionized water and brought to a final volume of 200 mL) 4 mL / L, L-Gln 125 mg / L, L-Asp 125 mg / L, B5 vitamin (PhytoTech, catalog number G219) 1 mL / L, agar 6.8 g / L, 6-benzyladenine (6-BA) 1 mg / L, termethin 400 mg / L, and glyphosate 20 mg / L. mg / L, solvent is deionized water, pH is 5.6.

[0058] (6) Elongation: The embryonic tissues selected in step (5) are then transferred to a sprout elongation medium containing aromatic amino acids from different treatments in Table 1 (e.g., treatment A, with 400 μmol / L tryptophan, 300 μmol / L phenylalanine, and 300 μmol / L tyrosine added, with 3 replicates for each treatment). The medium is then cultured at 26°C until the sprouts grow into seedlings. The final concentration of the shoot elongation medium consisted of: MS basal salt mixture (PhytoTech, catalog number M524) 4.33 g / L, MES 1.0 g / L, sucrose 30 g / L, iron salt solution 3.5 mL / L (2.6 g EDTA-FeNa dissolved in deionized water, brought to a final volume of 200 mL), L-Gln 75 mg / L, L-Asp 75 mg / L, vitamin B5 (PhytoTech, catalog number G219) 1 mL / L, zeatin riboside (ZR) 1 mg / L, timentin 400 mg / L, gibberellin (GA3) 0.2 mg / L, indoleacetic acid (IAA) 0.1 mg / L, and glyphosate screening agent 10 mg / L, in 7.5 g / L agar, with deionized water as the solvent and a pH of 5.6. ZR, timentin, GA3, IAA, and glyphosate were added after sterilization.

[0059] (7) Transplanting: Subsequently, the plants were directly transplanted into sterile nutrient soil and kept moist. After being cultured for one month at a temperature of 26℃, a humidity of 80%, and a light-to-dark ratio of 16 h / 8 h per day, the small plants were cleaned to remove the agar and then planted in a greenhouse.

[0060] The culture media G398, G219, MES, and AS were all purchased from PhytoTech.

[0061] Table 1. Concentration of Aromatic Amino Acids

[0062]

[0063] Example 4: Conversion Efficiency Identification

[0064] To compare the genetic transformation efficiency of soybean after adding different concentrations of aromatic amino acids in Example 3, GFP and PCR identification were performed on all T0 generation plants of the obtained 1300-AC-GFP vector to determine the proportion of positive seedlings. The results are shown in Table 2.

[0065] GFP identification: Leaves from T0 generation plants were taken and detected using a fluorescence microscope.

[0066] PCR identification: Leaves from T0 generation plants were collected and PCR detection was performed using primers (GFPCF: 5'CGTAAACGGCCACAAGTTCAGCGTG; GFPCR: GATCTTGAAGTTCACCTTGATGCCGTTC).

[0067] The results showed that treatment B had the highest transformation efficiency (18.1 ± 2.96%), followed by treatment A (13.2 ± 1.11%). Therefore, adding 500 μmol / L tryptophan, 400 μmol / L phenylalanine, and 400 μmol / L tyrosine to the shoot elongation medium significantly improved the genetic transformation efficiency of soybean, increasing it from 10% in the control to approximately 18%. However, excessive addition of aromatic amino acids significantly reduced the transformation efficiency.

[0068] Table 2. Soybean conversion efficiency with different concentrations of aromatic amino acids.

[0069]

[0070] Note: The number of explants for each transformation treatment was uniformly 100. Data are calculated using three replicates plus or minus the standard deviation; #Transformation efficiency is the ratio of PCR-positive seedlings to explants.

[0071] Example 5: Identification of chimerism rate and positive rate

[0072] Currently, commercial genetic transformation services primarily use the bar gene as a selection marker and glufosinate as a selection agent. To compare the chimerism rate and positivity rate of transgenic progeny using the bar gene and CP4 gene as marker genes, PCR identification was performed on 80 T0 generation seedlings of 1300-AC-GFP and 1300-PB-GFP, respectively. The results are shown in Table 3. The results indicate that the method of this invention can significantly improve the positivity rate and non-chimeric proportion of transgenic soybeans. The positivity rate can be increased from approximately 44% to approximately 95%, and the chimeric proportion can be decreased from approximately 43% to approximately 8%.

[0073] Table 3. Soybean conversion efficiency with different concentrations of aromatic amino acids.

[0074]

Claims

1. A method for improving the efficiency of soybean genetic transformation based on a glyphosate screening system, characterized in that, The method involves adding aromatic amino acids to the shoot elongation medium during the shoot elongation culture stage of soybean genetic transformation mediated by Agrobacterium using glyphosate as a screening agent, thereby improving the efficiency of soybean genetic transformation. The aromatic amino acids include tryptophan, phenylalanine, and tyrosine, with a final addition concentration of 300-600 μmol / L for each.

2. The method as described in claim 1, characterized in that, The aromatic amino acids consist of 400-600 μmol / L tryptophan, 300-500 μmol / L phenylalanine, and 300-500 μmol / L tyrosine, and the concentration is the final concentration added to the shoot elongation medium.

3. The method as described in claim 2, characterized in that, The aromatic amino acid is composed of 500 μmol / L tryptophan, 400 μmol / L phenylalanine, and 400 μmol / L tyrosine.

4. The method as described in claim 1, characterized in that, The soybeans include grain soybeans and fresh soybeans.

5. The method as described in claim 4, characterized in that, The varieties of grain soybeans mentioned include, but are not limited to, Tianlong No. 1, William 82 and Zhongdou 43; the varieties of fresh soybeans include, but are not limited to, Zhexian No. 8, Huning 95-1 and Nannong 30.

6. The method as described in claim 1, characterized in that, The final concentration composition of the shoot elongation medium was as follows: 4.33 g / L MS basal salt mixture, 1.0 g / L 2-morpholine ethanesulfonic acid, 30 g / L sucrose, 3.5 mL / L iron salt solution, 75 mg / L L-glutamine, 75 mg / L L-aspartic acid, 1 mL / L vitamin B5, 1 mg / L zeatin riboside, 400 mg / L termethin, 0.2 mg / L gibberellin, 0.1 mg / L indoleacetic acid, and 10 mg / L glyphosate, in 7.5 g / L agar, with deionized water as the solvent and pH 5.6; the iron salt solution was a 13 g / L EDTA-FeNa aqueous solution.

7. The method as described in claim 1, characterized in that, The soybean genetic transformation method uses a glyphosate-tolerant gene as a screening marker gene and glyphosate as a screening agent.

8. The method as described in claim 1, characterized in that, The glyphosate-resistant gene is selected from one of the following genes: OsmEPSPS, GAT, GOX, G10, and CP4.

9. The method as described in claim 1, characterized in that, The soybean genetic transformation was carried out according to the following steps: (1) Sterilization: Select healthy, plump, and mature soybeans and sterilize them in a desiccator filled with chlorine for 16 hours; (2) Germination: After sterilization, soybeans were sown into germination medium in a clean bench and cultured at 25°C for 1 day; the bean sprouts with the hypocotyl removed were cut in half lengthwise so that both explants had cotyledons and epicotyls; the explants were cut 3-5 times at the nodes of the cotyledons and epicotyls; the final concentration of the germination medium was: B5 basal medium 3.21 g / L, sucrose 30 g / L, plant gel 3.2 g / L, solvent was deionized water, pH 5.8; (3) Infection: The prepared explants were immersed in Agrobacterium tumefaciens containing the target gene and co-cultured at 28°C for 10-30 minutes; then, the excess bacterial solution on the explants was absorbed with absorbent paper and transferred to CCM medium and incubated in the dark at 22°C for 3-5 days; the final concentration of CCM medium was: B5 basal medium 3.21 g / L, 2-morpholine ethanesulfonic acid 2.5 g / L, sucrose 20 g / L, glucose 10 g / L, B5 vitamin 1 mL / L, acetylsuccinone 80 mg / L, dithiothreitol 300 mg / L, the solvent was deionized water, and the pH was 5.4; (4) Recovery: The explants cultured in step (3) were transferred to the recovery medium and cultured at 26℃ for 7 days, with 16 h of light and 8 h of darkness per day; the final concentration of the recovery medium was: 3.21 g / L of B5 basal medium, 1.0 g / L of 2-morpholine ethanesulfonic acid, 30 g / L of sucrose, 4 mL / L of iron salt solution, 125 mg / L of L-glutamine, 125 mg / L of L-aspartic acid, 1 mL / L of B5 vitamin, 6.8 g / L of agar, 2 mg / L of zeatin riboside, and 400 mg / L of termethin, with deionized water as the solvent and pH 5.6; the iron salt solution was a 13 g / L EDTA-FeNa aqueous solution; (5) Screening: The explants after co-culture in step (4) were transferred to a screening medium containing 20 mg / L glyphosate and cultured at 26°C for 21 weeks under light, with 16 h of light and 8 h of darkness per day. The medium was changed every two weeks during this period. The final concentration of the screening medium was as follows: 3.21 g / L B5 basal medium, 1.0 g / L 2-morpholine ethanesulfonic acid, 30 g / L sucrose, 4 mL / L iron salt solution, 125 mg / L L-glutamine, 125 mg / L L-aspartic acid, 1 mL / L B5 vitamin, 6.8 g / L agar, 1 mg / L 6-benzyladenine, 400 mg / L termethin, and 20 mg / L glyphosate. The solvent was deionized water, and the pH was 5.

6. The iron salt solution was a 13 g / L EDTA-FeNa aqueous solution. (6) Elongation: The embryonic tissues selected in step (5) are then transferred to a sprout elongation medium supplemented with aromatic amino acids and cultured at 26°C until they grow into seedlings; (7) Transplanting: Subsequently, the plants were directly transplanted into sterile nutrient soil and moisturized. After being cultivated for one month at a temperature of 26℃, a humidity of 80%, and a light-to-dark ratio of 16 h / 8 h per day, the small plants were cleaned to remove the agar and then planted in a greenhouse.

Images