Method for identifying unilateral incense raw materials in incense base based on molecular biological technology

By combining a modified CTAB method with anion exchange column purification technology and specific PCR amplification, the accuracy and sensitivity issues of natural fragrance raw material identification have been resolved, enabling precise identification of single fragrance raw materials in fragrance bases. This method is applicable to the detection of various plant-derived fragrances.

CN121992070APending Publication Date: 2026-05-08CHINA TOBACCO HUNAN IND CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411586941.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and accurately identifying the characteristic chemical components in natural fragrance raw materials, especially trace components present in complex sample matrices. Furthermore, traditional chemical analysis methods are subject to interference and errors, failing to meet the requirements for accurate identification of single fragrance raw materials in fragrance bases.

Method used

DNA from fragrance base raw materials was extracted using a modified CTAB method combined with anion exchange column purification technology, and identified by specific PCR amplification technology to ensure the purity and concentration of DNA. Target fragrance raw materials were then identified using specific primers.

Benefits of technology

It achieves highly specific and sensitive identification of single fragrance raw materials in fragrance bases, simplifies the detection process, reduces costs, and is applicable to the identification of various plant-derived fragrances.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121992070A_ABST
    Figure CN121992070A_ABST
Patent Text Reader

Abstract

The invention discloses a method for identifying a single incense raw material in an incense base through a molecular biological technology. According to the method, a molecular biology method is used for extracting DNA (Deoxyribose Nucleic Acid) of an incense raw material in an incense base for the first time, and a specific PCR (Polymerase Chain Reaction) amplification technology is used for identifying a target incense raw material. For an essence-based raw material sample which is difficult to treat, high-quality DNA is obtained for PCR (Polymerase Chain Reaction) by utilizing a DNA extraction method of combining an improved CTAB (Cetyltrimethyl Ammonium Bromide) method with anion column purification. The method can accurately detect the existence of the plant-derived perfume raw material in the perfume base, and has the advantages of high specificity, high sensitivity and wide application potential, the detection process is simplified, and the cost is greatly reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fragrance base raw material component identification technology, specifically involving a method for identifying single fragrance raw materials in fragrance bases based on molecular biology technology. Background Technology

[0002] In the flavoring of cigarettes and food, the aroma and effects of a single flavoring agent are relatively easy to grasp. However, compound functional flavor bases obtained by blending multiple single flavoring agents in specific proportions can significantly improve product quality and sensory characteristics. Modular compound functional flavor bases are widely used in cigarette flavoring; therefore, accurate identification of each single flavoring ingredient in the flavor base is crucial for flavoring and stability control. However, the separation and analysis of characteristic chemical components of natural flavoring ingredients and the identification of their formulations face numerous complexities. First, the chemical composition of natural flavoring ingredients is extremely complex, including volatile and non-volatile components, water-soluble, alcohol-soluble, and fat-soluble components. Typically, a single flavoring ingredient contains thousands of components. The composition of different ingredients varies greatly, thus requiring individual analysis and analysis for each ingredient. Second, some important components in natural flavoring ingredients may exist only in extremely small amounts, perhaps as low as parts per million or even lower. Analyzing these trace components requires highly sensitive analytical techniques, and accurate separation and identification in complex sample matrices increases the experimental difficulty. Furthermore, interactions may exist between the chemical components in natural fragrance raw materials, which can affect the accuracy of analytical results. For example, some components may interconvert or decompose during sample preparation or analysis, leading to errors in the analytical results. Additionally, natural fragrance raw materials are typically complex biological samples containing various compounds and impurities, such as oils, proteins, and carbohydrates. These impurities can interfere with the analytical process, affecting the separation and detection of target compounds. Faced with these challenges, there is currently a lack of effective methods for separating and analyzing the characteristic chemical components of natural fragrance raw materials and for formula identification. Therefore, traditional chemical analysis methods suffer from significant identification difficulties and insufficient accuracy due to the complexity and diversity of fragrance base components.

[0003] Therefore, this invention proposes for the first time a single-component identification method for fragrance base raw materials based on molecular biology technology. This method improves accuracy, sensitivity, and specificity while significantly simplifying the detection process and saving manpower and material costs. Since molecular biology technology involves DNA extraction, although the CTAB method is currently the most common method for plant DNA extraction, the quality and effectiveness of the extraction are affected by the sample state. This can result in the extracted DNA still containing RNA, protein, or other contaminants, affecting subsequent DNA analysis or applications. The fragrance raw materials analyzed undergo multiple processes such as steaming, boiling, extraction, or baking during production, which damages the DNA to varying degrees. Furthermore, the addition of food additives such as sugar, salt, oil, pigments, and organic matter further complicates DNA extraction. Common problems with existing methods for nucleic acid extraction include: low product concentration, significant differences in the 260 / 280 concentration between different states of fragrance raw materials, with many values ​​being significantly lower, indicating contamination by proteins, phenols, etc.; secondly, the extracted nucleic acid product is not clear and transparent, but rather a brownish-caramel color, and the impurities it contains can severely affect downstream reactions such as sequencing and PCR. Summary of the Invention

[0004] The purpose of this invention is to address the problems existing in the prior art by providing a method for identifying single fragrance ingredients in fragrance bases using molecular biology techniques. This method is the first to utilize molecular biology to extract DNA from fragrance ingredients in fragrance bases and then identify the target fragrance ingredients using specific PCR amplification technology. For fragrance ingredient samples that are difficult to process, a modified CTAB method combined with anion exchange column purification is used to extract high-quality DNA for PCR reactions, ultimately yielding more accurate results. Furthermore, the detection process is simplified, and costs are significantly reduced.

[0005] A method for identifying single fragrance raw materials in fragrance bases based on molecular biology techniques, including the extraction of DNA from fragrance raw materials and detection by PCR reaction.

[0006] The extraction steps for the fragrance base raw material DNA are as follows: (1) Add 2g of fragrance base material to a centrifuge tube and vortex to fully disperse the sample; (2) Add 4 μL of 10 mg / ml RNase A to the centrifuge tube, vortex to mix, and let stand at room temperature for 5 min; (3) Add 40 μL of 20 mg / mL Proteinase K to the above mixture and incubate at 50 °C for 1 h, shaking and mixing multiple times during the incubation process; (4) Add 500 μL of lysis buffer and lyse at 60°C for 30 min. Add 700 μL of chloroform to a centrifuge tube and vortex vigorously for 30 seconds. The lysis buffer formula is: 2% CTAB, 100 mmol / L Tris-HCl at pH 8.0, 20 mmol / L EDTA, and 1.4 mol / L NaCl. (5) Centrifuge at 12,000 rpm at room temperature for 5 minutes. The solution will separate into three layers. Carefully transfer the supernatant to a new 2 ml centrifuge tube. Accumulate in 5 tubes. (6) Add an equal volume of isopropanol and invert the centrifuge tube to mix thoroughly; (7) Transfer the above solution to an anion exchange column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate; (8) Add 500 μl of 75% ethanol to the anion exchange column and rinse twice. Centrifuge at 12,000 rpm at room temperature for 1 minute. (9) Place the anion exchange column into a new 2 ml collection tube, centrifuge, and thoroughly dry the membrane; (10) Place the anion exchange column on a new 1.5 ml centrifuge tube, add 50 μl of sterile ultrapure water elution buffer to the center of the membrane, let stand, and then centrifuge at 12000 rpm for 2 min to collect DNA. The eluted DNA can be used directly or stored at -20℃.

[0007] The PCR reaction system comprises the following components: Deionized H2O: 38ul; 10×Taq Buffer: 5ul; dNTP Mix: 1ul; Template DNA: 2ul; Primer F: 2ul; Primer R: 2ul; Total 50ul.

[0008] The procedure for the PCR reaction is as follows: 95℃, 5min; 95℃, 30s; 61℃, 1min; 72℃, 20s, cycle 35 times; 72℃, 5min; store at 4℃ for less than 4h.

[0009] The agarose gel method used for detecting the results after the PCR reaction is as follows: 2% agarose gel is prepared, and after the gel solidifies, electrophoresis is performed at a constant voltage of 120V for 30 minutes.

[0010] Furthermore, the primers used in the PCR reaction are designed based on the plant from which the component to be detected originates.

[0011] This invention uses hawthorn flavoring as an example to demonstrate the specific application process of this method, which is applicable to the identification of active ingredients in other plant-derived flavorings.

[0012] The primer pair sequences for detecting hawthorn-derived components are as follows: haw-F: CGACCCGAGAACCAGTTTTCA; haw-R:TCTTCATCGATGCGAGAGCC.

[0013] This invention determines whether a fragrance base contains a specific single-ingredient fragrance ingredient by analyzing the PCR amplification results.

[0014] Advantages of this invention: 1. High specificity: This invention achieves accurate identification of single fragrance raw materials (of a certain plant origin) in fragrance base through specific PCR amplification, avoiding interference from complex chemical components.

[0015] 2. High Sensitivity: Traditional chemical methods for analyzing fragrance raw materials mostly employ gas chromatography or mass spectrometry to determine the presence of certain species by analyzing and quantifying specific compounds or monomers. These methods have limitations because a particular metabolite can be associated with multiple plants, and the association between metabolites and species is not one-to-one, making it difficult to identify a specific plant for a particular substance. The method combining DNA extraction and PCR amplification can detect the presence of specific fragrance raw materials in extremely small amounts of sample, with a sensitivity far exceeding that of traditional chemical analysis methods.

[0016] 3. Wide range of applications: This method is not only applicable to the identification of hawthorn flavoring raw materials, but can also be extended to the detection of other plant-derived flavoring raw materials. This method has broad application potential, such as providing guidance for the addition of flavorings in the cigarette industry. Attached Figure Description

[0017] Figure 1 Schematic diagram of DNA extraction process for fragrance samples; Figure 2 Schematic diagram of PCR primer amplification; Figure 3 Electrophoresis diagram of PCR amplification products shows the detection results of hawthorn flavoring raw material.

[0018] A represents the amplification result of Example 1; B represents the amplification result of Example 3. Detailed Implementation

[0019] The following examples are intended to further illustrate the present invention, but not to limit it.

[0020] The DNA extraction and identification process for fragrance samples in this invention is as follows: 1. Sample pretreatment: The fragrance base is sampled and subjected to necessary pretreatment. Samples suitable for DNA extraction are obtained according to the different treatment methods in Examples 1, 2 and 3.

[0021] 2. DNA extraction: DNA was extracted from the treated samples using Examples 1, 2, and 3. The extracted DNA samples were then analyzed for quality and concentration using an ultra-micro spectrophotometer.

[0022] 3. PCR amplification: The DNA products extracted in Examples 1 and 3 (the extraction method in Example 2 was not effective, and the extraction concentration was almost negligible, so no further amplification was performed) were used for PCR amplification to identify the extraction quality. The primers used are shown in the primer table.

[0023] Since the sample solution involved in this invention is mainly derived from plants, the CTAB method (Cetyltrimethylammonium bromide) is a chemical method for extracting and purifying nucleic acids. This method uses cetyltrimethylammonium bromide as the extraction reagent and is primarily used to extract DNA from plant tissues or other organic matter. It is a centrifugation-centrifugation method that progressively extracts DNA while removing impurities such as cell membranes and proteins. This method relies on the formation of a complex by CTAB binding to DNA and uses phenol / chloroform extraction to distinguish nucleic acids from other components. Compared to other DNA extraction methods, the CTAB method is more effective for processing plant samples, especially those rich in polyphenols, effectively removing proteins, polyphenols, and other impurities, thereby improving the purity of the extracted DNA. Although the CTAB method is currently the most widely used plant DNA extraction method, it is suitable for extracting DNA from large sample volumes but not for low-volume DNA extraction. Furthermore, in some cases, the extracted DNA may still contain RNA, proteins, or other contaminants, affecting subsequent DNA analysis or applications. The flavor base sample solution used in this invention undergoes multiple processes such as steaming, boiling, extraction, or baking during its preparation, which damages the DNA in the raw materials to varying degrees. Furthermore, the addition of food additives such as sugar, salt, oil, and coloring further complicates DNA extraction. In addition, the target DNA content in the flavor base is extremely low, and sequencing requires extremely high DNA purity; therefore, the conventional CTAB method is not suitable for extracting target DNA from the sample solution.

[0024] Therefore, this invention explores a modified CTAB method and further introduces anion exchange chromatography (AEC) for DNA purification, forming a modified CTAB method combined with anion exchange column purification for DNA extraction and purification. The modified CTAB method, based on the basic CTAB method, eliminates the need for phenol / chloroform extraction in the buffer system and protease used for extracting DNA from processed raw materials, making it more suitable for DNA extraction. It is safe and fast, and can maximize the removal of impurities such as proteins, lipids, and other organic compounds from food. To ensure DNA purity, this invention also investigates anion exchange technology. Based on the negatively charged nature of DNA, the separation and purification of DNA are achieved through the interaction between DNA and anion exchange groups on a positively charged solid material.

[0025] The anion exchange column used in this embodiment of the invention is a QIAGEN Genomic-tips-100 / G.

[0026] Example 1 (1) Take 10g of fragrance base raw material solution, mix it evenly, add 30 mL of PBS to a 50mL centrifuge tube, mix to homogenize it, add 1xPBS buffer to a 50mL centrifuge tube, mix thoroughly, centrifuge at 12,000 rpm and discard the supernatant; (2) Add 10 mL of 0.1 M Tris HCl, mix thoroughly, centrifuge at 12,000 rpm, and discard the supernatant again; (3) Add 1.5 mL of resuspension buffer and 60 µL of Proteinase K to the precipitate obtained above, incubate at 56 °C for 1 h, and use a cell disruptor for 10 min (20% power) during the incubation. (4) Add 600 µL of isopropanol, mix thoroughly, vortex for 1 min, let stand at room temperature for 10 min, centrifuge at 12,000 rpm (~13,400×g) for 5 min, and transfer the supernatant to a new centrifuge tube; (5) Add 8 µL of carrier RNA to the supernatant, mix thoroughly, and then pass through the column; (6) Wash the column with wash-buffer, then elute the DNA with elution buffer preheated to 50 °C and collect it into a centrifuge tube; (7) Add 0.7 times the volume of isopropanol to the collected liquid, mix thoroughly, centrifuge, carefully discard the supernatant, add 700µL of 70% ethanol, vortex for 5 s to wash, centrifuge at 12,000 rpm (~13,400×g) for 2 min, discard the supernatant, and repeat the step. (8) After the alcohol has been thoroughly dried, dissolve the precipitate in 30 µL of deionized sterile water.

[0027] DNA extraction concentration and quality assessment

[0028] Example 2: DNA extraction from supernatant and purification using an exchange column Experimental methods

[0029] (1) Take 10g of fragrance base raw material solution, mix it evenly, add 30 mL of PBS to a 50mL centrifuge tube, mix to homogenize it, centrifuge at 12000rpm for 10min, take the supernatant, add 20 μL of 10mg / ml RNaseA to it, vortex mix, and let it stand at room temperature for 5min. (2) Add 200 μL Proteinase K (20 mg / mL) to the above mixture and incubate for 1 h (50 °C), shaking and mixing multiple times during the incubation process; (3) Add an equal volume of isopropanol and invert the centrifuge tube to mix thoroughly; (4) Transfer the above solution to an anion exchange column, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate; (5) Add 500 μl of 75% ethanol to the anion exchange column and rinse twice. Centrifuge at 12,000 rpm at room temperature for 1 minute. (6) Place the anion exchange column into a new 2 ml collection tube, centrifuge, and thoroughly dry the membrane; (7) Place the anion exchange column on a new 1.5 ml centrifuge tube, add 50 μl of sterile ultrapure water elution buffer to the center of the membrane, let stand, and then centrifuge at 12000 rpm for 2 min to collect DNA. The eluted DNA can be used directly or stored at -20℃.

[0030] DNA extraction concentration and quality assessment

[0031] Example 3: Highly Fragmented DNA Extraction and Enrichment Method Based on Modified CTAB Method Experimental methods

[0032] (1) Take 2g of the well-mixed fragrance base raw material and add it into a centrifuge tube. Vortex the sample to disperse it fully. (2) Add 4 μL of 10 mg / ml RNase A to the centrifuge tube, vortex to mix, and let stand at room temperature for 5 min; (3) Add 40 μL of 20 mg / mL Proteinase K to the above mixture and incubate at 50 °C for 1 h, shaking and mixing multiple times during the incubation process; (4) Add 500 μL of lysis buffer and lyse at 60°C for 30 min. Add 700 μL of chloroform to a centrifuge tube and vortex vigorously for 30 seconds. The lysis buffer formula is: 2% CTAB, 100 mmol / L Tris-HCl at pH 8.0, 20 mmol / L EDTA, and 1.4 mol / L NaCl. (5) Centrifuge at 12,000 rpm at room temperature for 5 minutes. The solution will separate into three layers. Carefully transfer the supernatant to a new 2 ml centrifuge tube. Accumulate in 5 tubes. (6) Add an equal volume of isopropanol and invert the centrifuge tube to mix thoroughly; (7) Transfer the above solution to an anion exchange column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate; (8) Add 500 μl of 75% ethanol wash solution to the anion exchange column and rinse twice. Centrifuge at 12,000 rpm at room temperature for 1 minute. (9) Place the anion exchange column into a new 2 ml collection tube, centrifuge, and thoroughly dry the membrane; (10) Place the anion exchange column on a new 1.5 ml centrifuge tube, add 50 μl of sterile ultrapure water elution buffer to the center of the membrane, let stand, and then centrifuge at 12000 rpm for 2 min to collect DNA. The eluted DNA can be used directly or stored at -20℃.

[0033] DNA extraction concentration and quality assessment

[0034] Extraction method comparison: Examples 1 and 2 required a larger volume of feed solution for DNA extraction, resulting in a lower extraction concentration compared to Example 3. Furthermore, the extracts from the two examples with better extraction results were amplified and identified to compare the extraction methods. Hawthorn-specific primers were designed, and the primer sequences are shown in the table below: (Results are shown in...) Figure 3 )

[0035] 1. The PCR reaction system was as follows: deionized H2O: 38 μL; 10×Taq Buffer: 5 μL; dNTP Mix: 1 μL; template DNA: 2 μL; primer F: 2 μL; primer R: 2 μL; total 50 μL. 2. The reaction conditions were: 95℃ for 5 min; [95℃ for 30 sec; 61℃ for 30 sec; 72℃ for 20 s;] - 35 cycles of 72℃ for 5 min.

[0036] 3. The amplification products were detected by 2% agarose gel electrophoresis, and the results are shown in the attached figures.

[0037] 4. Result Confirmation: PCR amplification results were analyzed to verify the presence of hawthorn flavoring in the flavor base.

[0038] The concentrations and purities extracted in Examples 1 and 2 were not as high as those in Example 3. In particular, Example 2 only extracted the supernatant, resulting in a very low concentration of only 2.2 ng / uL. Due to issues with concentration and purity, such as the presence of impurities that could affect downstream polymerase chain reaction (PCR) amplification, Example 1 did not amplify the target fragment. Only Example 3 amplified the target fragment.

Claims

1. A method for identifying single-ingredient fragrance raw materials in fragrance bases based on molecular biology techniques, characterized in that, This includes the extraction of DNA from the fragrance base and the detection via PCR reaction.

2. The identification method according to claim 1, characterized in that, The extraction steps for the fragrance base raw material DNA are as follows: (1) Add 2g of fragrance base material to a centrifuge tube and vortex to fully disperse the sample; (2) Add 4 μL of 10 mg / ml RNase A to the centrifuge tube, vortex to mix, and let stand at room temperature for 5 min; (3) Add 40 μL of 20 mg / mL Proteinase K to the above mixture and incubate at 50 °C for 1 h, shaking and mixing multiple times during the incubation process; (4) Add 500 μL of lysis buffer and lyse at 60°C for 30 min. Add 700 μL of chloroform to a centrifuge tube and vortex vigorously for 30 seconds. The lysis buffer formula is: 2% CTAB, 100 mmol / L Tris-HCl at pH 8.0, 20 mmol / L EDTA, and 1.4 mol / L NaCl. (5) Centrifuge at 12,000 rpm at room temperature for 5 minutes. The solution will separate into three layers. Carefully transfer the supernatant to a new 2 ml centrifuge tube. Accumulate in 5 tubes. (6) Add an equal volume of isopropanol and invert the centrifuge tube to mix thoroughly; (7) Transfer the above solution to an anion exchange column, centrifuge at 12000 rpm at room temperature for 1 minute, and discard the filtrate; (8) Add 500 μl of 75% ethanol to the anion exchange column and rinse twice. Centrifuge at 12,000 rpm at room temperature for 1 minute. (9) Place the anion exchange column into a new 2 ml collection tube, centrifuge, and thoroughly dry the membrane; (10) Place the anion exchange column on a new 1.5 ml centrifuge tube, add 50 μl of sterile ultrapure water elution buffer to the center of the membrane, let stand, and then centrifuge at 12000 rpm for 2 min to collect DNA. The eluted DNA can be used directly or stored at -20℃.

3. The identification method according to claim 1, characterized in that, The PCR reaction system comprises the following components: Deionized H2O: 38ul; 10×Taq Buffer: 5ul; dNTP Mix: 1ul; Template DNA: 2ul; Primer F: 2ul; Primer R: 2ul; Total 50ul.

4. The identification method according to claim 1, characterized in that, The procedure for the PCR reaction is as follows: 95℃, 5min; 95℃, 30s; 61℃, 1min; 72℃, 20s, cycle 35 times; 72℃, 5min; store at 4℃ for less than 4h.

5. The identification method according to claim 1, characterized in that, The agarose gel method used for detecting the results after the PCR reaction is as follows: 2% agarose gel is prepared, and after the gel solidifies, electrophoresis is performed at a constant voltage of 120V for 30 minutes.

6. The identification method according to claim 1, characterized in that, The primers used in the PCR reaction were designed based on the plant from which the component to be detected originated.

7. The identification method according to claim 6, characterized in that, The primer pair sequences for detecting hawthorn-derived components are as follows: haw-F: CGACCCGAGAACCAGTTTTCA; haw-R:TCTTCATCGATGCGAGAGCC.