SSR (Simple Sequence Repeat) molecular marker of new variety of mulberry 'Yunnan mulberry 9' as well as core primer group, kit and application of SSR molecular marker
By providing specific SSR molecular markers MASSR037 and MASSR063 and their core primer sets for the new mulberry variety 'Yun Sang 9', and combining PCR amplification and electrophoresis analysis, the instability and environmental dependence of the identification of the new mulberry variety 'Yun Sang 9' were solved, and rapid and accurate variety identification and seedling purity detection were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- RES INST OF SILKWORM & HONEYBEE YUNNAN ACAD OF AGRI SCI
- Filing Date
- 2026-02-11
- Publication Date
- 2026-05-08
AI Technical Summary
The lack of specific molecular identification markers for the new mulberry variety 'Yun Sang 9' in the current technology makes it impossible to quickly and accurately identify the purity of the seedlings of this variety through molecular biology methods, which affects the protection of variety rights and the management of seedling quality.
We provide specific SSR molecular markers MASSR037 and MASSR063 and their core primer set for the new mulberry variety 'Yun Sang 9'. Combined with PCR amplification and electrophoresis analysis, we can achieve rapid and accurate identification of 'Yun Sang 9'.
It enabled rapid and accurate identification of 'Yun Sang 9', solved the problems of instability and environmental dependence in variety identification, and ensured the effectiveness of variety rights protection and seedling quality management.
Smart Images

Figure CN121992136A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of crop variety identification technology, specifically to an SSR molecular marker for a new mulberry variety, 'Yun Sang 9', along with its core primer set, reagent kit, and applications. Background Technology
[0002] Moraceae plant mulberry ( Morus alba The leaves of *L.* are rich in protein and other nutrients, making them a primary feed source for silkworms, a special economic animal. They can also be used as feed for cattle, sheep, chickens, and other livestock and poultry. The mature fruit clusters are important berries in daily life. The development of the industry relies heavily on the support of superior mulberry varieties, and the large-scale promotion and application of these superior varieties requires robust identification and rights protection for new varieties.
[0003] The new mulberry variety 'Yun Sang No. 9' is a new mulberry variety developed by the Yunnan Academy of Agricultural Sciences' Sericulture and Bee Research Institute. It was bred using the commonly used mulberry variety Nong Sang No. 14 as the male parent and Yun Sang No. 8 as the female parent. After hybridization of the two parents, single plants were selected and their adaptability and resistance were observed and tested. It was then directionally cultivated for 5 years. In 2023, it passed the Yunnan Provincial Crop Variety Approval (Dianjian (Mulberry) 2023021). It has now been submitted as a leading variety in Yunnan Province. This variety has high yield and excellent traits. Compared with Yun Sang No. 5, it is more suitable for cultivation in areas with higher altitudes. It is a variety bred to adapt to the three-dimensional climate of Yunnan Province. It has good resistance to brown spot disease and has been well received by the public during the promotion process. However, the promotion of this variety has been hindered because the seedlings are not easy to distinguish from other seedlings and are confused with other varieties. There is no more reliable identification method, and the economic losses caused by incorrect planting have been hindered. This variety is characterized by its compact crown, numerous shoots, medium-thick, long, straight branches with slightly curved internodes, bluish-gray bark, relatively dense internode spacing, 3 / 8 leaf arrangement, large and numerous lenticels with occasional linear lenticels, strong anthocyanin color on the surface of new shoots, robust terminal buds, long triangular winter buds with brown markings, heart-shaped leaves, dark green color, thick and soft leaves with a strong luster. Leaves are 26-30 cm long and 20-25 cm wide. It is easily identifiable, inheriting the advantages of both parent varieties. It boasts high yield, strong resistance to brown spot disease, vigorous growth, tolerance to heavy watering and fertilization, strong shoot development, and tolerance to pruning. It sprouts early; in Mengzi City, Yunnan Province, sprouting occurs in late January, leafing in early February, and leaf maturity in mid-April. It is an early- to mid-maturing variety with wide climatic adaptability, suitable for cultivation in silkworm-producing areas of Yunnan Province at altitudes of 600-2000 m, and performs particularly well in cooler regions.
[0004] During the promotion of the new mulberry variety 'Yun Sang No. 9', the difficulty in distinguishing it from other varieties in the seedling stage due to its external morphological characteristics makes effective supervision and arbitration difficult in cases of counterfeit products, severely hindering its promotion and utilization. Therefore, there is an urgent need to find a simple, rapid, and effective identification method that is genuine, effective, unaffected by environmental factors, and can accurately distinguish this variety.
[0005] Traditional mulberry variety identification primarily relies on phenotypic traits, which are highly susceptible to environmental influences, exhibit poor stability, and require lengthy testing periods, severely impacting the effectiveness and authority of variety identification. Molecular marker technology, due to its high polymorphism, short testing period, and insensitivity to environmental factors, has become an important tool for variety identification and protection. Simple sequence repeats (SSRs), in particular, possess advantages such as co-dominance, good repeatability, ease of detection, and simple operation; therefore, SSR molecular markers can play a significant role in the evaluation and identification of mulberry variety specificity.
[0006] The lack of specific molecular identification markers and corresponding testing products for the new mulberry variety 'Yun Sang 9' in the existing technology makes it impossible to quickly and accurately identify the purity of the seedlings of this variety through molecular biology methods, which makes it difficult to meet the technical requirements for variety rights protection and seedling quality management. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of existing technologies in accurately identifying the new mulberry variety 'Yun Sang 9', and to provide specific SSR molecular markers, core primer sets, kits, and identification methods for this variety.
[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0009] An SSR molecular marker for identifying the new mulberry variety 'Yun Sang 9' comprises SSR molecular markers MASSR037 and / or MASSR063; the repeating motif of the SSR molecular marker MASSR037 is (TAAA)n, where n≥5, and its 5' flanking sequence is shown in SEQ ID NO.5, and its 3' flanking sequence is shown in SEQ ID NO.6; the repeating motif of the SSR molecular marker MASSR063 is (ACA)n, where n≥9, and its 5' flanking sequence is shown in SEQ ID NO.7, and its 3' flanking sequence is shown in SEQ ID NO.8.
[0010] This invention also provides a core primer set for identifying SSR molecular markers of the new mulberry variety 'Yun Sang 9', including primers for SSR molecular marker MASSR037 and / or primers for SSR molecular marker MASSR063:
[0011] The primers for the SSR molecular marker MASSR037 are:
[0012] MASSR037-F: 5'-ATGCCAGGTGGGTTTGTACG-3';
[0013] MASSR037-R: 5'-TATGATGTTGGGCCCCACC-3';
[0014] The primers for the SSR molecular marker MASSR063 are:
[0015] MASSR063-F: 5'-GGGCCCACCATCATCTTCAT-3';
[0016] MASSR063-R: 5'-ATTGCCCGGAAATTCGAC-3';
[0017] Among them, MASSR037-F and MASSR063-F have fluorescent reporter groups labeled at their 5' ends.
[0018] Furthermore, the fluorescent reporter group is FAM, HEX, or TAMRA.
[0019] The present invention also provides the use of the above-described core primer set in the preparation of a kit for identifying the new mulberry variety 'Yun Sang 9'.
[0020] A kit for identifying the new mulberry variety 'Yun Sang 9' includes the aforementioned core primer set.
[0021] The present invention also provides a method for identifying a new mulberry variety, 'Yun Sang 9', comprising the following steps: extracting genomic DNA from the sample to be tested; using the genomic DNA as a template, performing PCR amplification using the primers MASSR037-F / R and / or MASSR063-F / R to obtain PCR products; performing acrylamide gel electrophoresis and capillary electrophoresis on the PCR products; and analyzing the electrophoretic bands to identify whether the sample to be tested is the new mulberry variety 'Yun Sang 9'.
[0022] Furthermore, the analysis of the electrophoretic bands to identify whether the sample is the new mulberry variety 'Yun Sang 9' specifically involves: performing PCR amplification using MASSR037-F / R primers to detect whether two specific bands of 157 bp and 169 bp are generated; or performing PCR amplification using MASSR063-F / R primers to detect whether three specific bands of 279 bp, 288 bp, and 294 bp are generated; if any of the above specific bands are generated, the sample is determined to be 'Yun Sang 9'; if no such specific bands are generated, the sample is determined to be non-'Yun Sang 9'.
[0023] Furthermore, the PCR amplification reaction system is 10.0 μL, including 1.0 μL of 20 ng / μL DNA template, 5.0 μL of 2× TaqPCR Master Mix, 0.5 μL each of 10 μM upstream and downstream primers, and 3.0 μL of ddH2O.
[0024] Furthermore, the PCR amplification reaction conditions are as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, annealing at 62 °C-52 °C (decreasing by 1 °C per cycle) for 30 s, extension at 72 °C for 30 s, for 10 cycles; 95 °C denaturation for 30 s, 52 °C annealing for 30 s, extension at 72 °C for 30 s, for 25 cycles, and finally extension at 72 °C for 20 min.
[0025] This invention also provides the application of the above-mentioned core primer set or kit in the identification of the new mulberry variety 'Yun Sang 9'.
[0026] The present invention has the following beneficial effects:
[0027] This invention screened two core primer pairs, MASSR037 and MASSR063, from 200 candidate SSR primer pairs, enabling accurate identification of 'Yun Sang 9' from 48 control varieties (23 related varieties and 25 commonly promoted varieties nationwide). The MASSR037 primer pair amplified two specific bands of 157 bp and 169 bp, while the MASSR063 primer pair amplified three specific bands of 279 bp, 288 bp, and 294 bp. The amplification results were stable and reproducible. The molecular markers, primer sets, and kits provided by this invention are easy to operate and highly specific, suitable for the identification of 'Yun Sang 9' variety authenticity, seedling purity detection, and variety rights protection, solving the technical problem of the lack of molecular identification methods for this variety. Attached Figure Description
[0028] Figure 1 The results show the SSR amplification of 'Yun Sang 9' and 23 related strains using primer pair MASSR037-F / MASSR037-R.
[0029] Figure 2 The results of SSR amplification of 'Yun Sang 9' and 23 related strains using primer pair MASSR063-F / MASSR063-R are shown.
[0030] Figure 3 The results show the SSR amplification of 'Yun Sang 9' and 25 commonly promoted varieties nationwide using primer pair MASSR037-F / MASSR037-R.
[0031] Figure 4The results show the SSR amplification of 'Yun Sang 9' and 25 commonly promoted varieties nationwide using primer pair MASSR063-F / MASSR063-R. Detailed Implementation
[0032] The following embodiments are further illustrations of the present invention, but not limitations thereof. Specific experimental conditions and methods are not specified in the following embodiments, and the techniques used are generally conventional methods well known to those skilled in the art.
[0033] Example 1: Development of SSR molecular marker core primer set for the new mulberry variety 'Yun Sang 9'
[0034] 1. SSR primer selection
[0035] Genomic sequences in the mulberry genome database were searched using MISA software to identify SSR sites. The length of the retrieved SSR motif repeat units ranged from 2 to 6 nucleotides. Minimum repeat counts for these 2-6 nucleotide repeat motifs were set to 6, 5, 5, 4, and 4 times respectively (i.e., ≥6 times for dinucleotides, ≥5 times for trinucleotides and tetranucleotides, and ≥4 times for pentanucleotides and hexanucleotides), and the length of flanking sequences at the SSR sites was ≥150 bp. SSR primers were designed based on the identified SSR sites, with the following design criteria: primer length 18-25 bp, annealing temperature 52-63 ℃, GC content 40-70%, and PCR product length 100-400 bp. 200 primer pairs were synthesized from randomly selected SSR sites that could be aligned with the NCBI non-redundant protein database. Each primer pair consisted of an upstream primer A and a downstream primer B. Primer sequences were synthesized by BGI Genomics Co., Ltd.
[0036] 2. Extraction of DNA from mulberry varieties
[0037] A preliminary screening was conducted using the new mulberry variety 'Yun Sang 9', the female parent 'Yun Sang 8', the male parent 'Nong Sang 14', and 21 other closely related and phenotypic superior mulberry varieties suitable for both leaf and fruit production, totaling 24 varieties (numbered 1-24, including 15 mulberry varieties or lines with 'Yun Sang 9' parental lineage, these 15 mulberry varieties or lines being closely related to 'Yun Sang 9'; the remaining 8 mulberry varieties or lines being phenotypically similar to 'Yun Sang 9'). The specific mulberry varieties or lines used in the preliminary screening are shown in Table 1 (taken from the Yunnan Provincial Mulberry Germplasm Resource Nursery).
[0038] Table 1. Mulberry varieties or strains used in the preliminary screening
[0039] The specific DNA extraction and detection steps are as follows:
[0040] (1) Add 600 μL of lysis buffer and 1 steel ball to the grinding plate, take an appropriate amount of blades into the grinding plate, add 10 μL of LNase A, grind at 60 Hz for 2 min on the grinder, incubate at 70 ℃ for 30 min, and shake well 2 to 3 times during the process.
[0041] (2) After the incubation is completed, centrifuge at 4000 rpm for 10 min and take 400 μL of supernatant into the extraction plate;
[0042] (3) Add 280 μL of isopropanol to the extraction plate and place it at station 1 of the extraction instrument;
[0043] (4) Dispense 100 μL of magnetic beads into each well of the new extraction plate and place them at station 2 of the extraction instrument. Dispense 500 μL / well of 75% ethanol into each of the three plates and place them at stations 3, 4 and 5 respectively. Dispense 100 μL / 80 μL / 60 μL (the corresponding volume is dispensed according to the sample condition) of the new elution plate into each well and place it at station 6. After checking the instrument condition and extraction plate information, run the program.
[0044] (5) After the operation is completed, remove the elution plate for DNA detection and store it at 4 ℃.
[0045] (6) Concentration and integrity detection: Take 2 μL of DNA stock solution for NanoDrop 8000 detection, and take 2 μL of DNA stock solution with 2 μL of bromophenol blue for agarose gel electrophoresis detection.
[0046] 3. Using the mulberry genomic DNA extracted in step 2 as a template, PCR amplification was performed using the SSR adapter detection technique. The primers included an upstream primer labeled with a fluorescent reporter group (FAM, HEX, or TAMRA) at its 5' end and a downstream primer. The upstream primer was designed and synthesized in step 1, and the downstream primer was also designed and synthesized in step 1. PCR amplification guided by the upstream primer labeled with the fluorescent reporter group at its 5' end produced a fluorescent PCR product.
[0047] The total PCR reaction volume was 10.0 μL, including 1.0 μL of 20 ng / μL DNA template, 5.0 μL of 2 × TaqPCR MasterMix, 0.5 μL each of 10 μM forward and reverse primers, and 3.0 μL of ddH2O.
[0048] The PCR reaction conditions were as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, annealing at 62 °C-52 °C (decreasing by 1 °C per cycle) for 30 s, extension at 72 °C for 30 s, for 10 cycles; 95 °C denaturation for 30 s, 52 °C annealing for 30 s, extension at 72 °C for 30 s, for 25 cycles, and a final extension at 72 °C for 20 min to obtain the amplified product.
[0049] 4. To ensure the specificity of fluorescent PCR amplification and the uniformity of sample concentration for sequencing, after fluorescent PCR amplification, 2.0 μL of PCR product is taken for agarose gel electrophoresis (1% concentration). The band pattern of the PCR product is used to determine the amplification specificity of each SSR primer, and the brightness of the PCR product bands is used to determine the amplification efficiency of each SSR primer. According to the sample sequencing concentration requirements, each fluorescent PCR product is diluted to obtain fluorescent PCR products with uniform concentration, which are then arranged for sequencing.
[0050] Add the fluorescent PCR product diluted to a uniform concentration to the test plate, and add the test reagents according to the following system: 1.0 μL of fluorescent PCR product, GeneScan... TM 500 LIZ 0.5 μL, Hi-Di TM Formamide 8.5 μL. After centrifuging the plate containing the sample and reagents, place it on a PCR instrument and run the denaturation program (95 ℃, 3 min). Cool immediately after denaturation. Refer to the ABI 3730xl operating procedure, select the detection file corresponding to the plate name, and run the SSR sample analysis detection program.
[0051] The screening results showed that 92 polymorphic primer pairs were selected from the 200 primer pairs synthesized in step 1 above. Further selection of core primers with good repeatability and stability, capable of amplifying specific alleles for the new mulberry variety 'Yun Sang 9', yielded primer pairs MASSR037-F / MASSR037-R and MASSR063-F / MASSR063-R, which can be used as specific core primers for identifying 'Yun Sang 9'. The primer sequences are shown in Table 2. The SSR molecular marker corresponding to the core primers MASSR037-F / MASSR037-R is the MASSR037 marker, with a repeat motif of (TAAA)n, n≥5. The left-hand sequence (5' flanking sequence) of this MASSR037 marker is shown in SEQ ID NO.5, and the right-hand sequence (3' flanking sequence) is shown in SEQ ID NO.6. The SSR molecular marker corresponding to the core primers MASSR063-F / MASSR063-R is the MASSR063 marker, whose repeat motif is (ACA)n, n≥9. The left-hand sequence (5' flanking sequence) of the MASSR063 marker is shown in SEQ ID NO.7, and the right-hand sequence (3' flanking sequence) is shown in SEQ ID NO.8.
[0052] Using SSR fluorescent primers MASSR037-F / MASSR037-R as primers, the amplification products of the new mulberry variety 'Yun Sang 9' labeled with MASSR037 showed two specific bands: 157 bp (as shown in SEQ ID NO. 9) and 169 bp (as shown in SEQ ID NO. 10). Using SSR fluorescent primers MASSR063-F / MASSR063-R as primers, the amplification products of the new mulberry variety 'Yun Sang 9' labeled with MASSR063 showed three specific bands: 279 bp (as shown in SEQ ID NO. 11), 288 bp (as shown in SEQ ID NO. 12), and 294 bp (as shown in SEQ ID NO. 10). As shown in NO.13, three specific bands indicate that the new mulberry variety 'Yun Sang 9' can be identified from 'Yun Sang 9' and its 23 related and phenotypic mulberry varieties using only SSR fluorescently labeled primers MASSR037-F / MASSR037-R or MASSR063-F / MASSR063-R. Figure 1 and Figure 2 The fingerprint data is shown in Table 3.
[0053] Table 2 Primer Sequences
[0054] Table 3. Statistical analysis of capillary electrophoresis bands of 24 mulberry varieties or lines using primer pairs.
[0055] Example 2: Application of the SSR molecular marker core primer set for the new mulberry variety 'Yun Sang 9'
[0056] The two pairs of specific core primers for identifying 'Yun Sang 9' obtained from Example 1, MASSR037-F / MASSR037-R and MASSR063-F / MASSR063-R, were further validated. Twenty-five mulberry varieties currently bred nationwide and those with certain commercial applications were selected and simultaneously subjected to amplification and detection with 'Yun Sang 9'. DNA extraction, amplification, and detection methods were the same as in Example 1. The results showed that both pairs of specific core primers could distinguish 'Yun Sang 9' from other varieties. Figure 3 and Figure 4 The amplification-specific alleles of 'Yun Sang 9' and other varieties are shown in Table 4.
[0057] Table 4. Statistics of capillary electrophoresis bands of varieties and strains used in production and promotion for verification.
[0058] The 5' flanking sequence of the SSR molecular marker MASSR037 (SEQ ID NO.5): ATGCCAGGTGGGTTTGTACGTTTGTTTT
[0059] The 3' flanking sequence of the SSR molecular marker MASSR037 (SEQ ID NO.6): ATTAAATTAAAAAAAGCAGAGTTCTTAGCTGTCCGAACGGGAGTAAAACCGAGTAAGAAGAGTAAGGAGTCGGTGGTGGGGCCCAACATCATA
[0060] The 5' flanking sequence of the SSR molecular marker MASSR063 (SEQ ID NO.7): GGGCCCACCATCATCTTCATCTTACGCTACAGGTCCATCGGCGATTCACTT
[0061] The 3' flanking sequence of the SSR molecular marker MASSR063 (SEQ ID NO.8): ACCTTCATCATCACTTCACAACGAATCTAATACTACTACTACTGGTGCATTGAGATCAGGTAATACTACTACTGCTGCTGCGACTACTTCATCAGCTCAGACGACAGTCGTTCGGAACTCCAAGAAGCGGGCCAGAGCTTCGAGAAGAGCACCGACGACGGTTCTGACAACCGACACGTCGAATTTCCGGGCAAT
[0062] MASSR037 product 157 bp (SEQ ID NO.9): ATGCCAGGTGGGTTTGTACGTTTGTTTTTAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAAATTAAATTAAAAAAAGCAGAGTTCTTAGCTGTCCGAACGGGAGTAAAACCGAGTAAGAAGAGTAAGGAGTCGGTGGTGGGGCCCAACATCATA
[0063] MASSR037 product 169 bp (SEQ ID NO.10): ATGCCAGGTGGGTTTGTACGTTTGTTTTTAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAAATTAAATTAAAAAAAGCAGAGTTCTTAGCTGTCCGAACGGGAGTAAAACCGAGTAAGAAGAGTAAGGAGTCGGTGGTGGGGCCCAACATCATA
[0064] MASSR063 product 279 bp (SEQ ID NO.11): GGGCCCACCATCATCTTCATCTTACGCTACAGGTCCATCGGCGATTCACTTACAACAACAACAACAACAACAACAACAACAACAACAACAACCTTCATCATCACTTCACAACGAATCTAATACTACTACTACTGGTGCATTGAGATCAGGTAATACTACTACTGCTGCTGCGACTACTTCATCAGCTCAGACGACAGTCGTTCGGAACTCCAAGAAGCGGGCCAGAGCTTCGAGAA GAGCACCGACGACGGTTCTGACAACCGACACGTCGAATTTCCGGGCAAT
[0065] MASSR063 product 288 bp (SEQ ID NO.12): GGGCCCACCATCATCTTCATCTTACGCTACAGGTCCATCGGCGATTCACTTACAACAACAACAACAACAACAACAACAACAACAACAACAACCTTCATCATCACTTCACAACGAATCTAATACTACTACTACTGGTGCATTGAGATCAGGTAATACTACTACTGCTGCTGCGACTACTTCATCAGCTCAGACGACAGTCGTTCGGAACTCCAAGAAGCGGGCCAGAGCTTCGAGAAGAGCACCGACGACGGTTCTGACAACCGACACGTCGAATTTCCGGGCAAT
[0066] MASSR063 product 294 bp (SEQ ID NO.13): GGGCCCACCATCATCTTCATCTTACGCTACAGGTCCATCGGCGATTCACTTACAACAACAACAACAACAACAACAACAACAACAACAACAAACCTTCATCATCACTTCACAACGAATCTAATACTACTACTACTGGTGC ATTGAGATCAGGTAATACTACTACTGCTGCTGCGACTACTTCATCAGCTCAGACGACAGTCGTTCGGAACTCCAAGAAGCGGGCCAGAGCTTCGAGAAGAGCACCGACGACGTTCTGACAACCGACACGTCGAATTTCCGGGCAAT
[0067] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An SSR molecular marker for identifying the new mulberry variety 'Yun Sang 9', characterized in that, The invention includes SSR molecular markers MASSR037 and / or MASSR063; the repeating motif of the SSR molecular marker MASSR037 is (TAAA)n, where n≥5, and its 5' flanking sequence is shown in SEQ ID NO.5, and its 3' flanking sequence is shown in SEQ ID NO.6; the repeating motif of the SSR molecular marker MASSR063 is (ACA)n, where n≥9, and its 5' flanking sequence is shown in SEQ ID NO.7, and its 3' flanking sequence is shown in SEQ ID NO.
8.
2. A core primer set for SSR molecular markers used to identify the new mulberry variety 'Yun Sang 9', characterized in that, This includes primers for the SSR molecular marker MASSR037 and / or primers for the SSR molecular marker MASSR063: The primers for the SSR molecular marker MASSR037 are: MASSR037-F: 5'-ATGCCAGGTGGGTTTGTACG-3'; MASSR037-R: 5'-TATGATGTTGGGCCCCACC-3'; The primers for the SSR molecular marker MASSR063 are: MASSR063-F: 5'-GGGCCCACCATCATCTTCAT-3'; MASSR063-R: 5'-ATTGCCCGGAAATTCGAC-3'; Among them, MASSR037-F and MASSR063-F have fluorescent reporter groups labeled at their 5' ends.
3. The core primer set according to claim 2, characterized in that, The fluorescent reporter group is FAM, HEX, or TAMRA.
4. Use of the core primer set as described in claim 2 or 3 in the preparation of a kit for identifying the new mulberry variety 'Yun Sang 9'.
5. A reagent kit for identifying the new mulberry variety 'Yun Sang 9', characterized in that, Includes the core primer set as described in claim 2 or 3.
6. A method for identifying a new mulberry variety, 'Yun Sang No. 9', characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested. Using the genomic DNA as a template, PCR amplification was performed using the primers MASSR037-F / R and / or MASSR063-F / R as described in claim 2 to obtain PCR products. The PCR products were subjected to acrylamide gel electrophoresis and capillary electrophoresis; the electrophoretic bands were analyzed to identify whether the sample was the new mulberry variety 'Yun Sang 9'.
7. The method according to claim 6, characterized in that, The analysis of electrophoretic bands to identify whether the sample is the new mulberry variety 'Yun Sang 9' specifically involves: PCR amplification using MASSR037-F / R primers to detect whether two specific bands of 157 bp and 169 bp are generated; or PCR amplification using MASSR063-F / R primers to detect whether three specific bands of 279 bp, 288 bp, and 294 bp are generated. If any of the above specific bands are generated, the sample is determined to be 'Yun Sang 9'; if no such specific bands are generated, the sample is determined to be non-'Yun Sang 9'.
8. The method according to claim 6, characterized in that, The PCR amplification reaction system was 10.0 μL, including 1.0 μL of 20 ng / μL DNA template, 5.0 μL of 2 × TaqPCR Master Mix, 0.5 μL each of 10 μM upstream and downstream primers, and 3.0 μL of ddH2O.
9. The method according to claim 6, characterized in that, The PCR amplification reaction conditions were as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 62 °C-52 °C annealing for 30 s, 72 °C extension for 30 s, for 10 cycles; 95 °C denaturation for 30 s, 52 °C annealing for 30 s, 72 °C extension for 30 s, for 25 cycles, and finally 72 °C extension for 20 min.
10. The application of the core primer set as described in claim 2 or 3 or the kit as described in claim 5 in the identification of the new mulberry variety 'Yun Sang 9'.